Diagnostic potential of LncRNAs-ANRIL and MIAT in the blood of patients with cerebral venous thrombosis

doi:10.21203/rs.3.rs-3088466/v1

Download PDF

Research Article

Diagnostic potential of LncRNAs-ANRIL and MIAT in the blood of patients with cerebral venous thrombosis

https://doi.org/10.21203/rs.3.rs-3088466/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Long non-coding RNAs (LncRNAs) have been implicated as possible circulating stroke indicators. This study focused on the expression status of ANRILand MIAT in cerebral venous thrombosis (CVT) patients.

Methods: In this study, fifty CVT patients and one hundred age/gender-matched individuals as controls were included. The circulating levels of ANRIL and MIATin the first 24 hours after admission were evaluated using the quantitative real-time polymerase chain reaction (RT-PCR) method. We compared the expression levels of ANRIL and MIAT between patients and controls using the independent two-sample t-test. Subgroup analysis was used toinvestigate the association of lncRNAs with clinical characteristics in CVT patients. ROC curve analyses conducted the diagnostic value of two lncRNAs in patient assessment.

Results: The relative expression of lncRNAs ANRILand MIAT significantly decreased in patients compared to the control. ANRILand MIAT showed potential markers for discriminating CVT patients from the healthy controls with an AUC of 0.98 and 0.99, respectively.

Conclusion: For the first time we found downregulation and diagnostic potential of LncRNAs-ANRILand MIAT in the blood of patients with CVT.

Venous thrombosis

Stroke

Long non-coding RNA

ANRIL

MIAT

Gene expression

Cerebral venous thrombosis (CVT) is an uncommon but potentially fatal cerebrovascular disease. It mainly affects young to middle-aged individuals, and more patients are women; approximately 60% of 812 CVT patients from 9 Asian countries were women [1]. However, timely diagnosis and treatment may lead to a less dismal prognosis[2, 3]. CVT is often multifactorial, including female hormones, trauma surgery, pregnancy, puerperium, malignant disease, thrombophilia, inflammation or idiopathic factors[4] .Inflammation is considered an exacerbating and predisposing factor for CVT. The inflammatory reaction leads to localized endothelial injury and hyper-coagulation, which may trigger CVT onset. The aggravation of brain tissue ischemic injury following CVT-induced inflammation can lead to poor clinical outcomes [5, 6].

Long non-coding RNAs (lncRNAs) are RNAs with more than 200 nucleotides without protein-coding capacity, which have shown critical roles in gene regulation [7]. LncRNA antisense non-coding RNA in the INK4 locus (ANRIL) is located on the 9p21.3 loci. ANRIL accelerates atherosclerosis development [8], which plays a prominent role in angiogenesis and thrombosis [9]. A previous study showed the positive association of lncRNA ANRIL expression with inflammatory responses in patients with coronary artery disease [10], intracranial aneurysm, and type 2 diabetes [11]. In the pathogenesis of CVT, prothrombotic conditions and inflammatory responses are identified as two important risk factors for the development and progression of CVT disease [12].

LncRNA-MIAT (myocardial infarction (MI) associated transcript) exhibits up-regulation in ischemic stroke, myocardial infarction, and down-regulation in schizophrenia, diabetic nephropathy, and bone disease [13]. MIAT expression was positively correlated with the pro-inflammatory cytokine levels in myocardial infarction [14], and it was suggested that MI is also associated with a transient increased venous thromboembolism risk [15]. Considering the key role of ANRIL and MIAT in the pathogenesis of inflammation and thrombosis, we can assume that dysregulation of these lncRNAs may be involved in developing CVT.

We aimed to investigate the circulating level of ANRIL and MIAT lncRNAs in CVT patients in countries with a high prevalence of CVT [16].

Study subjects

In this prospective study, a total of 50 consecutive patients with symptoms of CVT who were admitted to the department of neurology of the Namazi hospital, Shiraz, Iran, from June 2020 to June 2021 were selected as study subjects. Inclusion criteria were as follows: (a) definite diagnosis of first acute CVT, (b) in the first week after the onset of CVT symptoms, (c) over 18 years of age, and (d) written informed consent prior to participation.

The diagnosis of CVT was based on the presence of relevant clinical symptoms by expert neurologists/radiologists, and it was confirmed by Computed Tomography (CT), CT venography (CTV), Magnetic resonance imaging (MRI), and/or MR venography (MRV). Exclusion criteria were: (a) all CVT patients with incomplete medical records, (b) patients with other neurological disorders rather than CVT such as hypertensive intracranial hemorrhage, arterial infarcts, brain arteriovenous malformation, cerebral vasculitis without venous-sinus thrombosis, brain aneurysms, reversible vasoconstriction syndrome, toxic and metabolic encephalopathies, and idiopathic intracranial hypertension without evident venous-sinus thrombosis.

The control group was composed of a representative sample of Shiraz’s population which were sex and age-matched with cases. The following variables were assessed: demographic data, predisposing factors for CVT, previous history of venous thrombotic events, and family history of CVT/ DVT.

Routine laboratory tests and specific tests were conducted to find the most probable cause of CVT. These causes include infection, anemia, thrombophilia, hematology, rheumatology, malignancy, sex-specific causes, mechanical tramua, and dehydration.

The institutional review board and ethics committee of Arsanjan Azad University approved the study protocol (Approval Code: IR.IAU.A.REC.1399.021). This study follows the ethical standards of the institutional and national research committee and with the Helsinki Declaration or comparable ethical standards [17]. Data can be shared with other centers upon the approval of the Ethics Committee.

RNA extraction and cDNA synthesis

The patient's blood samples 3 ml were collected in the first 24 hours after admission.

Total RNA was isolated from each sample using a Ribo ex 100ml trizol kit (GeanALL, South Korea) according to the manufacturer’s protocol. The quality of the RNAs was assessed by the optical density (A260/ A280nmratio). The concentration of the extracted RNAs was measured at 260 nm by Nanodrop (Thermo scientific company, USA). All samples had high quality (OD260/280 = 1.8–2.1).

Then extracted RNAs were reverse transcribed to the cDNA pool using the AddScript cDNA Synthesis kit (AddBio, South Korea) in a mixture of oligo-dT and random hexamer primers under the provider's instructions, then cDNAs were stored in -80℃.

Quantitative real-time PCR

Primers for the interesting genes and actin beta gene (ACTβ, used as a housekeeping gene) were designed using Allele ID 7.5 (Premier Biosoft International, Palo Alto, CA). The primer sequences are shown in Table 1. These primers were specific to mRNAs and failed to amplify genomic DNA.

Table 1

Primer sequences of two selected lncRNAs and *ACTβ*.
Genes	Gene ID	Sequences (5´→ 3´)
ANRIL	100048912	Forward	GAGGGTTCAAGCATCACTGTTAG	136
ANRIL	100048912	Reverse	CCCGTCTCTACTGTTACCTCTG	136
MIAT	440823	Forward	GGAGGCTGCGGACGAGTG	227
MIAT	440823	Reverse	AGGAACTTGCTGCTCTCTTGGT	227
ACTβ	60	Forward	GCCTCGCCTTTGCCTATCC	236
ACTβ	60	Reverse	TCTCTTGCTCTGGTCCTCGTC	236

At first, the standard curve was considered for all genes. Quantitative real-time PCR was performed using StepOne Real-Time PCR Systems (ABI Applied Bio-systems, Thermo Fisher Scientific, USA) in a 20-µl total volume using 1X qPCR BIO SyGreen Mix Lo-Rox (PCR Biosystems, UK), 100 ng cDNA and 10 µmol/µl of primers. Real-time PCR amplifications were done as follows: A pre-amplification denaturation was applied at 95°C for 10 min (1 cycle), accompanied by 40 cycles of 95°C for 20 s (denaturation), 58°C for 20 s (annealing), and 72°C for 30 s (extension). All samples were analyzed in duplicate. Melting curve analysis was performed, ramping from 75 to 95°C and rising 1 degree per step to confirm the precision of the PCR reaction. The relative mRNA levels for each individual (patients and controls) were calculated according to the 2^−ΔCt method based on the threshold cycle (Ct) values [18].

Statistical analysis

Data presented are mean ± standard error (SE). Statistical analysis was surveyed using IBM SPSS Statistic v.19 software. For all tests, a P value < 0.05 was considered statistically significant. Expression levels of lncRNAs were compared between patients and controls using an independent student’s t-test. The student’s t-test or Mann–Whitney U test was applied to determine the correlation between the patients' characteristics and gene expression level. ROC curve analyses conducted the diagnostic value of circulating ANRIL and MIAT in patient assessment.

Demographic and clinical characteristics of CVT patients and controls

Fifty patients with CVT (28 females) and 100 healthy controls (56 females) were recruited for this study. Table 2 shows demographics and the relative expression of ANRIL and MIAT in patients and controls.

Table 2

Demographic and clinical characteristics of the participants in the case and control groups.
Variables		Cases (n = 50)	Controls (n = 100)	P-Value
Age (years)		43.44 ± 1.8	43.52 ± 1.2	0.971^b
Sex	Female	28 (56.0%)	56 (56.0%)	1.00^a
	Male	22 (44.0%)	44 (44.0%)	1.00^a
ANRIL relative expression (fold change)		0.204 ± 0.038	1.302 ± 0.049	< 0.001^b
MIAT relative expression (fold change)		0.256 ± 0.039	1.158 ± 0.037	< 0.001^b

Categorical and continuous data are listed as mean ± SE or as number (%). ^aChi-square test; ^bIndependent two-sample t-test. P-Value < 0.05 was regarded as statistically significant.

The levels of lncRNAs ANRIL and MIAT in CVT patients relative to controls

As shown in Fig. 1, The relative expression of LncRNA ANRIL in CVT patients significantly decreased compared to controls (0.204 ± 0.038 vs.1.302 ± 0.049, P < 0.001). We also found significant MIAT down-regulation in CVT patients in comparison with controls (0.2560 ± 0.039 vs. 1.158 ± 0.037, P < 0.001).

Association between lncRNAs ANRIL and MIAT with Clinical Parameters in CVT Patients

The MIAT level showed a significant increase in patients with sex-specific risk factors (female, oral contraceptive, and pregnancy) compared to patients without this risk factor (0.364 ± 0.07, n = 18, vs. 0.205 ± 0.04, n = 32; P = 0.04) (Table 3).

Table 3

Association between lncRNAs *ANRIL* and *MIAT* with demographic and clinical parameters in CVT patients
		N = 50	ANRIL	P-value	MIAT
Age (years)	≤ 40	26	0.165 ± 0.04	0.173	0.315 ± 0.05	0.14
	> 40	24	0.239 ± 0.06		0.205 ± 0.05
Gender	Male	22	0.179 ± 0.05	0.519	0.221 ± 0.05	0.34
	Female	28	0.217 ± 0.05		0.295 ± 0.05
Hypertension	No	43	0.188 ± 0.04	0.460	0.261 ± 0.04	0.95
	Yes	7	0.279 ± 0.11		0.269 ± 0.12
Diabetes	No	45	0.188 ± 0.03	0.489	0.263 ± 0.04	0.94
	Yes	5	0.312 ± 0.15		0.254 ± 0.13
Smoking	No	40	0.198 ± 0.04	0.90	0.269 ± 0.04	0.69
	Yes	10	0.210 ± 0.1		0.234 ± 0.07
Alcohol	No	48	0.195 ± 0.03	0.68	0.257 ± 0.03	0.49
	Yes	2	0.336 ± 0.26		0.391 ± 0.36
Infectious disease	No	39	0.202 ± 0.04	0.770	0.292 ± 0.04	0.145
	Yes	11	0.196 ± 0.06		0.157 ± 0.03
Anemia	No	38	0.175 ± 0.04	0.288	0.245 ± 0.04	0.48
	Yes	12	0.281 ± 0.08		0.316 ± 0.08
Hematology disorders	No	43	0.212 ± 0.04	0.357	0.235 ± 0.04	0.07
	Yes	7	0.132 ± 0.07		0.431 ± 0.1
Rheumatology disorders	No	46	0.206 ± 0.04	0.959	0.263 ± 0.03	0.97
	Yes	4	0.139 ± 0.08		0.256 ± 0.17
Malignancy	No	43	0.207 ± 0.04	0.956	0.265 ± 0.04	0.87
	Yes	7	0.162 ± 0.09		0.247 ± 0.12
CVT family history	No	48	0.207 ± 0.03	0.04	0.263 ± 0.03	0.96
	Yes	2	0.043 ± 0.03		0.254 ± 0.23
Sex-specific	No	32	0.188 ± 0.04	0.65	0.205 ± 0.04	0.04
	Yes	18	0.223 ± 0.06		0.364 ± 0.07
Mechanical trauma	No	45	0.191 ± 3.12	0.900	0.255 ± 0.03	0.56
	Yes	5	0.284 ± 3.90		0.330 ± 0.16
Dehydration	No	46	0.196 ± 0.03	0.80	0.263 ± 0.03	0.97
	Yes	4	0.255 ± 0.21		0.258 ± 0.17
Unrecognized	No	43	0.195 ± 0.03	0.784	0.277 ± 0.04	0.35
	Yes	7	0.235 ± 0.14		0.174 ± 0.04

There were no significant differences between men and women patients in ANRIL and MIAT expression levels after CVT.

Two of the patients had a positive family history for CVT while 48 patients had negative family history for CVT.

Diagnostic Value of circulating lncRNAs ANRIL and MIAT in CVT Patients

ANRIL level showed a potential marker for discriminating CVT patients from the healthy controls with an AUC of 0.98 (95% CI, 0.97–1.005, P < 0.001; Fig. 2a). The corresponding sensitivity and specificity for ANRIL were 94.00% and 99.99%. For MIAT levels, we also found significant discrimination with an AUC score of 0.99 (95% CI, 0.98–1.004, P < 0.001; Fig. 2b), and the corresponding sensitivity and specificity for MIAT were 98.00% and 100%.

In this study we reported for the first time the down-regulation of lncRNAs ANRIL and MIAT in 50 CVT patients relative to controls. Moreover, two lncRNAs (ANRIL and MIAT) were identified as potential markers for CVT diagnosis with an AUC of 0.98 and 0.99, respectively for CVT. In our study, there was no significant association between ANRIL expressions with demographic and CVT risk factors in our patients. Unfortunately, data for identifying CVT severity with the modified Rankin Scale (mRS) were overlooked for many patients. Therefore, we could not estimate the genetic correlation between gene expressions with CVT severity to determine the inflammatory or anti-inflammatory effects of ANRIL and MIAT expression after CVT. According to previous reports, ANRIL gene polymorphisms associate to the IS risk and play a critical role in IS pathogenesis [19]. Moreover, ANRIL rs10965215 showed a good diagnostic accuracy for IS [20]. Also, several studies have identified the potential use of ANRIL as diagnostic biomarker for other disease such as Stroke[21, 22], CHD[23, 24], CAD[25, 26], Cancer[27, 28].

ANRIL overexpression is associated with inflammatory response in IS[29], The possible mechanism involved in pro-inflammatory effect of ANRIL include; increase in NF‑κB expression [30], type I interferon‑mediated signal transduction pathway and innate immune response [31]. On the other hand, the ANRIL downregulation with anti-inflammatory effects has been suggested in inflammatory bowel disease (IBD) [32], attenuating the atherosclerosis progression in CAD patients[8] ,and acute ischemic stroke[33]. Additionally, the association of ANRIL expression on endothelial dysfunction and promotion of thrombosis [34, 35] can represent the possible diagnostic potential of ANRIL for CVT.

We also found significant MIAT down-regulation in CVT patients compared to controls. Moreover, MIAT level in our patients with positive sex-specific risk factor was significantly higher relative to patients with negative sex-specific. Data from several sources have identified the positive association between sex- specific risk factors and CVT severity[36, 37], These results indicated that the possible inflammatory role of ANRIL on CVT.

Previous results confirmed the inflammatory effect of MIAT up-regulation with a positive correlation with disease severity in IS [38, 39], coronary artery disease [40], multiple sclerosis [41], and cancer [42]. The inflammatory mechanisms of MIAT has been suggested to participate in endothelial inflammation, vascular dysfunction [43], vascular leakage and upregulation of IL-1β and IL-6 [44]. However, Wang et al. in 2022 reported an anti-inflammatory effect of lncRNA MIAT in macrophages in synovium and myocardial tissues of collagen-induced arthritis mice [45].

We analyzed the circulating ANRIL and MIAT expression in CVT patients to identify a novel biomarker for CVT. Our results showed that circulating lncRNAs ANRIL and MIAT could be considered CVT biomarkers with an AUC score of 0.98 and 0.99, respectively, with the corresponding high sensitivity and specificity. This pilot study with 50 patients and 100 controls well demonstrated ANRIL and MIAT down-regulation after CVT. But, despite several substantial limitations, such as; retrospective design, small sample size, data obtained from one center, and not evaluating the mRS in admission and 3-month after CVT we cannot definitively report an association between these lncRNAs and CVT severity.

Collectively, this study outlines a possible role for ANRIL lncRNA in CVT. We firstly observed significant ANRIL down-regulation in CVT patients compared to controls. This is a novel finding for CVT disease, which might guide a new direction for future research. We recommend a study with a larger sample size for better evaluation of gene expression and outcome assessment.

Ethics approval and consent to participate:

The institutional review board and ethics committee of Arsanjan Azad University approved the study protocol (Approval Code: IR.IAU.A.REC.1399.021). This study follows the ethical standards of the institutional and national research committee and with the Helsinki Declaration or comparable ethical standards. The statement confirming consent was obtained from all participant samples and it will be available in case of request.

Consent for publication:

Not applicable

Data Availability statement:

All data available by first and corresponding authors on reasonable request

Competing interests:

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding:

Not applicable

Authors' contributions:
Z.Z. the main author and experimental operator.
H.M. , E.T. , Z.Z. major contributor in writing the manuscript.
A.B. , V.O. , N.F. performed the examination CVT patients.
R.T. , B.T. analyzed and interpreted the patient data regarding the neurological disease.
M.R. , S.H. , N.G. Contributed in conducting experiments.

All authors read and approved the final manuscript.

Acknowledgements:

The authors would like to thank Islamic Azad University of Zarghan, Iran; Shiraz University of Medical Sciences, Shiraz, Iran, and the staff of Namazi Hospital.

Wasay, M., et al. Asian study of cerebral venous thrombosis. Journal of Stroke and Cerebrovascular Diseases:2019. 28(10).
Gharamaleki, M.V., et al. The hospitalization rate of cerebral venous sinus thrombosis before and during COVID-19 pandemic era: A single-center retrospective cohort study. Journal of Stroke and Cerebrovascular Diseases: 2022. 31(7).
Shakibajahromi, B., et al. Changes in trend of cerebral venous sinus thrombosis. Current Journal of Neurology: 2019: p. 33-34.
de Freitas, G.R. and J. Bogousslavsky, Risk factors of cerebral vein and sinus thrombosis. Handbook on cerebral venous thrombosis: 2008. 23.
Ding, J., et al. Inflammation in cerebral venous thrombosis. Frontiers in immunology:2022:1148.
Izadi, S., et al. Circulating Levels of Interleukin-10 and-17 in Patients with Cerebral Sinovenous Thrombosis (CSVT) in Acute and Subacute Stages: A Prospective Case-Control Study. Iranian Journal of Immunology:2018. 15(3).
Furlan, G. and C. Rougeulle, Function and evolution of the long noncoding RNA circuitry orchestrating X‐chromosome inactivation in mammals. Wiley Interdisciplinary Reviews: 2016. 7(5).
Su, H., et al., LncRNA ANRIL mediates endothelial dysfunction through BDNF downregulation in chronic kidney disease. Cell Death & Disease: 2022. 13(7).
Zeng, R., et al. LncRNA ANRIL promotes angiogenesis and thrombosis by modulating microRNA-99a and microRNA-449a in the autophagy pathway. American journal of translational research:2019. 11(12).
Hu, Y. and J. Hu. Diagnostic value of circulating lncRNA ANRIL and its correlation with coronary artery disease parameters. Brazilian Journal of Medical and Biological Research: 2019. 52.
Pasmant, E., et al. ANRIL, a long, noncoding RNA, is an unexpected major hotspot in GWAS. The FASEB Journal: 2011. 25(2).
Ulivi, L., et al. Cerebral venous thrombosis: a practical guide. Practical neurology:2020. 20(5).
Sun, C., et al. Long non-coding RNA MIAT in development and disease: a new player in an old game. Journal of biomedical science: 2018. 25(1).
Yan, Z.S., et al. Upregulation of long non‐coding RNA myocardial infarction‐associated transcription is correlated with coronary artery stenosis and elevated inflammation in patients with coronary atherosclerotic heart disease. The Kaohsiung Journal of Medical Sciences:2021. 37(12).
Rinde, L., et al., Impact of incident myocardial infarction on the risk of venous thromboembolism: the Tromsø Study. Journal of Thrombosis and Haemostasis: 2016. 14(6).
Janghorbani, M., et al. Cerebral vein and dural sinus thrombosis in adults in Isfahan, Iran: frequency and seasonal variation. Acta neurologica Scandinavica: 2008. 117(2).
Zhou, X., et al. Long non-coding RNA ANRIL regulates inflammatory responses as a novel component of NF-κB pathway. RNA biology: 2016. 13(1).
Schmittgen, T.D. and K.J. Livak. Analyzing real-time PCR data by the comparative CT method. Nature protocols: 2008. 3(6).
Yang, J., et al. LncRNA ANRIL Expression and ANRIL Gene Polymorphisms Contribute to the Risk of Ischemic Stroke in the Chinese Han Population. Cell Mol Neurobiol: 2018. 38(6).
Fathy, N., et al. Long Noncoding RNAs MALAT1 and ANRIL Gene Variants and the Risk of Cerebral Ischemic Stroke: An Association Study. ACS Chem Neurosci: 2021. 12(8).
Tan, C., et al. Effects of ANRIL variants on the risk of ischemic stroke: a meta-analysis. Bioscience reports: 2019. 39(5).
Yang, J., et al., LncRNA ANRIL expression and ANRIL gene polymorphisms contribute to the risk of ischemic stroke in the Chinese Han population. Cellular and molecular neurobiology: 2018. 38.
Liu, Z., et al. Expression of lncRNA-ANRIL in patients with coronary heart disease before and after treatment and its short-term prognosis predictive value. Eur Rev Med Pharmacol Sci: 2020. 24(1).
Murray, R., et al. DNA methylation at birth within the promoter of ANRIL predicts markers of cardiovascular risk at 9 years. Clinical epigenetics: 2016. 8(1).
Folkersen, L., et al. Relationship between CAD risk genotype in the chromosome 9p21 locus and gene expression. Identification of eight new ANRIL splice variants. PloS one: 2009. 4(11).
Razeghian-Jahromi, I., A. Karimi Akhormeh, and M.J. Zibaeenezhad. The role of ANRIL in atherosclerosis. Disease Markers: 2022.
Kong, Y., C.-H. Hsieh, and L.C. Alonso. ANRIL: a lncRNA at the CDKN2A/B locus with roles in cancer and metabolic disease. Frontiers in endocrinology: 2018. 9.
Lou, N., G. Liu, and Y. Pan. Long noncoding RNA ANRIL as a novel biomarker in human cancer. Future Oncology: 2020. 16(35).
Wufuer, A., et al. ANRIL overexpression globally induces expression and alternative splicing of genes involved in inflammation in HUVECs. Molecular Medicine Reports:2023. 27(2).
Deng, L., et al. Long noncoding RNA ANRIL knockdown attenuates neuroinflammation following ischemic stroke via suppressing the expression of NF-kappaB in vitro and in vivo. Neurol Res: 2021. 43(9).
Wufuer, A., et al. ANRIL overexpression globally induces expression and alternative splicing of genes involved in inflammation in HUVECs. Mol Med Rep: 2023. 27(2).
Xia, H., et al. Long non-coding RNA ANRIL serves as a potential marker of disease risk, inflammation, and disease activity of pediatric inflammatory bowel disease. Clin Res Hepatol Gastroenterol: 2022. 46(4).
Feng, L., J. Guo, and F. Ai. Circulating long noncoding RNA ANRIL downregulation correlates with increased risk, higher disease severity and elevated pro‐inflammatory cytokines in patients with acute ischemic stroke. Journal of clinical laboratory analysis: 2019. 33(1).
Zeng, R., et al. LncRNA ANRIL promotes angiogenesis and thrombosis by modulating microRNA-99a and microRNA-449a in the autophagy pathway. Am J Transl Res: 2019. 11(12).
Su, H., et al. LncRNA ANRIL mediates endothelial dysfunction through BDNF downregulation in chronic kidney disease. Cell Death Dis: 2022. 13(7).
Fernandes, A.M.d.C. Trombose Venosa Cerebral: 2019.
Coutinho, J.M., et al. Cerebral venous and sinus thrombosis in women. Stroke: 2009. 40(7).
Zhang, S., et al. Long non-coding RNA MIAT impairs neurological function in ischemic stroke via up-regulating microRNA-874-3p-targeted IL1B. Brain Research Bulletin:2021. 175.
Zhu, M., et al. Peripheral blood leukocyte expression of lncRNA MIAT and its diagnostic and prognostic value in ischemic stroke. Journal of Stroke and Cerebrovascular Diseases: 2018. 27(2).
Tan, J., et al. LncRNA-MIAT increased in patients with coronary atherosclerotic heart disease. Cardiology research and practice: 2019.
Amiri, M., et al. Expression and diagnostic values of MIAT, H19, and NRON long non-coding RNAs in multiple sclerosis patients. Egyptian Journal of Medical Human Genetics: 2022. 23(1).
Wang, Y., et al. Clinicopathological and prognostic significance of long non-coding RNA miat in human cancers: A review and meta-analysis. Frontiers in genetics: 2021.
Yan, B., et al. lncRNA-MIAT regulates microvascular dysfunction by functioning as a competing endogenous RNA. Circ Res: 2015. 116(7).
Yu, C., et al. Downregulation of Long Noncoding RNA MIAT in the Retina of Diabetic Rats with Tail-vein Injection of Human Umbilical-cord Mesenchymal Stem Cells. Int J Med Sci: 2020. 17(5).
Wang, Z., et al. LncRNA MIAT downregulates IL-1β, TNF-ɑ to suppress macrophage inflammation but is suppressed by ATP-induced NLRP3 inflammasome activation. Cell Cycle: 2021. 20(2).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Diagnostic potential of LncRNAs-ANRIL and MIAT in the blood of patients with cerebral venous thrombosis

Status:

Version 1

Abstract

Figures

Introduction

Material and Methods

Study subjects

RNA extraction and cDNA synthesis

Quantitative real-time PCR

Statistical analysis

Results

Demographic and clinical characteristics of CVT patients and controls

The levels of lncRNAs ANRIL and MIAT in CVT patients relative to controls

Association between lncRNAs ANRIL and MIAT with Clinical Parameters in CVT Patients

Diagnostic Value of circulating lncRNAs ANRIL and MIAT in CVT Patients

Discussion

Declarations

References

Additional Declarations

Status:

Version 1