A study conducted in breast cancer cells found that (valproic acid) inhibits CIP2A/C-MYC/PI3K/Akt/mTOR signaling molecules and PD-L1

doi:10.21203/rs.3.rs-3097920/v1

Download PDF

Research Article

A study conducted in breast cancer cells found that (valproic acid) inhibits CIP2A/C-MYC/PI3K/Akt/mTOR signaling molecules and PD-L1

https://doi.org/10.21203/rs.3.rs-3097920/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Resistant cells are a critical problem that reduce treatment efficacy of breast cancer. Nowadays, CIP2A and PD-L1 are considered as theraputical challenges in breast cancer, because of responsible for drug resistance and immune evasion respectively. Hence, identifying agents to suppress these factors is great of interest. Specifically, epigenetic drugs can be an effective approach to alter the behavior of genes.

Objective

The objective of this study is to evaluate the drug effects and molecular mechanisms of valproic acid (VPA) as a HDAC inhibitor, particularly its effect on CIP2A and PD-L1 in breast cancer MCF-7 cell line.

Materials and Methods

In this study, MCF-7 cells were treated with various concentration of VPA for 24 h, 48 h, and 72 h. The rate of cell viability was measured by MTT assay. Finally, gene expressions of CIP2A, c-MYC, PI3K, Akt, mTOR and PD-L1 were analyzed by real time PCR and ΔCT method.

Result

VPA showed a growth inhibitory effect in MCF-7 cell line. This effect is achieved by decreasing the expression levels of CIP2A oncogene and its downstream signaling molecules i.e. c-MYC, PI3K, Akt and mTOR. In addition to being a CIP2A targeting agent, VPA also inhibits PD-L1 in MCF-7 cell line.

Conclusions

Our findings suggest that VPA can be a novel approach to combat with challenges caused by CIP2A and PD-L1, thereby alone or in combination with existing therapies could be promising strategy to get more efficiencies in treatments for breast cancer patients.

Valproic acid (VPA)

histone deacetylase inhibitor (HDACi)

CIP2A

PD-L1

breast cancer

Breast cancer (BC) is an invasive cancer among females accounting for most cancer-related deaths worldwide (1). Despite major achievements in BC therapy, the emerge of resistance mechanisms has impaired efficacy of treatment strategies. Hence, identifying targeting agents, therapeutic targets, and innovative strategies to improve BC prevention is essential.

Cancerous inhibitor of protein phosphatase 2A (CIP2A) is a well-defined oncogene that promotes tumorigenic signals in cancer by inhibitory impact on the tumor suppressor protein phosphatase 2A (PP2A) (2, 3).Moreover, CIP2A overexpression is associated with therapy resistance and aggressive growth of BC cells, and it accounts a worthwhile survival biomarker for predicting poor prognosis of patients (4–9).CIP2A, either directly or indirectly through interaction with several key cellular molecules/transcription factors involved in critical oncogenic pathways, stimulates tumor cell growth, escape of cell senescence, cell renewal, and inhibits apoptotic death (2, 3).The phosphoinositide-3-kinase/protein kinase B/mammalian target of rapamycin complex 1(PI3K/Akt/mTOR) signaling pathways are negatively regulated by PP2A, but CIP2A causes activation of these molecules in an opposite function through hindering the serine/threonine phosphatase function of PP2A (3, 10–13). In addition, CIP2A has a critical role in the persistency of c-Myc protein through inhibitory activity on PP2A, which results in abnormal proliferation in tumor and BC cells (4, 14, 15).

Programmed death–ligand 1 (PD-L1), also identified as CD274 and B7-H1, regulates adaptive immune response, which is achieved by launching a signal as “don’t find me” to the immune cells (16–18).Recently, the therapeutic inhibition of PD-L1 has been widely applied to promote immune surveillance in clinical practice due to its remarkable results(19, 20). Interestingly, it has been reported that the PP2A target c-MYC is able to regulate immune checkpoint signaling by transactivation of PD-L1 (21), suggesting that CIP2A suppression to reactivate PP2A and subsequentc-MYC degradation may lead to prevention of this factor involved in immune evasion. Furthermore, PP2A, by dephosphorylation of the Tristetraprolin (TTP), which is an mRNA binding protein, dissociates it from 14-3-3(22). TTP causes PD-L1 mRNA to be degraded through binding to mRNA of PD-L1 in AU-rich elements. In addition, PP2A, by inhibition of the MAPK signaling pathways, is led to inhibitory site of TTP to be phosphorylate, thereby regulates TTP(23). Based on the mentioned evidence, PP2A has been shown to be correlated with PD-L1, hence, we hypothesized that CIP2A through suppressing the serine/threonine phosphatase function of PP2A, thereby subsequent inactivation of the associated signaling molecules, might affect PD-L1 expression. Accordingly, CIP2A and PD-L1 as therapeutical challenges can be a worthwhile and promising target for cancer therapy. Hence, identifying agents to suppress these factors is important. Nowadays, epigenetic agents are considered an effective therapeutical approach to alter the behavior of genes.

Several studies have shown the correlation between overexpression of histone deacetylase (HDAC) and attenuation of histone acetylation with poor outcome in multiple tumor types (24–30)Therefore, HDAC enzymes are considered as a promising target for potential drugs to re-activate tumor suppressor genes through triggering epigenetic modification and subsequent transcriptional changes (31–34).Nowadays, Valproic acid (VPA), a short-chain fatty acid (2-propylpentanoic acid), is considered as a HDAC inhibitor with efficient and potent features against cancer (35, 36).Several studies have demonstrated the function of VPA in stimulating tumor cell differentiation, apoptosis, and arrest in cell cycle (35, 37–40).

These findings firmly indicated that VPA, as a HDAC inhibitor, has certain anticancer properties; however, the molecular mechanisms of VPA in BC cells continues to be of interest and remains to be explored. Accordingly, for the first time, we investigated the effect of VPA on CIP2A and PD-L1 in BC MCF-7 cell line.

Drug Preparation

VPA was purchased from Sajad Daru Shargh Pharmaceutical Co (Mashhad, Iran) and a stock solution with concentration of 100 mM/L was prepared by dissolving in culture medium. Subsequent concentrations were made from the stock solution.

Culture of MCF-7 Cell Line and Treatment

The MCF-7 breast cancer cell line purchased from general cell collection bank of Iran(Ferdowsi University, Mashhad, Iran). The MCF-7 cells were cultured in Dulbecco’s modified Eagle’s medium(DMEM, DNAbiotec, Tehran, Iran) supplemented with 10% fetal bovine serum(FBS; DNAbiotec, Tehran, Iran), 100 units/mL penicillin(DNAbiotec, Tehran, Iran), and 100 µg/mL streptomycin(DNAbiotec, Tehran, Iran), in a 37°C humidified incubator containing 5% CO2 in air.Then, cells were seeded in 6 well tissue culture plates and treated with valproic acidat the indicated concentrations (0.1, 1, 4, and 8mM) for various periods of time (24, 48, 72 h). Untreated cells were considered as the control group.

Cell Viability Assay

The 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay was applied to examine cell growth of MCF-7 cells.10⁵ exponentially growing cells/well in 100 µl of culture medium was seeded into a 96-well plate for 24 h prior to experiment at use. Subsequently, cells were treated with valproic acid at various concentrations (0.1, 1, 4, and 8 mM).At the indicated time (24, 48, and 72 h),20 µl of the MTT (5 mg/mL) dye solution was added into the 96-well plate. The cells were then incubated for 4 h at 37°C. After the incubation period, 100 µL of DMSOwas addedtodissolve the formazancrystals. The absorbance at 570 nm was measured for each well using a microplate ELISA reader.Untreated cells were defined as the control group. The viability of treated samples was determined as a percentage of the control samples viability. Each experiment was operated in triplicate.

Real-Time RT-PCR

RNA Extraction and cDNA Synthesis

Total RNA was extracted from the cultured cells using RNA extraction reagent (Parstous, Mashhad, Iran) according to the manufacturer’s instructions. The quantity of RNA samples was assessed using NanoDrop 2000c (BIO INTELLECTICA Nano100, Canada).Synthesis of complementary DNA (cDNA) was performed using, a reverse transcription cDNA Synthesis Kit (Parstous, Mashhad, Iran).

Gene Expression

Real-time PCR using a standard SYBR Green PCR (Amplicon) method was performed on a 7500 Real Time PCR System (ABI-ONE STEP-USA).Briefly, according to protocol instruction, 10µl final reaction consisting of 5 µl SYBR Green master mix, 3 µl deionized distilled water free nuclease, 0.5 µl of each primer, and 1 µl of cDNA was used for PCR reaction with a program consisting of an initial preheating at 95°C for 10 min, followed by denaturation at 95°C for 40 s, 60°C for 30 s, and 72°C for 30 s for a total of 40 cycles, and a final extension at 72°C for 5 min. Data were normalized to an internal control gene(GAPDH). All reactions were done in triplicate. The relative messenger RNA (mRNA) expression fold change was calculated based on the 2^−ΔΔCTmethod.The sequences of the primers used for the analysis of CIP2A, PD-L1, c-MYC, PI3K, AKT, mTOR and GAPDH listed in Table 1.

Table 1

Primer sequences
Gene	Sequence (5'-3') Product Size(bp)
CIP2A	Forward	5´ATACTTCAGGACCCACGTTTGAT3´ 137
CIP2A	Reverse	5´TCTCCAAGTACTAAAGCAGGAAAATCT3´
PD-L1	Forward	5´TCCTGAGGAAAACCATACAGC3´ 97
PD-L1	Reverse	5´GATGGCTCCCAGAATTACCA3´
c-MYC	Forward	5´CCTCAACGTTAGCTTCACCAAC3´ 97
c-MYC	Reverse	5´CTGCTGGTAGAAGTTCTCCTC3´
PI3K	Forward	5´ATGCCTGCTCTGTAGTGGTGG 3´ 165
PI3K	Reverse	5´CATTGAGGGAGTCGTTGTGC 3´
Akt	Forward	5´TTGTCATGGAGTACGCCAACG 3´ 213
Akt	Reverse	5´ACAGCCCGAAGTCTGTGATCTT3´
mTOR	Forward	5´CCAATCATTCGCATTCAGTCC3´ 105
mTOR	Reverse	5´AACAAACTCATGTCCGTTGCTG 3´
GADPH	Forward	5´GAAGGTGAAGGTCGGAGTC3´ 172
GADPH	Reverse	5´GAAGATGGTGATGGGATTTC3´

Statistical Analysis

Two-way analysis of variance with the post hoc Tukey and Dunnett multiple comparison tests were used to compare differences between the control group and the valproic -treated group. Data were provided as mean ± S.E.M. All statistical tests were done using SPSS Ver.26.0 software (SPSS, Inc, Chicago, IL, USA). A p value < 0.05 was considered statistically significant.

VPA Exposure Has an Inhibitory Effect on Cell Proliferation of MCF-7cells

The cell viability of MCF-7 cells treated by various concentrations of VPA (0.1 ~ 8.0 mM/L) for 24, 48 and 72 h of incubation was determined by MTT assay. VPA showed a growth inhibitory effect on MCF-7 cells. As shown in Fig. 1, the cell viabilities of MCF-7 exposed to valproic, decreased in a concentration and time dependent manner compared with the control group.

VPA Decreased the Expression of CIP2A Oncogene in the MCF-7 Cells (at mRNA level)

To explore the molecular mechanism responsible for the effects of VPA and its ability to target CIP2A, qPCR was used to investigate the expression levels of CIP2A oncogene in both of untreated group and MCF-7 cells exposed to various concentration of valproic (0.1,1 ,4, 8mmol/L) for 24 h, 48 h, and 72 h. It was observed that the expression of CIP2A gene was significantly down-regulated in all treated group (0.1, 1, 4, 8 mmol/L)compared with the control group (Fig. 2).In addition ,VPA at 0.1 mM and 4 mM, had been able to significantly reduce the CIP2A gene expression in a time-dependent manner(Fig. 2A, C).Meanwhile, the highest effect of VPA was in 8mM after 24h which could downregulate the mRNA expression levels of CIP2A(Fig. 2D).

VPA Decreased the Expression of C-MYC Gene in the MCF-7 Cells (at mRNA level)

To determine whether the c-MYC is the related mechanism to mediate effects of VPA, therefore the expression level of this gene was evaluated at the mRNA level in MCF-7 cells. As shown in Fig. 3, VPA treatment in all concentrations (0.1, 1, 4 and 8 mM) caused significant reduction in the expression levels of the c-MYC gene. In addition, the findings show that VPA in concentrations of 0.1 and4 mM could time-dependently make significant decrement in expression of c-MYC (Fig. 3A, C).Also, it was found that the decrease in the expression levels of the c-MYC gene has been most noticeable in8mM VPA at 24h (Fig. 3D).

VPA Decreased the Expression of PI3K Gene in the MCF-7 Cells (at mRNA level)

To find out the potential role of PI3K in the effects of VPA, the expression level of this gene measured at the mRNA level in MCF-7 cells. As shown in Fig. 4, significant reduction in PI3K gene expression was detected in all of the VPA- treated groups during the indicated times. In addition, the treatment of MCF-7 with 4mMVPA caused a noticeable decrease in the expression of PI3K gene in a time-dependent manner (Fig. 4C). Morevere, 4Mm VPA at 72h had a most influence on the PI3K gene expression compared with the all other concentrations during the indicated times (Fig. 4C).

VPA Decreased the Expression of Akt Gene in the MCF-7 Cells (at mRNA level)

To determine whether Akt signaling molecule participates in the effects of VPA treatment, the Akt expression levels was measured in MCF-7 cells exposed to different concentration of VPA. Based on results of Fig. 5C, D, a significant reduction in Akt expression was observed in MCF-7 cells treated with 4 and 8 mM of VPA. It should be noted that VPA at 0.1 and 1mM couldn’t make significant change in expression of Akt (Fig. 5A, B). In addition that the treatment of MCF-7 cells with 4 mM VPA caused significant decrease in expression of Akt gene in a time-dependent manner, the most effect of VPA in decrement of expression levels of Akt was in 4 mM after 72hin comparison with the other concentrations (Fig. 5C).

VPA Decreased the Expression of M-TOR Gene in the MCF-7 Cells (at mRNA level)

To ascertain the effect of VPA on the expression level of m-TOR gene at the mRNA level, Real time pcr assay was performed. As shown in Fig. 6, results revealed that VPA significantly decreased the expression of m-TOR gene in all of the treated groups (0.1, 1, 4, 8 mM/L) compared to the control group. In addition, the treatment of 0.1 mM and 4mM VPA resulted in a statistically significant reduction in the m-TOR gene expression in a time- dependent manner (Fig. 6A, C). Morevere, based on the results shown in the Fig. 6C,it can be concluded that the greatest effect of VPA was in 8Mm after 24h which had been able to robustly downregulate the mRNA expression levels of m-TOR gene.

VPA Decreased the Expression Of PD-L1 Gene in the MCF-7 Cells (at mRNA Level)

An interaction between CIP2A and PD-L1 was observed in GeneMANIA interaction database (Fig. 7). To explore whether and how VPA induced CIP2A downregulation influence on immune checkpoint molecules, using qPCR, its effect on the expression of PD-L1 in the MCF-7 cells was examined. As shown in Fig. 8, it can be understood that VPA caused significant reduction in the PD-L1 expression levels in all of the treated groups(0.1, 1, 4, 8 mM/L) during the indicated times. The results in Fig. 8D, showed that the treatment of MCF-7 with8mM could time-dependently make a noticeable decrease in the PD-L1 gene expression levels. The treatment of MCF-7 cells with4 Mm VPA at 72 h, resulted in a statistically greater significant reduction in the PD-L1 gene expression compared with the all other concentrations during the indicated times (Fig. 8C).

Breast cancer (BC) is an invasive cancer among females accounting for most cancer-related deaths worldwide (1). Resistant clones following the cytotoxic chemotherapy, as a critical problem limit prominent initial clinical responses. Thus, identifying innovative strategies and exploring agents that may allow more sensitization to chemotherapy or radio drugs for achieving equivalent clinical outcome with less toxic doses are highly interested.

Given the inactivation of PP2A that frequently occurs in cancer and its negative role in the regulation of multiple oncogenic pathways (41),the identification of PP2A activation agents to be combined with several existing drugs could be a promising approach to augment the efficacy of treatments in cancer (42, 43).Furthermore, a variety of mechanisms, including up-regulation of endogenous regulators such as cancerous inhibitor of PP2A (CIP2A) causes the function of PP2A to be impaired in cancer (44).CIP2A is an important protein in malignant transformation and regulates a series of downstream events, including pathways involved in tumorigenic cell signaling during cell proliferation, apoptosis, and DNA damage response (3). Currently, CIP2A is reported to be overexpressed in most of the human tumor types, and its expression correlates with BC aggressivity (4).Several studies have supported that CIP2A can be used as a worthwhile antitumor target (25, 44–47). Together, these data suggest that exploring CIP2A targeting drugs as PP2A reactivation strategy can provide a greater window for the development of existing treatment strategies for BC patients.

On the other hand, various studies have supported that VPA, as a HDAC inhibitor, is effective in treating BC mainly by suppressing tumor cell growth and inducing apoptosis (35, 37, 38). Based on the mentioned studies, the clinical benefit of VPA and therapeutic value of CIP2A is striking, but the molecular mechanisms pertaining antitumor effect of VPA and implication of VPA for targeting CIP2A in BC continues to be of interest and remains to be explored. In this way, it was tested whether VPA could be a new strategy for targeting CIP2A oncogene in MCF-7 cells. Our findings supported using CIP2A as a valuable target against tumor and demonstrated VPA as a potential CIP2A targeting agent as well.

In the present study, cell viability was determined in the MCF-7 cells treated with VPA using MTT test at various doses (0.1, 1, 4, and 8 mM/L). MTT results revealed that VPA induced favorable and significant cancer cell growth inhibition in MCF-7 cells in a dose and time dependent manner (Fig. 1). Besides, as shown in Fig. 2, the results of quantitative polymerase chain reaction (qPCR) in the MCF-7 cells treated by VPA showed striking effect in decrement of CIP2A expression levels. Hence, these results suggested that targeting CIP2A might be the major mechanism of VPA effects in MCF-7 cells.

Previous studies have highlighted that CIP2A downstream signaling molecules, i.e., c-MYC/PI3K/Akt/m-TOR, play a crucial role in inducing cell resistance to existing therapies for BC (3, 48).Owing to decrement of CIP2A expression levels following VPA exposure, the participation of these signaling molecules in effects of VPAis an interesting question. As shown in Fig. 3, 4, 5, and 6, the expression of CIP2A signaling-associated molecules, including c-MYC/PI3K/Akt/m-TOR were significantly decreased upon VPA treatment. These results indicated that the influence of VPA on MCF-7 cells is associated with reduction in expression levels of c-MYC/PI3K/Akt/m-TOR signaling molecules.

Moreover, the relevance of CIP2A and PD-L1 has not been addressed so far. The role of PP2A and its targets, including c-MYC (21), MAPK (22, 23)and PIK3CD (p110δ) signaling pathway(49) has been reportedin suppressing PD-L1 involved in immune evasion. Accordingly, another unexplored area is the function of CIP2A in the regulation of immune checkpoint signaling, specifically by the immune checkpoint inhibitors PD-L1. On the other hand, nowadays, the outstanding success of immune checkpoint therapy has made it a promising strategy in cancer treatment, but resistance to this approach emerged in a subset of patients. Based on the mentioned evidence, it would be intriguing to investigate whether reduction in CIP2A expression levels induced by VPA as PP2A activation strategy can lead to decrement of PD-L1 expression levels in MCF-7 cells. As shown in Fig. 8, the qPCR results revealed that VPA had striking effects to significantly decrease the PD-L1 expression levels of MCF-7 cells. Consequently, these findings indicated that VPA-induced CIP2A inhibition may also regulate immune checkpoint signaling, particularly by reduction in the expression levels of PD-L1, thereby treatment of MCF-7 cells with VPA could be a combination strategy as a PP2A activator to overcome resistance to immune checkpoint therapies, and thus enhance the anticancer efficacy of existing therapies for the BC patients.

Similar to our results, Mawatari et al.(50)showed that VPA inhibited cell cycle and cell growth and induced apoptosis of SKBR3 BC cell lines. In fact, they found that VPA exerts its effect through mechanisms including increased expression of caspase-3 and p21. In another study, Fortunati et al.(38)demonstrated that VPA, as a powerful antigrowth agent, accumulates cells in sub-G1, stimulates apoptosis, decreases Bcl-2, and increases expression of Bak in MCF-7 cells. Aztopal et al.(51), reported similar findings, in which VPA exposure of MCF-7 cells exhibited antigrowth effect in a dose- and time-dependent manner and induced caspase-mediated apoptosis.

In this study, we indicated some molecular mechanisms that provide clues for better understanding regarding which molecular mechanisms contribute to effect of VPA in BC cells. Nevertheless, further research is required to confirm VPA as a CIP2A targeting agent. Although we showed that VPA plays a role in PD-L1 inhibition, addressing the mechanism through which VPA inhibits the PD-L1 and exact correlation of VPA-induced decrease of CIP2A and PD-L1 inhibition is still unclear; hence, further investigation is necessary in this regard.

In summary, VPA shows an outstanding growth inhibition effect in MCF-7 cells through a novel mechanism, i.e., the CIP2A/c-MYC/PI3K/Akt/m-TOR signaling molecules. This notion augmented that CIP2A, as a major molecule, makes MCF-7 cells sensitive to VPA-induced growth inhibition. Hence, for the first time, our findings showed the use of VPA as a new strategy for targeting CIP2A oncogene. Furthermore, we showed that VPA in MCF-7 cells results in the lowering of PDL-L1. As a hypothesis, this effect may be in relation to CIP2A signaling inactivation, suggesting that targeting the nexus of oncoproteins with signaling molecules and checkpoint inhibitors could be a novel antitumor approach to restore the immune response against BC cells. Taken together, the ability of VPA to suppress CIP2A and PD-L1 as intriguing drug targets in cancer suggests that VPA alone or in combination with existing therapies could be a promising strategy to get more efficiency in BC treatments.

Acknowledgment: This work was financially supported by Birjand University of Medical Sciences .

Author Contributions: Gholamreza Anani Sarab contributed to the study's conception and design. Elahe Zeinali performed material preparation, data collection, and analysis. Vahid Bagheri wrote the first draft of the manuscript and all authors commented on previous versions. Atena Mansouri and Esmaeil Rostami read and approved the final manuscript.

Data availability: All data produced or analyzed during this study are incorporated in this published article.

Compliance with ethical standards

Conflict of Interest: The authors declare that they have no conflict of interest.

Consent to participate: All authors have seen the manuscript and approved to submit the manuscript.

Consent for publication: All authors consent to the publication of the manuscript.

Funding: This work was supported by Birjand University of medical sciences (1399077.).

Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D (2011) Global cancer statistics. Cancer J Clin 61:69–90. https://doi.org/10.3322/caac.20107
Soofiyani SR, Hejazi MS, Baradaran B (2017) The role of CIP2A in cancer: A review and update. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 96:626 – 33. 10.1016/j.biopha.2017.08.146
De P, Carlson J, Leyland-Jones B, Dey N (2014) Oncogenic nexus of cancerous inhibitor of protein phosphatase 2A (CIP2A): an oncoprotein with many hands. Oncotarget 5:4581. 10.18632/oncotarget.2127
Côme C, Laine A, Chanrion M, Edgren H, Mattila E, Liu X et al (2009) CIP2A is associated with human breast cancer aggressivity. Clin cancer research: official J Am Association Cancer Res 15:5092–5100. 10.1158/1078-0432.ccr-08-3283
Choi YA, Park JS, Park MY, Oh KS, Lee MS, Lim J-S et al (2011) Increase in CIP2A expression is associated with doxorubicin resistance. FEBS Lett 585:755–760. https://doi.org/10.1016/j.febslet.2011.01.018
Yu G, Liu G, Dong J, Jin Y (2013) Clinical implications of CIP2A protein expression in breast cancer. Med Oncol (Northwood Lond Engl) 30:524. 10.1007/s12032-013-0524-9
Li S, Feng TT, Guo Y, Yu X, Huang Q, Zhang L et al (2016) Expression of cancerous inhibitor of protein phosphatase 2A in human triple negative breast cancer correlates with tumor survival, invasion and autophagy. Oncol Lett 12:5370–5376. 10.3892/ol.2016.5374
Yin J, Chen D, Luo K, Lu M, Gu Y, Zeng S et al (2019) Cip2a/miR-301a feedback loop promotes cell proliferation and invasion of triple-negative breast cancer. J Cancer 10:5964–5974. 10.7150/jca.35704
Tawab Osman N, Khalaf M, Ibraheem S (2020) Assessment of CIP2A and ROCK-I expression and their prognostic value in breast cancer. Pol J pathology: official J Pol Soc Pathologists 71:87–98. 10.5114/pjp.2020.97016
Wang J, Li W, Li L, Yu X, Jia J, Chen C (2011) CIP2A is over-expressed in acute myeloid leukaemia and associated with HL60 cells proliferation and differentiation. Int J Lab Hematol 33:290–298. https://doi.org/10.1111/j.1751-553X.2010.01288.x
Switzer CH, Ridnour LA, Cheng RY, Sparatore A, Del Soldato P, Moody TW et al (2009) Dithiolethione compounds inhibit Akt signaling in human breast and lung cancer cells by increasing PP2A activity. Oncogene 28:3837–3846. 10.1038/onc.2009.244
Westermarck J, Hahn WC (2008) Multiple pathways regulated by the tumor suppressor PP2A in transformation. Trends Mol Med 14:152–160
Perrotti D, Neviani P (2013) Protein phosphatase 2A: a target for anticancer therapy. Lancet Oncol 14:e229–e38. https://doi.org/10.1016/S1470-2045(12)70558-2
Niemelä M, Kauko O, Sihto H, Mpindi J, Nicorici D, Pernilä P et al (2012) CIP2A signature reveals the MYC dependency of CIP2A-regulated phenotypes and its clinical association with breast cancer subtypes. Oncogene 31:4266–4278. https://doi.org/10.1038/onc.2011.599
Junttila MR, Puustinen P, Niemelä M, Ahola R, Arnold H, Böttzauw T et al (2007) CIP2A inhibits PP2A in human malignancies. Cell 130:51–62. 10.1016/j.cell.2007.04.044
Parsa AT, Waldron JS, Panner A, Crane CA, Parney IF, Barry JJ et al (2007) Loss of tumor suppressor PTEN function increases B7-H1 expression and immunoresistance in glioma. Nat Med 13:84–88. https://doi.org/10.1038/nm1517
Topalian SL, Drake CG, Pardoll DM (2012) Targeting the PD-1/B7-H1 (PD-L1) pathway to activate anti-tumor immunity. Current opinion in immunology 24:207 – 12. doi: https://doi.org/10.1016/j.coi.2011.12.009
Tsushima F, Yao S, Shin T, Flies A, Flies S, Xu H et al (2007) Interaction between B7-H1 and PD-1 determines initiation and reversal of T-cell anergy. Blood The Journal of the American Society of Hematology 110:180–185. https://doi.org/10.1182/blood-2006-11-060087
Sharma P, Allison JP (2015) Immune checkpoint targeting in cancer therapy: toward combination strategies with curative potential. Cell 161:205–214. https://doi.org/10.1016/j.cell.2015.03.030
Galluzzi L, Vacchelli E, Bravo-San Pedro J-M, Buqué A, Senovilla L, Baracco EE et al (2014) Classification of current anticancer immunotherapies. Oncotarget 5:12472. 10.18632/oncotarget.2998
Casey SC, Tong L, Li Y, Do R, Walz S, Fitzgerald KN et al (2016) MYC regulates the antitumor immune response through CD47 and PD-L1. Science 352:227–231. 10.1126/science.aac9935
Sun L, Stoecklin G, Van Way S, Hinkovska-Galcheva V, Guo RF, Anderson P et al (2007) Tristetraprolin (TTP)-14-3-3 complex formation protects TTP from dephosphorylation by protein phosphatase 2a and stabilizes tumor necrosis factor-alpha mRNA. J Biol Chem 282:3766–3777. 10.1074/jbc.M607347200
Coelho MA, de Carné Trécesson S, Rana S, Zecchin D, Moore C, Molina-Arcas M et al (2017) Oncogenic RAS Signaling Promotes Tumor Immunoresistance by Stabilizing PD-L1 mRNA. Immunity 47:1083–99e6. 10.1016/j.immuni.2017.11.016
Weichert W, Röske A, Gekeler V, Beckers T, Stephan C, Jung K et al (2008) Histone deacetylases 1, 2 and 3 are highly expressed in prostate cancer and HDAC2 expression is associated with shorter PSA relapse time after radical prostatectomy. Br J Cancer 98:604–610. https://doi.org/10.1038/sj.bjc.6604199
Minamiya Y, Ono T, Saito H, Takahashi N, Ito M, Mitsui M et al (2011) Expression of histone deacetylase 1 correlates with a poor prognosis in patients with adenocarcinoma of the lung. Lung cancer (Amsterdam Netherlands) 74:300–304. https://doi.org/10.1016/j.lungcan.2011.02.019
Giaginis C, Damaskos C, Koutsounas I, Zizi-Serbetzoglou A, Tsoukalas N, Patsouris E et al (2015) Histone deacetylase (HDAC)-1,– 2,– 4 and – 6 expression in human pancreatic adenocarcinoma: associations with clinicopathological parameters, tumor proliferative capacity and patients’ survival. BMC Gastroenterol 15:148. https://doi.org/10.1186/s12876-015-0379-y
Hsieh C-L, Ma H-P, Su C-M, Chang Y-J, Hung W-Y, Ho Y-S et al (2016) Alterations in histone deacetylase 8 lead to cell migration and poor prognosis in breast cancer. Life Sci 151:7–14. https://doi.org/10.1016/j.lfs.2016.02.092
Witt A, Lee C, Lee T, Azzam D, Wang B, Caslini C et al (2017) Identification of a cancer stem cell-specific function for the histone deacetylases, HDAC1 and HDAC7, in breast and ovarian cancer. Oncogene 36:1707–1720. https://doi.org/10.1038/onc.2016.337
Linares A, Assou S, Lapierre M, Thouennon E, Duraffourd C, Fromaget C et al (2019) Increased expression of the HDAC9 gene is associated with antiestrogen resistance of breast cancers. Mol Oncol 13:1534–1547. 10.1002/1878-0261.12505
Sharda A, Rashid M, Shah SG, Sharma AK, Singh SR, Gera P et al (2020) Elevated HDAC activity and altered histone phospho-acetylation confer acquired radio-resistant phenotype to breast cancer cells. Clin epigenetics 12:4. 10.1186/s13148-019-0800-4
Yoo CB, Jones PA (2006) Epigenetic therapy of cancer: past, present and future. Nat Rev Drug Discovery 5:37–50. https://doi.org/10.1038/nrd1930
Shi Y, Jia Y, Zhao W, Zhou L, Xie X, Tong Z (2018) Histone deacetylase inhibitors alter the expression of molecular markers in breast cancer cells via microRNAs. Int J Mol Med 42:435–442. 10.3892/ijmm.2018.3616
Huang M, Zhang J, Yan C, Li X, Zhang J, Ling R (2019) Small molecule HDAC inhibitors: Promising agents for breast cancer treatment. Bioorg Chem 91:103184. 10.1016/j.bioorg.2019.103184
Xiang XS, Li PC, Wang WQ, Liu L (2022) Histone deacetylases: A novel class of therapeutic targets for pancreatic cancer. Biochimica et biophysica acta Reviews on cancer:188676. 10.1016/j.bbcan.2022.188676
Chateauvieux S, Morceau F, Dicato M, Diederich M (2010) Molecular and therapeutic potential and toxicity of valproic acid. Journal of Biomedicine and Biotechnology 2010. doi: https://doi.org/10.1155/2010/479364
Wawruszak A, Halasa M, Okon E, Kukula-Koch W, Stepulak A (2021) Valproic Acid and Breast Cancer: State of the Art in 2021. 13. doi: 10.3390/cancers13143409
Travaglini L, Vian L, Billi M, Grignani F, Nervi C (2009) Epigenetic reprogramming of breast cancer cells by valproic acid occurs regardless of estrogen receptor status. Int J Biochem Cell Biol 41:225–234. https://doi.org/10.1016/j.biocel.2008.08.019
Fortunati N, Bertino S, Costantino L, Bosco O, Vercellinatto I, Catalano MG et al (2008) Valproic acid is a selective antiproliferative agent in estrogen-sensitive breast cancer cells. Cancer Lett 259:156–164. https://doi.org/10.1016/j.canlet.2007.10.006
Injinari N, Amini-Farsani Z, Yadollahi-Farsani M, Teimori H (2021) Apoptotic effects of valproic acid on miR-34a, miR-520h and HDAC1 gene in breast cancer. Life Sci 269:119027. 10.1016/j.lfs.2021.119027
Lipska K, Gumieniczek A, Filip AA (2020) Anticonvulsant valproic acid and other short-chain fatty acids as novel anticancer therapeutics: Possibilities and challenges. Acta Pharm 70:291–301. 10.2478/acph-2020-0021
Sangodkar J, Farrington CC, McClinch K, Galsky MD, Kastrinsky DB, Narla G (2016) All roads lead to PP2A: exploiting the therapeutic potential of this phosphatase. FEBS J 283:1004–1024. 10.1111/febs.13573
Shu S, Lin CY, He HH, Witwicki RM, Tabassum DP, Roberts JM et al (2016) Response and resistance to BET bromodomain inhibitors in triple-negative breast cancer. Nature 529:413–417. 10.1038/nature16508
Rincon R, Cristobal I, Zazo S, Arpi O, Menendez S, Manso R et al (2015) PP2A inhibition determines poor outcome and doxorubicin resistance in early breast cancer and its activation shows promising therapeutic effects. Oncotarget 6:4299–4314. 10.18632/oncotarget.3012
Junttila MR, Puustinen P, Niemelä M, Ahola R, Arnold H, Böttzauw T et al (2007) CIP2A inhibits PP2A in human malignancies. Cell 130:51–62. 10.1016/j.cell.2007.04.044
Liu CY, Shiau CW, Kuo HY, Huang HP, Chen MH, Tzeng CH et al (2013) Cancerous inhibitor of protein phosphatase 2A determines bortezomib-induced apoptosis in leukemia cells. Haematologica 98:729–738. 10.3324/haematol.2011.050187
Choi YA, Park JS, Park MY, Oh KS, Lee MS, Lim JS et al (2011) Increase in CIP2A expression is associated with doxorubicin resistance. FEBS Lett 585:755–760. 10.1016/j.febslet.2011.01.018
Dong Q-Z, Wang Y, Dong X-J, Li Z-X, Tang Z-P, Cui Q-Z et al (2011) CIP2A is overexpressed in non-small cell lung cancer and correlates with poor prognosis. Ann Surg Oncol 18:857–865. https://doi.org/10.1245/s10434-010-1313-8
Soofiyani SR, Hejazi MS, Baradaran B (2017) The role of CIP2A in cancer: a review and update. Biomed Pharmacother 96:626–633. https://doi.org/10.1016/j.biopha.2017.08.146
Ali K, Soond DR, Pineiro R, Hagemann T, Pearce W, Lim EL et al (2014) Inactivation of PI(3)K p110δ breaks regulatory T-cell-mediated immune tolerance to cancer. Nature 510:407–411. 10.1038/nature13444
Mawatari T, Ninomiya I, Inokuchi M, Harada S, Hayashi H, Oyama K et al (2015) Valproic acid inhibits proliferation of HER2-expressing breast cancer cells by inducing cell cycle arrest and apoptosis through Hsp70 acetylation. Int J Oncol 47:2073–2081. 10.3892/ijo.2015.3213
Aztopal N, Erkisa M, Erturk E, Ulukaya E, Tokullugil AH, Ari F (2018) Valproic acid, a histone deacetylase inhibitor, induces apoptosis in breast cancer stem cells. Chemico-Biol Interact 280:51–58. 10.1016/j.cbi.2017.12.003

Download PDF

Editorial decision: Returned Without Review
17 Aug, 2023
Reviewers invited by journal
27 Jun, 2023
Editor assigned by journal
26 Jun, 2023
First submitted to journal
24 Jun, 2023

You are reading this latest preprint version

A study conducted in breast cancer cells found that (valproic acid) inhibits CIP2A/C-MYC/PI3K/Akt/mTOR signaling molecules and PD-L1

Status:

Version 1

Abstract

Background

Objective

Materials and Methods

Result

Conclusions

Figures

Background

Materials And Methods

Drug Preparation

Culture of MCF-7 Cell Line and Treatment

Cell Viability Assay

Real-Time RT-PCR

RNA Extraction and cDNA Synthesis

Gene Expression

Statistical Analysis

Results

VPA Exposure Has an Inhibitory Effect on Cell Proliferation of MCF-7cells

VPA Decreased the Expression of CIP2A Oncogene in the MCF-7 Cells (at mRNA level)

VPA Decreased the Expression of C-MYC Gene in the MCF-7 Cells (at mRNA level)

VPA Decreased the Expression of PI3K Gene in the MCF-7 Cells (at mRNA level)

VPA Decreased the Expression of Akt Gene in the MCF-7 Cells (at mRNA level)

VPA Decreased the Expression of M-TOR Gene in the MCF-7 Cells (at mRNA level)

VPA Decreased the Expression Of PD-L1 Gene in the MCF-7 Cells (at mRNA Level)

Discussion

Conclusion

Declarations

References

Status:

Version 1