Cloning and expression the nisin gene in Lactobacillus plantarum Running title: Cloning and expression of nisin gene

doi:10.21203/rs.3.rs-3103321/v1

Download PDF

Research Article

Cloning and expression the nisin gene in Lactobacillus plantarum Running title: Cloning and expression of nisin gene

https://doi.org/10.21203/rs.3.rs-3103321/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Currently, researchers are exploring the capability of lactic acid bacteria to produce therapeutic molecules through the use of living microorganisms. This study aims to clone the nisin gene in Lactobacillus plantarium. The process involves isolating the nisin gene from Lactococcus lactis and transferring it to a pET-21a(+) plasmid. To achieve this, the nisin gene and plasmid were cut using BamHI and HinIII enzymes in an enzymatic environment. Moreover, the T4 ligase enzyme was employed to ligation of the nisin gene and plasmid together. To increase the number of plasmids, they were cloned in E. coli DH5α prior to introducing the nisin gene. The multiplication of bacteria helped to increase the plasmid count. Afterward, heat shock was used to transfer the plasmid into L. plantarium. Following this, the bacteria were grown in a culture medium that contained ampicillin. Only those bacteria with the pET-21a(+) plasmid were able to grow due to their possession of the ampicillin resistance gene. Sequencing was performed on the obtained clones, confirming the presence of the desired gene. PCR reaction was used to confirm the cloning, and the study demonstrated that nisin protein can be expressed functionally in L. plantarium, increasing its antimicrobial activity. This opens up the possibility of producing nisin as a recombinant protein in Lactobacillus plantarum. Finally, the genes of E. coli, L. plantarum, and Lactobacillus lactis were registered in the World Gene Bank with the numbers OQ674135, OQ674136, and OP546029 respectively.

probiotic

plasmid

Lactobacillus plantarum

cloning

nisin

Probiotics are microorganisms that are alive and typically consist of bacteria and yeast. When consumed in adequate amounts, probiotics can have a beneficial impact on an individual's health. Probiotics have shown potential for promoting animal and human health through various means [1]. In the European Union, prescribed microorganisms for animal use are predominantly gram-positive bacterial strains belonging to Bacillus, Enterococcus, Lactobacillus, Pediococcus, Streptococcus, and Saccharomyces cerevisiae as a yeast [2].

Meeting the growing demand for high-quality food and effectively controlling pathogenic microorganisms throughout the "farm-to-consumer" process has become a difficult task. This challenge arises due to transformations in animal production, food processing, and dietary habits, making an increasing number of consumers vulnerable to infection [3]. The use of probiotics can serve as a natural means to control and prevent the transmission of pathogens like Campylobacter, Escherichia coli, Clostridium, Yersinia enterocolitica, and Bacillus cereus throughout the food chain and different technologies [4].

L. plantarum is among the most popular probiotic bacteria utilized in animal feed. It helps to limit the growth of opportunistic pathogens in animal feed and intestines by reducing the pH value. Furthermore, it exhibits a wide-ranging inhibitory effect against different types of pathogens, including Listeria monocytogenes, Clostridium perfringens, Salmonella enterica, and E. coli [5].

Molecular cloning is a process that involves creating recombinant DNA molecules, transferring them into a host organism, and then cultivating them. Plasmids are tiny circular pieces of DNA that replicate within the host cell, independent of chromosomal or genomic DNA. Common plasmids used in recombinant DNA technology are typically optimized for studying and manipulating genes. For instance, most plasmids can be replicated in E. coli and are generally small in size (ranging from about 3000–6000 bp) to support easy manipulation. By forming phosphodiester bonds between the desired DNA and the plasmid vector, the desired DNA becomes part of a new recombinant plasmid [6].

Nisin is a small antimicrobial protein that is classified as a bacteriocin and originates from L. lactis. It also exhibits an antimicrobial effect against pathogens such as L. monocytogenes, which can cause severe illness and even fatalities in individuals such as the very young, elderly, pregnant, sick, and immunocompromised individuals. L. monocytogenes can thrive at low temperatures [7].

Nisin functions as a bacteriocin, exhibiting a broad-spectrum antimicrobial effect primarily against gram-positive bacteria found in food. However, current research suggests that the antimicrobial activity of nisin may be effective against a wide variety of non-food bacteria. Several studies have indicated that pure nisin, combined with other antibiotics, can show effectiveness against gram-negative pathogens, and bioengineered versions of nisin have been developed to enhance its activity against both gram-positive and gram-negative bacteria. Recently, researchers in interdisciplinary fields have explored new therapeutic applications of nisin for human diseases, leveraging its bioengineering potential. Nisin exhibits a dual mechanism for killing target cells: it inhibits cell wall synthesis and forms pores in it. In both mechanisms, nisin adheres to lipids, which are the primary transporter of the peptidoglycan structural units of bacterial cell walls, hindering their construction [8].

Nisin triggers the transcription of genes governed by nisA and nisF promoters via a two-component regulatory system [9], which encompasses NisK protein histidine kinase and NisR response regulator [10]. A transferable expression system with nisin control (NICE) has been developed [11] based on the combination of nisA promoter and nisRK regulatory genes [12]. This system consists of two compatible replicons, namely a regulatory plasmid bearing the nisRK regulatory genes and an expression vector containing the desired gene under the control of the nisA promoter. The system offers various benefits, including the ability to regulate the level of expression through the quantity of nisin employed for induction [12]; highly elevated levels of recombinant protein synthesis (up to 60% of all intracellular proteins) [13]; and undetectable expression of the target gene in the uninduced state, which permits the production of lethal proteins [14].

Improving the probiotic performance of L. plantarum as an additive in animal feed requires enhancing nutritional efficiency, increasing the absorption and digestion of food by farmed animals, and reducing bacterial pathogens in the human food chain. To boost the efficacy of this probiotic, nisin is required, which L. plantarum cannot produce and secrete on its own. Consequently, genetic engineering was employed to transfer the nisin gene from L. lactis to L. plantarum. For the first time, a specific primer of the nisin gene was designed, and the gene was purified using PCR before being transferred to the pET-21a(+) plasmid. The plasmid was then introduced into L. plantarum via electroporation (a process that involves applying electric pulses to cells to create temporary pores in their membranes) [15].

Bacterial preparation and nisin gene extraction

The L. plantarum (IBRC-M 10817) and L. lactis (IBRC-M 10692) were obtained in lyophilized form from the Iranian Scientific and Industrial Research Organization. They were cultured in MRS Broth (Merk, Germany) under aerobic conditions at 37°C [15, 16].

To obtain the nisin gene, the entire genome of L. lactis bacteria was initially extracted utilizing a commercial Genomic DNA Extraction kit (BETA BAYERN, Germany). The quality and quality of the extracted DNA was then determined using the Nanodrop device (Thermo Fisher Scientific, USA). Subsequently, a pair of specific primers with restriction sites of BamHI and HinIII enzymatic cutter (Table 1) were employed to amplify the nisin gene via PCR. The PCR reaction mixture was comprised 25 µl of 2X Taq RED Master mix 1.5 mM MgCl₂ (Ampliqon, Denmark), 4 µl of template DNA, 2 µl of each forward and reverse primers, and DEPC water to bring the mixture up to a total volume of 50 µl. The PCR (MJ Research, USA) thermal program is shown in Table 2.

Table 1

Specifications of the primers used for nisin gene amplification [16].
Primer names	Nisin primers with restriction site	Restriction enzyme	Base pair amplification
NI-Bam-305F	GCCTCGGATCCATGAGTACAAAAGATTTTAAC	BamhI	305 bp
NI-HIN-305R:	CTCAAGCTTCTCCGTTTATCGTTTGGAG	HindII	305 bp

Table 2

Temperature conditions of polymerase chain reaction for nisin gene amplification [16].
Step	Number of cycles	Temperature (ºC)	Time
Primary denaturation	1	95	5 min
denaturation	35	95	35 second
Connection		58	40 second
expansion		72	1min
Final expansion	1	72	5 min

In the following step, the PCR product was examined using 2% agarose gel electrophoresis to visualize its size bands (Fig. 1). Additionally, the amplified DNA product was sent for sequencing to Macrogene company of Korea. The obtained sequence was then compared against existing records in databases through a blasting procedure, and the accuracy of the gene was assessed.

Plasmid selection

In this research, the nisin gene was cloned using plasmid pET-21a(+) (Novagen, Merck, Germany), which is capable of replicating and expressing genes. This plasmid carries two T7•Tag® sequences at both ends, along with an optional C-terminal His•Tag that facilitates expression and purification. Additionally, it has a Multiple Cloning Site (MCS) sequence, which is a specific site for inserting genes, and contains various enzyme cut sites. The plasmid also comprises an ampicillin resistance gene marker (Fig. 2) [17].

Transfer of nisin gene to pET-21a(+) plasmid

At this stage, the nisin gene and plasmid were treated with BamHI and HinIII enzymes within enzymatic buffer. After the digestion process, the nisin gene was added to the digested plasmid, and T4 ligase enzyme was utilized to fuse the nisin gene with the plasmid at 16°C for 20 hours [17, 18].

Introducing the plasmid into the bacteria

In order to increase the quantity of plasmids both before and after the addition of the nisin gene, the plasmid was introduced into E. coli DH5α (IBRC-M 11186) bacteria to enhance the number of plasmids via bacterial cell proliferation. The heat shock method was employed to transfer the plasmid into the E. coli cells [11]. The procedure for performing the task is as follows: Initially, a microtube containing 200 microliters of competent E. coli DH5α cells was chosen, and all of the plasmids fused with the nisin gene were added to it. Then, the heat shock method was utilized, which included keeping the tube at cold temperature (on ice) for 30 minutes. Subsequently, the tube was transferred to a temperature of 42°C in a Bain-Marie for 70 seconds, followed by returning it to cold temperature for 2 minutes to facilitate plasmid transfer into the bacteria. Finally, 500 µl of Luria-Bertani (LB; Himedia, India) liquid culture was added to the microtube, and it was placed at 37°C for 90 minutes to enable the initial growth of bacteria [18].

Detection of cloned bacteria

The bacterial cells were cultured in a medium containing the antibiotic ampicillin, and only those bacteria that had received the pET-21a(+) plasmid grew and produced progeny due to the presence of an ampicillin resistance gene. The same plasmid was extracted via a specific kit from E. coli DH5α cells where it had been transferred and subsequently introduced into L. plantarum bacteria using the heat shock method so transformed and non-transformed L. plantarum are cultured in a De Man, Rogosa and Sharpe agar medium (MRS), manufactured by HIMEDIA in India, containing the antibiotic ampicillin, only the transformed bacteria have grown (Figs. 3 and 4) [19].

Identification of new L. plantarum combined with nisin gene

To extract plasmids from L. plantarum, a specific Plasmid DNA Extraction Mini kit (Favorgen, Taiwan) was employed, and a band of more than 5000 pairs of nucleotides should appear on the gel electrophoresis due to the presence of the pET-21a(+) plasmid. In the event that the same plasmid is obtained and exposed to endonuclease cutting enzymes BamHI and HinIII before being introduced into the bacterial cell containing the nisin gene, the nisin gene is cut, and a small band of around 200 pairs of nucleotides (the size of the nisin gene) is formed on the gel electrophoresis, along with a larger band of over 5000 pairs of nucleotides (corresponding to the plasmid itself) (Fig. 4) [16, 19].

Evaluation and identification of nisin gene in L. plantarum by Real Time-PCR

To evaluate the level of nisin gene expression, the Real Time PCR method was utilized. For this purpose, RNA was extracted by Total RNA Purification Mini Kit (Favorgen, Tiwan) from L. plantarum and L. lactis using a specialized cDNA synthesis kit (Addbio, South Korea) to convert it into cDNA. The components and quantities used in a final volume of 20 microliters are as follows: Nuclease-Free H₂0 1 µl, X Reaction Buffer 10 µl, mMdNTP Mixture 2.0 µl, X oligo dT20 [or 10x random hexamer] 2.0 µl, RNA template 4 µl, and X AddScript Enzyme Solution 1.0 µl. The temperature programs for converting RNA to cDNA are provided in Table 3 [20].

Table 3

Temperature conditions necessary to convert RND to cDNA in a polymerase chain reaction tube.
Stage	Temperature conditions	Time (min)	Temperature (ºC)
1	starting temperature	10	25
2	reverse transcription	60	50
3	inactivation of reverse transcription	5	80
4	storage temperature	12	12

Real-Time PCR

To conduct the real-time stage, the method of Rina et al. (2016) was utilized. The primers and temperature program are provided in Table 4. To measure the expression of the nisin gene, the PCR reaction mixture comprised 25 microliters, consisting of 12.5 microliters of Cybergreen master mix (Amplicon, Denmark), 3 microliters of template cDNA, 1 microliter of each primer (forward and reverse) listed in Table 4, and the volume of the mixture was made up to 25 µL using DEPC water. The temperature program for PCR is as follows: initial denaturation at 95°C for 5 minutes, followed by 40 cycles of denaturation at 95°C for 35 seconds, primer binding temperature at 55°C for one minute and 45 seconds, and elongation at 72°C for 1 minute. Finally, a final elongation step was performed at 72°C for 8 minutes [21]. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is used as a housekeeping gene or internal gene expression for comparison of it with nisin gene expression to determine the level of nisin expression

Table 4

Sequence of primers used in this study
Gene name	Primer	Sequence	The length of gene (bp)
Nissin	Forward	GGAGGCACTCAAAATGAGTAC	174
	Reverse	CTATCCTTTGATTTGGTT	174
Internal gene GAPDH	Forward	TCTTGACTGCAGATGACCGT	174
	Reverse	AGTTACCACCACGTACAGGG	174

Nucleotide sequencing and sequence analysis

Once the positive samples of the nisin gene were obtained, they were sent to sequencing (Macrogen-Korea). Afterward, the obtained sequences were subjected to a blast test in the gene bank of NCBI. To register these sequences in the gene bank, Mega software (version 11) was utilized to perform alignment [18].

To confirm the presence of recombinant plasmids carrying the nisin gene in L. plantarum and E. coli DH5, three methods were employed:

a) PCR on bacterial colonies using specific primers b) enzymatic cutting of plasmids c) PCR with primers that bind to the product (as depicted in Fig. 4).

Based on Fig. 1, the PCR results of the nisin gene were obtained. Figure 2 displayed identification results of recombinant cells, indicating that non-transferred bacteria did not grow in an ampicillin culture medium. Figure 3 illustrated the bacteria transferred to pET-21a(+) due to having an ampicillin resistance gene. After cloning the nisin gene into the pET-21a(+) plasmid and transferring the resulting plasmid to L. plantarum cells, a number of colonies grew on MRS culture medium containing the appropriate amount of ampicillin. Confirmation of cloning and the presence of the desired gene fragment (nisin gene) was done via PCR. To confirm the cloning process, PCR reactions were performed on the obtained colonies, and the electrophoresis results of the PCR products are shown in Fig. 5. After extracting the plasmid pET-21a(+) carrying the nisin gene from the gene-containing colonies, enzymatic cleavage was done using BamHI and HinIII enzymes. The nisin gene band was found to have a size of approximately 305 bp, while the band corresponding to the pET-21a(+) plasmid measured about 5000 bp. The results of determining the sequence of the plasmid pET-21a(+) carrying the nisin gene from the culture of gene-containing colonies revealed that the sequence of the nisin gene in these clones was entirely identical to the nisin gene in the medium carrier E. coli DH5α. These findings suggested that the nisin gene was correctly cloned in the enzyme site and was placed in the appropriate translation site.

Real Time-PCR

After transferring the nisin gene from L. lactis to L. plantarum using Real-Time PCR (Applied Biosystems model 7200), the expression value of the nisin gene and internal gene expression (GAPDH) was measured as cycle threshold (Ct). The average value of 2^-(∆∆Ct) between gene expression was then calculated in both L. lactis and L. plantarum, with three repetitions for each bacterium. L. lactis was used as a control because it naturally contains the nisin gene. Based on the results, the average expression of the nisin gene in L. plantarum was equivalent to its average in L. lactis. Overall, the findings indicated that gene expression in L. plantarum is comparable to gene expression in L. lactis (as demonstrated in Fig. 6). The expression columns of internal genes and the nisin gene in L. lactis (as the nisin gene donor, control) and L. plantarum (as the target bacterium of the nisin gene receptor via plasmid Pet21a(+) were presented, and the average columns of 2^-(∆∆Ct) indicated the equal expression of the nisin gene in both bacteria.

Phylogeny analysis

The nucleotide sequence of the studied segment of the nisin gene was investigated and compared using blast analysis in the gene bank. The obtained sequences were then analyzed using Mega software (version 11), and the targeted sequences were compared with other sequences registered in NCBI. The results indicated that the obtained sequences had more than 99% similarity with the sequences registered in NCBI. It is worth noting that the nisin gene isolated from E. coli and L. plantarum was first published in the World Gene Bank under the numbers OQ674135 and OQ674136, respectively, and the nisin gene isolated from L. lactis was registered under the number OP546029. Figure 7 illustrates the phylogenetic tree of the nisin gene.

Nisin exhibits a multi-faceted antibacterial mechanism in which it binds to both peptidoglycan and lipid components of the bacterial cell wall, thereby inhibiting its biosynthesis. In addition, nisin forms pores in the cell membrane, leading to the leakage of essential ions and eventual death of the bacterial cell [22]. Generally, gram-positive bacteria such as Listeria, Mycobacterium, and Staphylococcus species, are more sensitive to nisin. Spore-producing bacteria such as Clostridium and Bacillus are also sensitive to nisin [23]. Various species of lactic acid bacteria are recognized as probiotics, and they possess essential characteristics such as the ability to produce bacteriocins and organic acids, adhesion to host cells, and resistance to antibiotics and heavy metals. Plasmids encoding these probiotic traits have been sequenced from L. salivarius, L. plantarum, and L. fermentum [24]. The genus Lactobacillus is very diverse, with over 60 species that can be phylogenetically distinct from one another. As a result of this diversity, the efficiency of transcription, translation, or secretion signals may differ from one Lactobacillus species to another. This is well demonstrated in L. plantarum, where the two-plasmid NICE system seems to be unstable and weak, despite its successful transfer to other Lactobacilli. Unlike L. lactis, which has several inducible expression systems available, very few inducible expression systems are available for Lactobacilli. Consequently, adapting the NICE system in L. plantarum provides a robust, adjustable, and stable expression tool for this bacterium [25]. The development of controlled gene expression systems is crucial for the potential health applications of specific Lactobacillus strains, as it allows for the creation of dose-response curves for the biological effect being studied. Several studies have demonstrated that using the NICE system, the expression level and concentration of nisin genes can be regulated. The NICE optimized system has been successfully employed to label L. plantarum with green fluorescent protein and track the fate of these fluorescent Lactobacilli in vivo or in cell cultures. Other studies have revealed that by cloning and transferring the NICE gene, Lactobacilli can be improved to promote human and animal health by secreting therapeutic proteins in the culture medium. Electroporation is a useful method for transferring plasmid DNA to Lactobacilli to enhance their probiotic function [26].

The addition of probiotics to the feed of weaned piglets has resulted in an increase in growth rate due to high feed consumption and improved feed conversion ratio. Complex probiotic supplements, including Sarcomyces cerevisiae yeast and Lactobacillus species, have been reported to enhance the growth performance of weaned pigs [27]. Positive effects on growth, feed conversion efficiency, and nutrient digestibility have also been observed in pigs supplemented with probiotic supplements of Bacillus subtilis and Saccharomyces boulardi. The use of probiotics such as Lactobacillus reuteri in weaned pigs was shown to be comparable to antimicrobial growth stimulant (apramycin) in terms of increasing feed efficiency and enhancing nutrient digestibility. This effect may be attributed to the increased activity of digestive enzymes, such as beta-galactosidase, which stimulates the smooth movements of the digestive system and improves the apparent digestibility of nutrients. Moreover, probiotics have been observed to improve feed consumption, the number and growth of piglets at weaning, and the composition of milk in cattle [28, 29].

The microflora present in the digestive system plays a crucial role in the body's defense mechanism. The main intestinal microflora of pigs comprises Lactobacilli, Bifidobacteria, Streptococci, Bacteroides, Clostridium perfringens, and E. coli, which may vary with age [30]. One of the key abilities of stable microflora in the digestive tract is resistance to colonization [30]. However, supplementation with Lactobacillus in weaning piglets can aid in the initial development of stable intestinal microflora, enhance immune system motility, and prevent diarrhea. Nevertheless, the success rate of Lactobacillus transformation is relatively low compared to E. coli due to the different restriction modification systems coded by the host [31, 32].

Nisin, an antibacterial polypeptide, was initially identified from L. lactis. The need for large quantities of nisin in various applications has led to the development of high-level expression and purification of this bacteriocin. Researchers have therefore focused on two main approaches: 1) improving and optimizing cultivation conditions for nisin production from Lactococcus strains, and 2) producing nisin as a recombinant protein [33, 34]. Recombinant nisin is produced using hosts such as Saccharomyces, E. coli, L. lactis, and L. casei. In this study, L. plantarum was used. Previous research has investigated nisin expression in E. coli.

This study employed a new genetic technique for L. plantarum, which allows for rapid forward genetic engineering based on the systems of this type of bacteria. The study demonstrated that nisin protein can be functionally expressed in L. plantarum and increase the antimicrobial activity of this bacterium. It also demonstrated the effective production of nisin biologically and opened the prospect of producing nisin as a recombinant protein in Lactobacillus bacteria.

Acknowledge

The authors appreciate the Vice-Chancellor for Research and Technology at Urmia University for funding this project.

Authors' contributions

MAA and AT conceptualized the study. MAA, AT and AO collected, analyzed and interpreted the data. MAA and AT wrote the first draft of the manuscript. All authors revised the manuscript and approved the final version.

Conﬂict of Interest

The authors declare that they have no conflicts of interest. All authors have full control of all primary data and they agree to allow review of their data upon request.

Data availability statement

Should the journal need to have access to the data, we will be happy to provide them.

Abd El-Hack ME, El‐Saadony MT, Shafi ME et al (2020) Probiotics in poultry feed: A comprehensive review. J Anim Physiol Anim Nut. https://doi.org/10.1111/jpn.13454
Markowiak P, Śliżewska K (2018) The role of probiotics, prebiotics and symbiotic in animal nutrition. Gut Pathog. https://doi.org/10.1186/s13099-018-0250-0
Han J, Gao J, Matthews KR (2017) Retail Food Safety: Concerns, Regulations, Remedies. In: Ravishankar RV, Jamuna AB (eds) Trends in Food Safety and Protection, 1th edn. CRC press, Florida, pp 239–256
Quigley L, O'Sullivan O, Stanton C et al (2013) The complex microbiota of raw milk. FEMS Microbiol Rev. https://doi.org/10.1111/1574-6976.12030
Nouri S, Nazeri S, Hosseyni P (2018) Biochemical and molecular identification of probiotic bacteria. Cell Mol Res (Iranian J Biol). https://doi.org/20.1001.1.23832738.1397.31.1.11.7
Bertero A, Brown S, Vallier L (2017) Methods of cloning. In: Jalali M, Saldanha FYL, Jalali M (eds) Basic science methods for clinical researchers. edn. Academic Press, Cambridge, pp 19–39
Kaktcham PM, Kouam EMF, Tientcheu MLT et al (2019) Nisin-producing Lactococcus lactis subsp. lactis 2MT isolated from freshwater Nile tilapia in Cameroon: Bacteriocin screening, characterization, and optimization in a low-cost medium. LWT. https://doi.org/10.1016/j.lwt.2019.03.007
Hasheminya SM, Dehghannya J (2020) A review of the structure, mechanism, and application of bacteriocins in foods as natural preservatives. J Food Microbiol. https://doi.org/10.1016/s0168-1605(01)00560-8
Stock JB, Surette MG, Levit M (1995) Two-component signal transduction systems. Ann Rev Biochem. https://doi.org/10.1146/annurev.biochem.69.1.183
Kuipers OP, Beerthuyzen MM, de Ruyter PG et al (1995) Autoregulation of nisin biosynthesis in Lactococcus lactis by signal transduction. J Biol Chem. https://doi.org/10.1074/jbc.270.45.27299
Kuipers OP, de Ruyter PG, Kleerebezem M (1998) Quorum sensing-controlled gene expression in lactic acid bacteria. J Biotech. https://doi.org/10.1186/1475-2859-4-16. PMID: 15921537
Kleerebezem M, Beerthuyzen MM, Vaughan EE et al (1997) Controlled gene expression systems for lactic acid bacteria: transferable nisin-inducible expression cassettes for Lactococcus, Leuconostoc, and Lactobacillus spp. Appl Environ Microbiol. https://doi.org/10.1128/aem.63.11.4581-4584.1997
De Ruyter P, Kuipers OP, de Vos WM (1996) Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin. Appl Environ Microbiol. https://doi.org/10.1128/aem.62.10.3662-3667.1996
Ruyter PGd, Kuipers OP, Meijer WC et al (1997) Food-grade controlled lysis of Lactococcus lactis for accelerated cheese ripening. Nat Biotech. https://doi.org/10.1038/nbt1097-976
Joseph A, Aikawa S, Sasaki K et al (2013) Utilization of lactic acid bacterial genes in Synechocystis sp. PCC 6803 in the production of lactic acid. Biosci Biotechnol Biochem. https://doi.org/10.1271/bbb.120921
Bringel F, Hubert J-C (1990) Optimized transformation by electroporation of Lactobacillus plantarum strains with plasmid vectors. Appl Microbiol Biotech. https://doi.org/10.1007/BF00604934
Matoba Y, Tanaka N, Noda M et al (2013) Crystallographic and mutational analyses of tannase from Lactobacillus plantarum. Proteins Struct Funct Bioinform. https://doi.org/10.1002/prot.24355
Sharma C, Osmolovskiy A, Singh R (2021) Microbial fibrinolytic enzymes as anti-thrombotics: Production, characterisation and prodigious biopharmaceutical applications. Pharm. https://doi.org/10.3390/pharmaceutics13111880
Hu S, Kong J, Kong W et al (2009) M. Identification of nisin-producing strains by nisin-controlled gene expression system. Curr Microbiol. https://doi.org/10.1007/s00284-009-9378-y
Trmčić A, Monnet C, Rogelj I (2011) Expression of nisin genes in cheese-a quantitative real-time polymerase chain reaction approach. J Dairy Sci. https://doi.org/10.3168/jds.2010-3677
Grattepanche F, Lacroix C, Audet P (2005) Quantification by real-time PCR of Lactococcus lactis subsp. cremoris in milk fermented by a mixed culture. Appl Microbiol Biotech. https://doi.org/10.1007/s00253-004-1705-4
Huang SS, Sung SH, Chiang CE (2007) Chitosan potentiation of warfarin effect. https://doi.org/10.1345/aph.1K173. Ann Pharmacother
And HC, Hoover D (2003) Bacteriocins and their food applications. Compr Rev Food Sci Food Saf. https://doi.org/10.1111/j.1541-4337.2003.tb00016.x
Gor MC, Golneshin A, Van TTH et al (2020) Cloning and functional expression of a food-grade circular bacteriocin, plantacyclin B21AG, in probiotic Lactobacillus plantarum WCFS1. PLoS ONE. https://doi.org/10.1371/journal.pone.0232806
Tauer C, Heinl S, Egger E et al (2014) Tuning constitutive recombinant gene expression in Lactobacillus plantarum. Microb Cell Factories. 2014;13(1):1–11
Pavan S, Hols P, Delcour J et al (2000) Adaptation of the nisin-controlled expression system in Lactobacillus plantarum: a tool to study in vivo biological effects. Appl Environ Microbiol. https://doi.org/10.1128/aem.66.10.4427-4432.2000
Dowarah R, Verma A, Agarwal N (2017) The use of Lactobacillus as an alternative of antibiotic growth promoters in pigs: A review. Anim Nutr. https://doi.org/10.1016/j.aninu.2016.11.002
Wang J, Ji H, Zhang D et al (2011) Assessment of probiotic properties of Lactobacillus plantarum ZLP001 isolated from gastrointestinal tract of weaning pigs. Afr J Biotechnol 10(54):11303–11308
Zhao P, Kim I (2015) Effect of direct-fed microbial on growth performance, nutrient digestibility, fecal noxious gas emission, fecal microbial flora and diarrhea score in weanling pigs. Anim Feed Sci Technol. https://doi.org/10.1016/j.anifeedsci.2014.12.010
Mul A, Perry F (1994) The role of fructo-oligosaccharides in animal nutrition. In: Garnsworthy PC, Cole DJA (eds) Recent advances in pig nutrition, 3rd edn. Nottingham University Press, Southborough, pp 79–104
Jensen B (1998) The impact of feed additives on the microbial ecology of the gut in young pigs. J Anim Feed Sci. https://doi.org/10.22358/jafs/69955/1998
Liu H, Zhang J, Zhang S et al (2014) Oral administration of Lactobacillus fermentum I5007 favors intestinal development and alters the intestinal microbiota in formula-fed piglets. J Agri Food Chem. https://doi.org/10.1021/jf403288r
Shin JM, Gwak JW, Kamarajan P et al (2016) Biomedical applications of nisin. J Appl Microbiol. https://doi.org/10.1111/jam.13033
Piper C, Hill C, Cotter PD et al (2011) Bioengineering of a Nisin A-producing Lactococcus lactis to create isogenic strains producing the natural variants Nisin F, Q and Z. https://doi.org/10.1111/j.1751-7915.2010.00207.x. Microb Biotechnol

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Cloning and expression the nisin gene in Lactobacillus plantarum Running title: Cloning and expression of nisin gene

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Bacterial preparation and nisin gene extraction

Plasmid selection

Transfer of nisin gene to pET-21a(+) plasmid

Introducing the plasmid into the bacteria

Detection of cloned bacteria

Real-Time PCR

Nucleotide sequencing and sequence analysis

Results

Real Time-PCR

Phylogeny analysis

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1