Temporal analysis of early pregnancy related gene transcripts in Murrah Buffaloes

doi:10.21203/rs.3.rs-3104810/v1

Download PDF

Research Article

Temporal analysis of early pregnancy related gene transcripts in Murrah Buffaloes

https://doi.org/10.21203/rs.3.rs-3104810/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

A crucial requirement for effective reproductive management in cattle like cows and buffaloes is the early and accurate pregnancy detection. By allowing the farmer to quickly spot non-pregnant animals and cure and/or rebreed them, early pregnancy identification is essential for reducing the calving interval. The goal of the current study was to standardize the expression of the CCL8 and CXCL10 genes as an early pregnancy marker in Murrah buffaloes. Blood samples were taken on day 16 for gene expression following artificial insemination, where as blood sample collected on day 0, 7, 14, 21 post A.I. for progesterone concentration. Buffaloes were split into two groups, pregnant (n = 6) and non-pregnant (n = 6), based on the day of the resumption of estrus. Using qRT-PCR based on SYBR green dye, the gene expression levels in peripheral blood leucocytes (PBLs) were assessed. CCL8, CXCL10, and GAPDH gene amplification products produced amplicons with respective sizes of 108, 117, and 158 bp. The results of the qPCR analysis demonstrate that CCL8 mRNA gene expression in pregnant Murrah buffaloes was found to be 5.13 and 12.21 fold higher in comparison to non-pregnant Murrah buffaloes, while CXCL10 mRNA expression was found to be 4.19 and 22.17 fold higher in comparison to non-pregnant Murrah buffaloes. As a result, on day 16 of pregnancy, pregnant buffaloes had higher levels of CCL8 and CXCL10 mRNA expression in PBLs than non-pregnant buffaloes. Progesterone levels in the pregnant group significantly rose (p0.05) from day 0 to day 21. On days 0, 7, and 14, however, there was no discernible difference between the pregnant and non-pregnant groups. On day 45 after the A.I., per-rectal examination further verified the pregnancy. Hence, on day 16 gene expression profiling of CCL8 and CXCL10 in Murrah buffaloes may be employed as an early pregnancy marker.

Early pregnancy marker

gene expression

chemokines

qRT-PCR

Murrah buffalo

Indian buffaloes have long calving interval, late puberty and high incidence of anoestrus. The lack of reliable methods for detecting early pregnancy in buffaloes exacerbates the situation. In bovine species, several methods of pregnancy detection (Cyesiognosis) are used, but none is ideal due to inherent limitations in level of sensitivity, accuracy and reliability, specificity, speed, and convenience of testing (Bharti and Jacob, 2019). Due to the development of molecular techniques like proteomics and their applications in animal research, researchers are now looking for pregnancy biomarker molecules (Spencer and Bazer, 2004; Hansen and other, 2017).

In the past few decades, several methods of directly or indirectly diagnosing pregnancy have emerged, such as rectal palpation (Franco et al., 1987), ultrasound (Fricke, 2002), early pregnancy factor (Cordoba et al., 2001) and PAG1 (pregnancy-associated glycoprotein 1) is a pregnancy-specific protein B. (Zoli et al., 1992, Kiracofe et al., 1993). In case of pregnant animals progesterone level remains elevated throughout the pregnancy (until parturition) causing the absence of cyclic pattern. Progesterone is an example of non- pregnancy specific diagnosis method (Reese et al., 2016). Although these methods of pregnancy detection have their own advantages, they can only be used within 4 weeks of artificial insemination (AI).

Early and accurate pregnancy detection is a critical criterion for improving reproductive management in livestock such as cows and buffaloes. High reproductive efficiency is required to achieve high life-time production from dairy animals. Early pregnancy diagnosis is critical for shortening the calving interval by allowing the farmer to identify non pregnant animals as soon as possible and treat and/or rebreed them. A 60-day post-parturient barren interval is ideal for breeding in dairy animals. Dairy farmers must identify non-pregnancy as soon as possible in order to rebreed the dam as soon as possible. It is estimated that the early embryonic time is 42 days after insemination (Hubbert et al., 1972). Their pregnancy is safer and non-infectious embryonic losses are uncommon after implantation. In early pregnancy, OAS1 protein expression in buffalo is a reliable marker of conceptus implantation (Batra et al., 2019).

Cytokines play a controversial role in early pregnancies in mammals. These low molecular proteins are responsible for maintaining corpus luteum, foetal adhesion and invasion, implantation, foetal growth, placental differentiation and various immunomodulatory mechanisms (Schafer, 2003). In some cases, the availability of sufficient numbers on a local level is important for embryo survival (Nasu et al., 1999). Cytokines are small proteins secreted by cells that have a specific effect on cell interactions and communication (Zhang et al., 2007). As it stimulates the expression of interferon-stimulated genes (ISGs), such as interferon-stimulated protein 15 kDa (ISG15), myxovirus-resistance (MX) proteins 1 and 2, and 2′-5′-oligoadenylate synthetase 1 (OAS1) in cow peripheral blood leukocytes (Han et al., 2006, Stevenson et al., 2007, Green et al., 2010, Shirasuna et al., 2012, Matsuyama et al., 2012, Kizaki et al., 2013, Pugliesi et al., 2014; Mishra and Sarkar, 2018). The determination of IFN-stimulated genes (ISG) in circulating immune cells has previously been shown to be a potential pregnancy diagnostic test for beef (Matsuyama et al., 2012; Pugliesi et al., 2014; Melo et al., 2020), dairy products (Shirasuna et al., 2012; Haq et al., 2016) cattle, there is still no method that has been shown to be both accurate and practical for detecting pregnancy before day 20 (Green et al., 2010; Yoshino et al., 2018; Melo et al., 2020). After comparing these four methods as pregnancy predictors on day 20 after timed AI in dairy cattle, Ferraz et al., 2021 evaluated the abundance of two genes (ISG15 and LGALS3BP) stimulated by the conceptus using samples collected from four cell types: peripheral blood mononuclear cells (PBMC), total blood leukocytes, cervical cells, and total milk leukocytes. They found that ISG15 abundance using PBMC is the best pregnancy predictor on d 20 post-TAI among the cell types evaluated. At the feto-maternal interface in the uteri of pregnant buffaloes collected from a nearby abattoir, the pregnancy-associated proteins PAG-1 and PAG-2 were discovered as early markers for pregnancy and were found to be expressed from one to four months of pregnancy (Rangasami et al., 2015). These results allow the diagnosis of pregnancy within 3 weeks of artificial insemination, but have shown varying degrees of effectiveness after AI. The accuracy as a marker for early pregnancy in dairy cows was almost not true, although the accuracy increased from 17 days to 25 days (Han et al., 2006). In dairy cows, the level of MX2 mRNA in PBL did not change significantly from 0 to 18 days after AI (Stevenson et al., 2007), while the OAS1 mRNA level has been successfully used to assess the 18-day gestation of heifers, but it has not been used in dairy cows (Shirasuna et al., 2012). In addition, the combination of ISG gene expression in PBL and color Doppler ultrasound of the corpus luteum on 20 days after artificial insemination of cattle is a possible high-precision diagnosis of pregnancy (Pugliesi et al., 2014).

A study showed that the mRNA of Chemokine (C-C motif) ligand 8 (also known as MCP2) and (C-X-C motif) ligand 10 (also known as IP10) expression in bovine endometrium was higher on the 15th and 18th days of pregnancy than in the non-pregnant stage (Sakumoto et al., 2017). In addition, CCL8 and CXCL10 expression increased after IFNT stimulation in an in vitro endometrial culture system (Sakumoto et al., 2017). mRNA expression of the CCL8 and CXCL10 genes increased in PBLs from 14 to 18 days of pregnancy, whereas no significant changes were observed in cows with Early Embryonic Mortality (EEM) or Late Embryonic Mortality (LEM) (Sakumoto et al., 2018) because IFNT stimulated the expression of CCL8 and CXCL10 in cultured peripheral blood leukocytes and the rise in CCL8 and CXCL10 levels may be pregnancy-related to pregnancy. Furthermore, CCL16 and IFNT stimulated the expression of CCL8 and CXCL10 in cultured peripheral blood leukocytes, implying that chemokines such as CCL8, CXCL10, and CCL16 may play some role in maternal recognition (Sakumoto et al., 2018). The cytokine related gene expression in peripheral blood leucocytes (PBLs) from early pregnant buffalo has not been studied till date. Therefore, considering all the above points, we have studied the expression of CCL8 and CXCL10 in buffalo’s peripheral blood leukocytes on day 16 after AI in pregnant and non-pregnant buffalos.

Collection of buffalo peripheral blood

Entire procedure was conducted as per the guidelines of IAEC committee registered as Registration No 2058/GO/Re/SL/19/CPCSEA dated 19.03.2019 meeting held at College of Veterinary and Animal Sciences, SVPUAT, Meerut-250110, India. Murrah buffaloes from Livestock Research Farm SVPUAT, Meerut were used for the study. The animals were kept in a dry, clean and well ventilated sheds and reared under strict management and proper hygienic conditions throughout the study. Prophylactic measures against cattle/bovine diseases were carried out as prescribed by the health calendar of the institute to ensure that the animals were in a healthy condition throughout the study. Blood samples were collected through sterile EDTA coated vacutainers containing 0.5% (10 µl/ml of blood) anticoagulant from jugular vein of buffaloes on day 0 and after post AI on day 16th. Precautions were taken to minimize the effect of ribonuclease activity while transport to laboratory and subsequent processing. After collection blood samples were immediately processed for extraction of total RNA to prevent its degradation. The data were collected separately for the Pregnant (n = 6) and Non-Pregnant (n = 6) Murrah buffaloes.

Isolation of Total RNA using Trizol Reagent

Extraction of total RNA from the blood samples was carried out using TRIzol reagent (Thermo Fisher, USA). Briefly, 600 µl of blood was mixed with 900µl of Trizol reagent and vortexed uniformly to completely dissociate the blood cells. Then 180µl of chloroform (0.2 volumes Trizol Reagent) was added. Tubes were shaken vigorously for 15 second and incubated on ice for 15 min and further, Tubes were centrifuged at 12,000 x g for 15 mins at 4°C. After centrifugation, the mixture was separated into 2 phase i.e. first phase is aqueous phase which is transparent in color and second in interphase. The upper aqueous layer was removed carefully into the labeled tube without disturbing the interphase and 500µl of isopropanol was added to each of these tubes and incubated for overnight at -20^°C. Tubes were centrifuged again at 12,000 x g for 10 mins at 4°C. A pellet was visible at this stage after centrifuge. The supernatant was removed. The pellet was washed with 1ml of 75% ethanol and mixed by vortexing. Tubes were again centrifuged at 12,000 x g for 10 mins at 4°C. Supernatant was poured off to waste and tubes were inverted on clean tissue towel for 10 minutes to let the ethanol evaporate. Depending on the size, the pellet was resuspended in 15–200 µl of DEPC-treated water and stored at -80°C.

Quality and Quantity Check of RNA

The total RNA was quantified and purity was checked by using the nanodrop spectrophotometer reading. 1µl total RNA was used and absorbance at 260 nm and 280 nm wavelengths were recorded against nuclease free water as blank. RNA samples showing the OD₂₆₀: OD₂₈₀ value more than 1.8 was considered to contain no protein and ratio of 2.0-2.2 was taken for further analysis.

Reverse Transcription and synthesis of cDNA

The first stand cDNA was synthesized by using Promega First Strand cDNA Synthesis Kit (Promega, USA) as per manufacturer’s instruction from the isolated total RNA. Reverse transcription was carried out in 20 µl reaction mixtures. Calculation was done by using the concentration of total RNA from nanodrop reading (ng/µl) to take 5µl of total RNA for each reaction and dissolved in nuclease free water by 6.5µl and add 1µl of Random primer to make final volume 12.5µl. Then we incubate at 70°C for 5 minutes and after that snap chilled on ice for 5 minute and following mixture was added. Reaction mixture was mixed to RNA-primer complex and spinned, followed by incubation at 70°C for 5 minutes. Reaction was stopped by incubating for 5 min at 70°C and finally at 4°C forever. The resulting complimentary DNAs (cDNAs) were used in quantitative RT-PCR (qRTPCR) reactions. The cDNA is stored at -20°C for less than one week and − 80°C for long term use.

Confirmation of cDNA with GAPDH Primers

The integrity of the cDNA was checked by PCR with GAPDH primers. The amplification of 158 bp GAPDH gene fragment from the cDNA indicated that the cDNA was made from the RNA extracted from blood was of good quality.

Optimization of End Point PCR

End point PCR conditions were optimized to amplify buffaloes CCL8 and CXCL10 gene sequences in thermo cycler. Factor specific primers were used for the amplification of genes. Primers were synthesized using Fast PCR (Version: 6.2.73) primer designing software. Details of primers have been given in Table-1. The annealing temperature was standardized using cDNA prepared from mRNA of buffaloes blood by PCR. The reaction was carried out at different annealing temperatures, primer concentrations, MgCl₂ concentration, template RNA and Taq polymerase. The optimum temperature of 60°C for CCL8 and CXCL10 were found to be most suitable for annealing for respective primers and was used in subsequent polymerase chain reactions. The above reactants were added to a nuclease free thin walled 0.2 ml microcentrifuge tube pre-chilled on ice. The contents were gently vortexed and then spin down to collect at the bottom of tube by brief centrifugation. The reaction was carried out in a thermal cycler using the following cycling parameters that have been found optimum for amplification of gene fragments given in Table-1.

Table 1

Gene transcripts, primer sequences and resulting fragment sizes (For RT- qPCR)
Target	Sequence of nucleotides	Fragment Size (bp)	Reference
CCL8	For:AACATGAAGGTCTCCGCTGG Rev:GCAGCAGGTGATTGGGGTAG	108	BA01272031 BA01272032
CXCL10	For:CTCGAACACGGAAAGAGGCA Rev:TCCACGGACAATTAGGGCTT	117	BA01272033 BA01272034
GAPDH	For:ACCCAGAAGACTGTGGATGG Rev:CAACAGACACGTTGGGAGTG	158	BA01272039 BA01272040

Real Time PCR

Quantitative Real-time PCR was carried out using a stepOne^™ Real Time PCR from Applied Biosystems. The reaction was set up in a separate area from the nucleic acid preparation or PCR product analysis. Light exposure to the qPCR master mix was kept to a minimum. Pipetting was done with care to avoid creating bubbles, which would interfere with the instrument's reading of fluorescence. For gene quantification, no template control (NTC) was used to check for contamination in reaction components other than the cDNA. The absence of a detectable signal indicated that the samples were DNA-free. Only the real time master mix and primers were used in the negative control. To set up the reaction, optically clear caps were used. 3µl of cDNA was extracted. Following master mix was prepared as given in Table-2.

Table 2

Components of Master Mix for qPCR
Components	Volume per Reaction
Eva Green Mix	10µl
Primer forward	0.5µl
Primer reverse	0.5µl
Nuclease Free Water	6.0µl
Template	3.0µl
Total volume	20µl

Without gloves, no contact with the optical surface of the caps was made. Before beginning the cycling programme, the strips were centrifuged to spin down the solution to the bottom of the tubes and remove any possible bubbles. GAPDH was chosen as a housekeeping gene. Three segmented qPCR amplification programme was used as given in Table-3.

Table 3

Real Time Programme for amplification of fragment of CCL8, CXCL10, GAPDH gene transcript
Sr.No.	Step	Temperature	Time
1	Initial Denaturation cycles	95°C	10 Minute
2	2 step cycling for 40
	Denaturation	95°C	15 Second
	Annealing and Extension	60°C	1 Minute
3	Dissociation step	95°C	15 Second
		60°C	1 Minute
		95°C	15 Second
		60°C	15 Second

The average C_T value obtained for CCL8, CXCL10 and GAPDH gene was normalized so that the comparison could be made. The data obtained were subjected to comparative C_T method (ΔΔC_T method) for the analysis of the expression level of target (CCL8, CXCL10) and an endogenous control. The levels of these amplicons were compared to the calibrator sample.

Calculation of ΔΔC_T Method

ΔC_T = CT_Target - CT_Control

Calculation of the nΔΔC_T Value:

ΔΔC_T = ΔC_{T Test sample} – ΔC_{T Calibrator sample}

Incorporation of ΔΔC_T value into the fold difference

The fold difference of the target gene transcript, relative to the calibrator was calculated by the 2^ΔΔCt value (Livak and Schmittgen, 2001).

The necessary procedures used to improve the reproductive effectiveness in cattle like cows and buffaloes include an early and accurate diagnosis. Pregnancy detection tests that are affordable, precisely up- or down-regulated, least impacted by non-animal variables, present in readily accessible body fluids produced over a long period of time, and leave no remnant after pregnancy are the most important requirements.

Amplification of CCL8 and CXCL10 and GAPDH transcript cDNA

CCL8 and CXCL10 gene expression in pregnant and non- pregnant Murrah buffaloes was observed by amplifying cDNA with CCL8, CXCL10 specific primer and GAPDH primer. The amplicons with CCL8, CXCL10 and GAPDH respectively. The PCR products were loaded in Agarose Gel Electrophoresis (2.5% gel) to confirm the size. The band in agarose gel indicated the CCL8 and CXCL10 gene expression in pregnant animals on day 16th whereas correspounding band was absent in non-pregnant Murrah buffaloes (Figure-3). However, PCR product specific to GAPDH gene showed similar amplicon in both pregnant and non-pregnant Murrah buffaloes (Figure-1).

Pregnancy Diagnosis

Positive pregnancy status of inseminated animals in experimental group was confirmed at around 45 days post AI by performing per-rectal examination of the animals at Livestock Research Centre, SVPUAT, Meerut. Six out of 12 inseminated animals in experimental group were confirmed to be pregnant, by feeling amniotic membrane slip and fetal bumps. Other six animals were confirmed to be non pregnant on account of return to estrous in next cycle (i.e. within next 21 days). The selection of animals in the control group was done on the basis of anestrous. The animals which had not come in estrous since many cycles and were also confirmed to be non pregnant, were assumed to be in anestrous and chosen as control group. Thus, real time expression study was done only for six pregnant animals in the experimental group and six animals from the control group.

Relative gene expression analysis of CCL8 and CXCL10 by Real Time PCR

∆∆C_T method is a suitable method of real time PCR to analyze the relative changes in gene expression of CCL8 and CXCL10 transcript in both pregnant and non-pregnant Murrah buffaloes. The GAPDH gene was used as an endogenous control (reference gene) during relative quantification. The amplification plots of all the three genes i.e. (CCL8, CXCL10 and GAPDH) were identically similar, confirming the equality in kinetics of Real-Time PCR of all the three genes involved (Figs. 2 and 3). The dissociation curves of the amplified products of target gene CCL8, CXCL10 as well as endogenous control gene GAPDH were showing the single peak confirming the specificity of the amplification (Figs. 4, 5 and 6). The fold changes between both pregnant and non-pregnant Murrah buffaloes at day 16th were summarized in Tables 4 and 5. The expression level of CCL8 and CXCL10 gene in both pregnant and non-pregnant Murrah buffaloes in term of fold change is given in Figs. 7 and 8.

Table 4

R.T-PCR based expression analysis of CCL8 gene using Livak and Schmittgen (2001) method
Sample	Avg CT (CCL8)	Avg CT (GAPDH)	ΔCT (CCL8- GAPDH)	ΔΔCT (ΔCT Target- ΔCT NK)	Fold change in expression of CCL8 (2^{- ΔΔCT})
NK	35.19	31.88	+ 3.31	0	1
K3	30.76	31.06	-0.30	-0.30-3.31= -3.61	12.21
K8	33.08	32.13	0.95	0.95–3.31= -2.36	5.13
*NK- (Non-Pregnant); K-3 and K-8 (Pregnant)

Table 5

R.T-PCR based expression analysis of CXCL10 gene using real-time PCR using Livak and Schmittgen (2001) method.
Sample	Avg CT (CXCL10)	Avg CT (GAPDH)	ΔCT (CXCL10- GAPDH)	ΔΔCT (ΔCT Target- ΔCT NK)	Fold change in expression of CXCL10 (2^{- ΔΔCT})
NK	34.77	31.26	3.51	0	1
K3	29.99	30.97	-0.98	-0.98-3.51= -4.49	22.47
K8	32.23	30.95	1.28	1.28–3.51= -2.23	4.69
*NK- (Non-Pregnant); K-3 and K-8 (Pregnant)

Present study was aimed for the identification of early pregnancy markers. This study is the first in buffaloes although similar studies have been done in cattle. Earlier study showed that the level of CCL8, CXCL10 transcript (mRNA) increased gradually from 14 to 18 day in pregnant cows as comparison to non-pregnant cows post AI (Sakumoto et al., 2018). By considering the above views, the present study was conducted on CCL8 and CXCL10 gene expression for pregnancy diagnosis in Murrah buffaloes at day 16th of post AI. And it was hypothesized that that CCL8 and CXCL10 mRNA level in blood was up-regulated in blood from pregnant Murrah buffaloes as comparison to non-pregnant Murrah buffaloes.

The product size of amplicons of CCL8 and CXCL10 gene on Agrose gel electrophoresis having 107 bp and 117 bp was obtained in pregnant murrah buffaloes (K-3, K-8) at day 16th of post AI (Fig. 1). However, the amplification was absent in the non-pregnant murrah buffaloes (NK). Thus, the current study shows correlation between CCL8, CXCL10 gene expression in pregnant Murrah buffaloes. Further, the increased level of mRNA gene expression was correlated with serum progesterone concentration in pregnant Murrah buffaloes. Previous study shows that the expression of CCL8 and CXCL10 genes increased in PBLs from day 14 to day 18 during early pregnancy in cows (Sakumoto et al., 2018). However the expression of both CCL8 and CXCL10 in PBLs was stimulated and may play a role in regulating maternal recognition of pregnancy in cows.

The present study demonstrated several fold increase in expression of CCL8 and CXCL10 gene in pregnant Murrah buffaloes as compared to non-pregnant Murrah buffaloes (NK) at day 16 post AI (Table-4, 5; Fig. 7, 8). In pregnant Murrah buffaloes (K3, K8), the mRNA gene expression of CCL8 was found as 12.21 and 5.13 fold higher as compared to non-pregnant Murrah buffaloes (Table 4; Fig. 7) whereas the mRNA expression for K-3 and K-8 of CXCL10 was found as 22.17 and 4.19 fold higher respectively as compared to non-pregnant Murrah buffaloes (Table 5; Fig. 8). Thus, the average mRNA expression level of CCL8 and CXCL10 gene was higher in pregnant Murrah buffaloes as compared to non-pregnant Murrah buffaloes.

However, the present study exhibited fold several increase in CCL8 gene expression and CXCL10 showed many fold increase in CXCL10 gene expression at day 16 post AI in Murrah buffaloes. Previous studies also revealed that semi-quantitative RT-PCR and qPCR showed higher level of expression of CCL8 and CXCL10 transcript during 18th days post AI in blood of pregnant cows (Sakumoto et al., 2018; Kumari et al., 2021).

On the basis of relative expression analysis, it can be concluded that the expression of CCL8 and CXCL10 gene were significantly higher in pregnant Murrah buffalo post 16 day A.I. as compared to non-pregnant buffalo. Therefore, CCL8 and CXCL10 gene transcripts on day 16^th may be considered as early pregnancy marker in Murrah buffaloes.

Batra K, Nanda T, Kumar A, Kumari R, Kumar V, Maan S (2019) Molecular characterization of OAS1 as a biomarker molecule for early pregnancy diagnosis in Bubalus bubalis. Indian J Biotechnol 18:97–107
Cordoba MC, Sartori R, Fricke PM (2001) Assessment of a commercially available early conception factor (ECF) test for determining pregnancy status of dairy cattle. J Dairy Sci 84(8):1884–1889
Ferraz PA, Filho CASG, Rocha CC, Neto AL, Bruni GA, Oshiro TSI, Baruselli PS, Lima FS, Pugliesi G (2021) Feasibility and accuracy of using different methods to detect pregnancy by conceptus-stimulated genes in dairy cattle. JDS Commun 2:153–158
Franco OJ, Drost M, Thatcher MJ, Shille VM, Thatcher WW (1987) Fetal survival in the cow after pregnancy diagnosis by palpation per rectum. Theriogenology 27(4):631–644
Fricke PM (2002) Scanning the future Ultrasonography as a reproductive management tool for dairy cattle. J Dairy Sci 85(8):1918–1926
Green JC, Okamura CS, Poock SE, Lucy MC (2010) Measurement of interferon-tau (IFN-τ) stimulated gene expression in blood leukocytes for pregnancy diagnosis within 18–20 d after insemination in dairy cattle. Anim Reprod Sci 121(1–2):24–33
Han H, Austin KJ, Rempel LA, Hansen TR (2006) Low blood ISG15 mRNA and progesterone levels are predictive of non-pregnant dairy cows. Eur J Endocrinol 191(2):505–512
Hansen TR, Sinedino LDP, Spencer TE (2017) Paracrine and endocrine actions of interferon tau (IFNT). Reproduction 154:45–59. https://doi.org/10.1530/REP -17
Haq IU, Han Y, Ali T, Wang Y, Gao H, Lin L, Wu Y, Wu S, Zeng S (2016) Expression of interferon-stimulated gene ISG15 and ubiquitination enzymes is up regulated in peripheral blood monocyte during early pregnancy in dairy cattle. Reprod Biol 16:255–260. https://doi.org/10.1016/j.repbio.2016.10.001
Hubbert WT, Dennis SM, Adams WM, Bierschwal CJ, Biggers JD, Carrol EJ, Zemjanis R (1972) Recommendations for standardizing bovine reproductive terms. Cornell Vet 62:216–237
Kiracofe GH, Wright JM, Schalles RR, Ruder CA, Parish S, Sasser RG (1993) Pregnancy-specific protein B in serum of postpartum beef cows. J Anim Sci 71(8):2199–2205
Kizaki K, Shichijo-Kizaki A, Furusawa T, Takahashi T, Hosoe M, Hashizume K (2013) Differential neutrophil gene expression in early bovine pregnancy. Reprod Biol Endocrinol 11(1):1–10
Kumari R, Kumar R, Dayal S, Chandran PC, Kumar S, Ray PK, Kamal RK (2021) Development of qPCR assay for Estimation of Transcriptional Abundance of Chemokines during embryonic Implantation in Buffaloes. Buffalo Bull 40(1):45–55
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(- Delta Delta C(T)) method. Methods 25(4):402–408
Matsuyama S, Kojima T, Kato S, Kimura K (2012) Relationship between quantity of IFNT estimated by IFN-stimulated gene expression in peripheral blood mononuclear cells and bovine embryonic mortality after AI or ET. Reprod Biol Endocrinol 10(1):1–10
Melo GD, Pinto LMF, Rocha CC, Motta IG, Silva LA, da Silveira JC, Gonella-Diaza AM, Binelli M, Pugliesi G (2020) Type I interferon receptors and interferon-τ-stimulated genes in peripheral blood mononuclear cells and polymorphonuclear leucocytes during early pregnancy in beef heifers. Reprod Fertil Dev 32:953–966. https://doi.org/10.1071/RD19430
Mishra SR, Mihir Sarkar M (2018) Interferon Stimulated Genes (Isgs): Novel Pregnancy Specific Biomarker in Buffaloes (Bubalus bubalis). J Immunol Sci 2(2):48–51
Nasu K, Narahara H, Matsui N, Kawano Y, Tanaka Y, Miyakawa I (1999) Platelet-activating factor stimulates cytokine production by human endometrial stromal cells. Mol Hum Reprod 5(6):548–553
Pugliesi G, Miagawa BT, Paiva YN, França MR, Silva LA, Binelli M (2014) Conceptus-induced changes in the gene expression of blood immune cells and the ultrasound-accessed luteal function in beef cattle: how early can we detect pregnancy. Biol Reprod 91(4):95–101
Rangasamy S, Balasubramanian S, Vadivoo VS, Brindha K, Gopikrishnan D, Kulasekar K (2015) Expression of Pregnancy Associated Glycoproteins (PAGs) During Different Stages of Pregnancy-A Marker for Early Pregnancy Diagnosis in Buffaloes. Indian J Anim Reprod 36(2):25–36
Reese ST, Pereira MC, Vasconcelos JLM, Smith MF, Green JA, Geary TW et al (2016) Markers of pregnancy: How early can we detect pregnancies in cattle using pregnancy-associated glycoproteins (PAGs) and micro RNAs? Anim. Reprod 13(3):200–208
Sakumoto R, Hayashi KG, Fujii S, Kanahara H, Hosoe M, Furusawa T, Kizaki K (2017) Possible roles of CC-and CXC-chemokines in regulating bovine endometrial function during early pregnancy. Int J Mol Sci 18(4):742
Sakumoto R, Iga K, Hayashi KG, Fujii S, Kanahara H, Hosoe M, Furusawa T (2018) Gene expression of CCL8 and CXCL10 in peripheral blood leukocytes during early pregnancy in cows. J Anim Sci Biotechnol 9(1):1–11
Schafer-Somi S (2003) Cytokines during early pregnancy of mammals: a review. Anim Reprod Sci 75(1–2):73–94
Shirasuna K, Matsumoto H, Kobayashi E, Nitta A, Haneda S, Matsui M, Kawashima C, Kida K, Shimizu T, Miyamoto A (2012) Upregulation of interferon-stimulated genes and interleukin-10 in peripheral blood immune cells during early pregnancy in dairy cows. J Reprod Dev 58(1):84–90. 10.1262/jrd.11-094k
Spencer TE, Bazer FW (2004) Conceptus signals for establishment and maintenance of pregnancy. Reprod Biol Endocrinol 2:49. https:// doi.org/10.1095/biolreprod.103. 024133
Stevenson JL, Dalton JC, Ott TL, Racicot KE, Chebel RC (2007) Correlation between reproductive status and steady-state messenger ribonucleic acid levels of the Myxovirus resistance gene, MX2, in peripheral blood leukocytes of dairy heifers. J Anim Sci 85(9):2163–2172
Yoshino H, Toji N, Sasaki K, Koshi K, Yamagishi N, Takahashi T, Ishiguro-Oonuma T, Matsuda H, Yamanouchi T, Hashiyada Y, Imai K, Izaike Y, Kizaki K, Hashizume K (2018) A predictive threshold value for the diagnosis of early pregnancy in cows using interferon-stimulated genes in granulocytes. Theriogenology 107:188–193. https://doi.org/10.1016/j.theriogenology.2017.11.014
Zhang JM, An J (2007) Cytokines, inflammation and pain. Int Anesthesiol Clin 45(2):27
Zoli AP, Guilbault LA, Delahaut P, Ortiz WB, Beckers JF (1992) Radioimmunoassay of a bovine pregnancy-associated glycoprotein in serum: its application for pregnancy diagnosis. Biol Reprod 46(1):83–92

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Temporal analysis of early pregnancy related gene transcripts in Murrah Buffaloes

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Collection of buffalo peripheral blood

Isolation of Total RNA using Trizol Reagent

Quality and Quantity Check of RNA

Reverse Transcription and synthesis of cDNA

Confirmation of cDNA with GAPDH Primers

Optimization of End Point PCR

Real Time PCR

Calculation of ΔΔC_T Method

Calculation of the nΔΔC_T Value:

Incorporation of ΔΔC_T value into the fold difference

Result

Amplification of CCL8 and CXCL10 and GAPDH transcript cDNA

Pregnancy Diagnosis

Relative gene expression analysis of CCL8 and CXCL10 by Real Time PCR

Discussion

Conclusion

References

Additional Declarations

Status:

Version 1

Temporal analysis of early pregnancy related gene transcripts in Murrah Buffaloes

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Collection of buffalo peripheral blood

Isolation of Total RNA using Trizol Reagent

Quality and Quantity Check of RNA

Reverse Transcription and synthesis of cDNA

Confirmation of cDNA with GAPDH Primers

Optimization of End Point PCR

Real Time PCR

Calculation of ΔΔCT Method

Calculation of the nΔΔCT Value:

Incorporation of ΔΔCT value into the fold difference

Result

Amplification of CCL8 and CXCL10 and GAPDH transcript cDNA

Pregnancy Diagnosis

Relative gene expression analysis of CCL8 and CXCL10 by Real Time PCR

Discussion

Conclusion

References

Additional Declarations

Status:

Version 1

Calculation of ΔΔC_T Method

Calculation of the nΔΔC_T Value:

Incorporation of ΔΔC_T value into the fold difference