Title：CHSY1 promotes the tumorigenesis and progression of ovarian cancer.  Running title：CHSY1 in ovarian cancer

doi:10.21203/rs.3.rs-3105673/v1

Download PDF

Research Article

Title：CHSY1 promotes the tumorigenesis and progression of ovarian cancer. Running title：CHSY1 in ovarian cancer

https://doi.org/10.21203/rs.3.rs-3105673/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Chondroitin synthase-1 (CHSY1) is an enzyme responsible for the biosynthesis of chondroitin sulfate, and it has been reported to be involved in tumorigenesis and progression in several cancer types. However, little is known about CHSY1 in ovarian cancer (OC).

Methods

CHSY1 expression was analysed on a tissue microarray (TMA) including tumour and peritumour tissues of OC patients, and the correlations between CHSY1 and clinicopathological features and prognosis. Gene sequencing analysis and qRT‒PCR were used to identify downstream genes and pathways. Cell function assays were used to assess cell proliferation, invasion and metastasis.

Results

The study revealed that CHSY1 expression was increased in OC vs. peritumour tissues and positively correlated with prognosis. In vitro cell function assays revealed high CHSY1 expression in OC cells, and CHSY1 was able to promote tumour cell proliferation and tumour cell invasion. Gene sequencing analysis and qRT‒PCR confirmed that CHSY1 promotes OC tumorigenesis through the downstream gene TIAM1 and the ERK signalling pathway.

Conclusion

Our study revealed a novel role of CHSY1 in OC tumorigenesis and offered a possible therapeutic target for OC.

ovarian cancer

CHSY1

tumour progression

TIAM1

As one of the most common tumours of the female reproductive system, ovarian cancer (OC) ranks third in incidence after cervical cancer and uterine cancer, and because of its insidious onset and rapid progression and the current prevalence of clinical chemotherapy resistance, OC has the highest mortality rate among female genital tract malignancies^[1]. Surgery plus chemotherapy has been the standard treatment for OC in the clinic for many years. In recent years, there have been great advances in the treatment of OC, such as the use of gene-targeted drugs, but there has been little improvement in prognosis. Therefore, it is urgent to find new markers and treatment targets of OC. Chondroitin sulfate (CS) is a sulfated glycosaminoglycan that can be detected in the connective tissue of humans and other animals^{[2, 3]}. Studies have shown that CS may play an anticancer role in a variety of tumours through pathways such as immunomodulation and angiogenesis^{[4, 5]}. Chondroitin sulfate synthetase 1 (CHSY1) is a key cofactor in CS synthesis^[6]. CHSY1 is involved in T-cell differentiation and has been reported to be involved in the development of soft tissue sarcoma, hepatocellular carcinoma and colorectal cancer^{[7, 8, 9]}. However, its mechanism of action has not yet been elucidated, and its role in OC has not been reported.

In this study, we reported for the first time that CHSY1 is highly expressed in OC. Knocking down or overexpressing CHSY1 significantly affected the proliferation and invasion ability of OC cells, and transcriptome sequencing identified its downstream factor, TIAM1, and signalling pathway, revealing its mechanism of action in OC.

TMA and antibodies

A TMA, which included 154 OC tissues and 45 peritumour tissues, was purchased from SHANGHAI OUTDO BIOTECH CO., LTD (No. HOvaC154Su01). Antibodies (Abs) against ERK, TNF-α and Ki67 were purchased from Abcam (Cambridge, UK). Antibodies against mTOR and p-mTOR were purchased from CST (Boston, USA). Antibodies against CHSY1, P53, TIAM1, β-catenin and GAPDH were purchased from Proteintech (Chicago, USA). Antibodies against P38 and P-ERK1 were purchased from Bioss (Beijing, China).

Immunohistochemistry (IHC)

A PV-9000 two-step immunohistochemistry kit and DAB colour reagent (TCI) were used to detect the indicated antigens in TMA or mouse tissue samples according to the manufacturers’ instructions. The immunostaining intensity was semiquantitatively scored by two observers independently as follows: 0 for negative staining; 1 for weak staining; 2 for moderate staining; and 3 for strong staining. Scores of 0 and 1 were classified as low expression, and scores of 2 and 3 were classified as high expression. Pictures were taken under a fluorescence microscope (Olympus IX73).

Cell culture and transfection

The OC cell lines SK-OV-3, CAOV-3 and HO-8910 were purchased from GeneChem (Shanghai, China), and the A2780 cell line was purchased from iCell Bioscience Inc. (Shanghai, China). The normal ovary cell line IOSE80 was purchased from BNCC (Beijing, China). All the above cell lines were cultured in DMEM with 10% FBS and antibiotics at 37°C and 5% CO₂. All the cells were authenticated and characterized by their respective suppliers.

Vector construction and lentivirus infection

Using the CHSY1 and TIAM1 genes as templates, shRNA target sequences were designed to construct RNA interference lentiviral vectors for the target gene to knockdown CHSY1 or TIAM1 (Table 1). After identifying the target sequences for RNA interference, single-stranded DNA oligos containing the interfering sequences were synthesized and annealed to produce double-stranded DNA; then, they was directly ligated into the lentiviral vector (BR-V108) at both ends, and the ligation product was transferred into prepared, competent E. coli cells (TIANGEN, Cat. # CB104-03, German), PCR was used to verify the expression of the recombinant product (primer sequences for PCR are provided in Table 2), and plasmid extraction was performed to verify the correct sequence.

Table 1

shRNA target site sequences
Symbol	Target sequence
shCHSY1−1	GCACAAAGAACCCAAAGATAA
shCHSY1−2	TGAGAATTACGAGCAGAACAA
shCHSY1−3	GCAAATACAGCAACACAGAAA
TIAM1−1	GCTGAACAGACTGGTGAGAAA
TIAM1−2	TGAACAGACTGGTGAGAAA
TIAM1−3	GTATAAAGATGGTTCCAAA
Sh Contral	TTCTCCGAACGTGTCACGT

Construction of the vector for overexpression of target gene

Three plasmids (BR-V108, pMD2.G and pSPAX2) were transfected into adherent epithelioid 293T cells, and after enrichment, purification and quality inspection, the overexpression lentiviral vector was obtained. Cells were infected with the lentivirus, as verified by qRT-PCR and western blotting, and then, used for the following experiments. The primers were the same as those mentioned above.

Table 2

Primer sequences for the colony PCR identification of shRNA
Primer name	Primer sequence(5’−3’)
Identify primer-F	CCTATTTCCCATGATTCCTTCATA
Identify primer-R	GTAATACGGTTATCCACGCG

Quantitative real-time polymerase chain reaction (qRT‒PCR)

Total RNA from OC cells was isolated using TRIzol reagent (Sigma, USA) and then reverse-transcribed into cDNA using the PrimeScript™ RT Reagent Kit (Vazyme, USA). qRT‒PCR using SYBR Premix Ex Taq (Vazyme, USA) was performed with an Applied Biosystems VII7 real-time PCR system in triplicate, and the values were normalized to those of the housekeeping gene GAPDH. The comparative CT (2^−ΔΔCT) method was applied to analyse the qRT‒PCR data. The primer sequences used to quantify the target genes are provided in file: Table 3.

Western blotting

Western blotting was performed with a BCA Protein Assay Kit (HyClone-Pierce, USA) according to the manufacturer’s protocol. Cells were lysed in RIPA buffer containing protease inhibitor and phosphatase inhibitor. The lysate was electrophoresed with 12% SDS‒PAGE, and the proteins were transferred to a 0.2-µm

Table 3

Primer sequences in qRT-PCR
Gene	Upstream Primer Sequence	Downstream Primer Sequence	Amplified Fragment(bp)
GAPDH	TGACTTCAACAGCGACACCCA	CACCCTGTTGCTGTAGCCAAA	121
CHSY1	AGTGGGTGGCTTTGATGTTTC	AGGATGGTGGACGTGGACTA	130
TIAM1	CCGCCTTGGAATCTTTTCG	AACCTGCTCCTTCGCTTGCT	123
COMT	ACGCTTCTCTTGGAGGAATGTG	AGGAACGATTGGTAGTGTGTGC	143
RAD23B	CTGAAAAGGGGAAAGATGCC	TGGACACTGCTTTGGGTTTG	150
LAMC1	CGGAATACCATTGAAGAGACTG	ATTCTGGCTGAGTGACTGAC	145
DUSP3	TGCCTGGGAAGTGATGGAAC	TTTTGCCTGGATGGTGCTCT	96
CALU	TGACTTATGGCACTTACCTGGATG	AACCTCCGCTCATCTCTAACCA	85
KIAA1191	CACCACCGAGGAGACCAAGTA	CTTAGGTGAAGAGTGCGGAGTG	142
C4orf32	AAGGAGAGCGAGCAGGATGTT	TGTGAAGCCCATGTTGATAAGGTT	128
MZT1	GAGCTTCGCAAGGCTACTGA	CCCTCTTGCAGAGCTTGACATA	100
OLR1	AGGTTAAACGACAAGGACAGACA	TGAGCCTCCCCTACTACAGC	90
PPP1CB	TTGTGCAGATGACTGAAGCAGAAGTT	CCAAAAGAATAGGCTGGCTGAGAAA	81
PTCH1	GCACTATGCTCCTTTCCT	TATTCTCTGGTTTCCCGA	150
ARPC1A	CAAGGAGCACAACGGACACAT	GCTTCCAAACACCATCTTTCTGAC	119
CFL2	TGTACGATGCCACATACGAAAC	CAAGCCATTTACTTGCCACTCA	170
ITGA2	GGCGACGAAGTGCTACGAAA	CCCAAGAACTGCTATGCCAAAC	131

polyvinylidene fluoride membrane (Tanon, China). The membranes were blocked in 5% nonfat milk for 2 h at room temperature and incubated with primary antibodies at 4°C overnight. The corresponding secondary antibody was diluted with blocking solution, incubated with PVDF film for 1 h at room temperature and then washed with TBST 3 times for 10 min each time. Colour development was performed using the Millipore Immobilon Western Chemiluminescent HRP Substrate kit, and chemiluminescence was detected using a chemiluminescence imager.

Celigo Cell Counting Assay

Cells in the logarithmic growth phase in each group were digested with trypsin and then resuspended in complete medium to form a cell suspension. The plating cell density was determined according to the cell growth rate (most cells were plated at 2000 cells/well). Each group had 3 multiple wells with 100 µL/well at 37°C and 5% CO₂. Celigo (Nexcelom, USA) was added once per day for 5 days (with the first addition on the day after plating). The number of cells is accurately calculated by adjusting the input parameters of the analysis settings. The data were mapped, and the cell proliferation curve was drawn for 5 days.

EdU cell proliferation detection

Cells in the logarithmic growth phase were seeded at a density of 5×10⁴ cells/well in 96-well microtiter plates. We prepared 50 µM EdU (Ribobio, China) medium by diluting the EdU solution at 1000:1 with complete cell culture medium. Each well was incubated with 100 µL of 50 µM EdU medium for 2 h, and then the medium was discarded. Each well was incubated with 50 µL of cell fixative for half an hour at room temperature after washing twice, and then the fixative was discarded. Cells were incubated for 5 min with glycine and penetrant. The cells were stained with 1× Apollo stain and then with 1× Hoechst 33342. Images were taken with a fluorescence microscope, and the cell proliferation rate was calculated.

Flow cytometric analysis of apoptosis

Annexin V-PE (eBioscience, USA) staining was used to visualize apoptotic cells according to the manufacturer’s instructions. Briefly, cells were seeded into each well of a 6-well plate. After washing with PBS twice, cells were labelled with 5 µl Annexin V-FITC and 10 µl propidium iodide (50 µg/ml) in the dark at 4°C for 15 min and detected in a FACS Calibur device (eBioscience, USA). Photos were taken using a fluorescence microscope (OLYMPUS).

Wound healing assay

After trypsin digestion of the cells in the log growth phase, the complete medium was resuspended into a cell suspension and counted. The cells were plated in three wells for each group at a density of 50000 cells/well at 37°C and 5% CO₂. The medium was changed to reduced-serum medium the next day, and scratches were made across the central part of wells of the 96-well plate. Cells were washed gently with serum-free medium 3 times, and then 0.5% FBS was added and cultured at 37°C in a 5% CO₂ incubator. The cells were scanned with a Cellomics instrument and analysed.

Transwell assay

Cells in the log growth phase were digested with low serum medium and resuspended to make cell suspensions and counted. Then, 600 µL containing 30% FBS medium was added to the lower chamber. Cells were diluted in proportion with serum-free medium, and 100 µL of the cell suspension (containing 100000 ~ 200000 cells) was added to each chamber. The chambers added to wells with forceps so that the lower chamber contained 30% FBS media, and the cells were cultured for 24 hours in a tissue culture incubator. The medium was removed with absorbent paper, and then 400 µL of staining solution was added to each well of the 24-well plates. Each chamber was immersed in the staining solution for 5 min to stain the cells that migrated through the membrane. Each chamber was placed in a large water cup, rinsed several times and then allowed to dry completely. Photos were taken under a microscope.

Transcriptome sequencing

CHSY1 knockdown SK-OV-3 cells were subjected to transcriptome sequencing analysis by Shanghai Yibeirui Biomedical Science and Technology Co., Ltd. (Shanghai, China).

Xenograft assay

Four-week-old mice (BALB/c nude) were obtained from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. (Nantong, China) and maintained under pathogen-free conditions. The mice were subcutaneously injected with the indicated HO8910 cells (1×10⁷ cells in 100 ml serum-free medium) in each flank. Animal groupings and label definitions are the same as in Table 4: NC (control), KD (TIAM1 knockdown), OE (CHSY1 overexpression), OE + KD (CHSY1 overexpression + TIAM1 knockdown).

Table 4

Groups transfected with different lentivirus for the following experiments.
Groups	Transfection	Lentivirus titre	Lentivirus dosage
NC(OE + KD)	control	1×10⁸ TU/mL	20µL
CHSY1 + NC-shTIAM1	CHSY1 over-expression	1×10⁸ TU/mL	20µL
shTIAM1 + NC-CHSY1	TIAM1 knockdown	1×10⁸ TU/mL	20µL
CHSY1 + shTIAM1	CHSY1 over-expression + TIAM1 knockdown	1×10⁸ TU/mL	20µL

Tumour volume was calculated as follows: tumour volume=×L×W×W (L represents the long diameter, and W represents the short diameter). At the end of the experiment, the mice were sacrificed, and the tumours were weighed and processed to detect the expression of Ki67 by IHC.

Statistical analysis

Values are presented as the mean ± standard deviation (SD) from at least three independent experiments. The data were analysed using SPSS version 22.0 (SPSS, Inc., Chicago, IL, USA). Data analysis was conducted by paired or unpaired two-tailed Student’s t tests. Survival analysis was performed using the Kaplan–Meier method. The Cox proportional hazard was applied to analyse the hazard ratio and 95% confidence interval for DFS or OS. For all studies, a p value < 0.05 from a two-sided test indicates statistically significance.

CHSY1 is upregulated in human OC tissues, and this phenotype is associated with a poor prognosis in patients

CHSY1 expression was assessed by IHC of a human TMA containing 154 OC tissues and 45 peritumour ovarian tissues, and representative images are shown in Fig. 1A. All samples on the TMA were classified into the CHSY1 low group or CHSY1 high group according to CHSY1 expression. According to the sign test, the proportion of OC samples with high CHSY1 expression (46.6%) was significantly higher than the proportion of peritumour samples with high CHSY1 expression (6.3%) (P < 0.001) (Table 5).

Table 5

Immunohistochemistry analysis in ovarian cancer tissues and normal ovarian tissues
CHSY1 expression	Tumor tissue		Normal tissue		p value
CHSY1 expression	Cases	Percentage	Cases	Percentage	0.000***
Low	55	53.4%	18	94.7%
High	48	46.6%	1	6.3%

We investigated the correlation between CHSY1 expression and the clinicopathological features of OC. According to Mann‒Whitney U analysis, the expression of the CHSY1 gene was significantly different among patients grouped by pathological features such as pathological grade, T value, tumour lymph node metastasis (N value), tumour distant metastasis (M value), clinical stage and recurrence (Table 6). The same results were observed by Spearman grade correlation analysis (Table 7).

Table 6

Mann‒Whitney U analysis on CHSY1 and tumor characteristics in patients with ovarian cancer
Features	No. of patients	CHSY1 expression		p value
Features	No. of patients	low	high	p value
All patients	103	55	48
Age (years)				0.704
≤ 48	52	29	23
༞48	50	26	24
Grade				0.006**
I	8	5	3
II	13	11	2
III	61	24	37
stage				0.000***
1	7	6	1
2	23	19	4
3	53	24	29
4	18	4	14
Tumor size				0.380
≤ 12.5cm	52	30	22
༞12.5cm	51	25	26
T Infiltrate				0.000***
T1	7	6	1
T2	23	19	4
T3	71	28	43
Lymphatic metastasis(N)				0.003**
N0	80	48	32
N1	21	5	16
Metastasis				0.005**
M0	83	49	34
M1	18	4	14
Recurrence of state				0.001***
No	21	18	3
Yes	80	35	45

Table 7

Spearman grade correlation analysis between CHSY1 expression and tumor characteristics in patients with ovarian cancer
		CHSY1
T Infiltrate	Spearman related	0.399
	significance(double-tailed)	0.000***
	N	101
Lymphatic metastasis(N)	Spearman related	0.294
	significance(double-tailed)	0.003**
	N	101
Metastasis	Spearman related	0.282
	significance(double-tailed)	0.004**
	N	101
stage	Spearman related	0.431
	significance(double-tailed)	0.000***
	N	101
Recurrence of state	Spearman related	0.341
	significance(double-tailed)	0.000***
	N	101
Grade	Spearman related	0.303
	significance(double-tailed)	0.006**
	N	82

To determine the prognostic significance of CHSY1 in OC patients, we analysed overall survival (OS) and disease-free survival (DFS) by the Kaplan–Meier method. CHSY1 gene expression was significantly associated with the OS and DFS of OC patients, which means that the survival period was shorter in patients with high expression of the CHSY1 gene than in those with low expression (Fig. 1B).

Based on the above data, the CHSY1 gene may be related to the development and prognosis of OC and may be a drug target for OC treatment.

Knockdown of CHSY1 in OC cells in vitro by lentivirus

We first examined the background gene expression of CHSY1 in several OC cell lines by qRT‒PCR. We found that the expression of the CHSY1 gene in SK-OV-3, CAOV-3, HO-8910, and A2780 cells was relatively high compared with that in normal ovarian cells (IOSE80) (P < 0.05); it was highest in SK-OV-3 cells, whereas HO-8910 and A2780 cells showed moderate and low levels of CHSY1, respectively (Fig. 2A).

Multiple 19–21 nt target sequences were designed for RNA interference using the CHSY1 gene as a template. After evaluation and filtering with the design software, a total of 3 sequences were selected as interference targets, and lentivirus containing shRNA was transfected into SK-OV-3 cells. The qRT‒PCR results showed that the expression of CHSY1 was not significantly different between the shCtrl group and the shCHSY1-1 group. The CHSY1 knockdown efficiency was 50.8% (P < 0.05) in the shCHSY1-2 group and 57.0% (P < 0.05) in the shCHSY1-3 group. Therefore, shCHSY1-3 was used in the following experiments as shCHSY1 (Fig. 2B).

Cells infected with shCtrl or shCHSY1 lentivirus were observed via fluorescence microscopy 72 hours later. The lentiviral vector used in the experiment had fluorescent tags, and the expression of fluorescence (GFP) was observed under a fluorescence microscope. Both HO-8910 and SK-OV-3 cells showed over 80% infection efficiency and normal cell conditions. Therefore, downstream experiments were planned (Fig. 2C). To further determine CHSY1 gene knockdown efficiency after lentivirus infection, qRT‒PCR was applied; the CHSY1 knockdown efficiency in the shCHSY1 group vs. shCtrl group of HO-8910 cells was 79.30% (P < 0.05), while in SK-OV-3 cells, the CHSY1 knockdown efficiency was 55.93% (P < 0.05) (Fig. 2D). The western blotting results showed that after lentivirus infection, the protein level of CHSY1 in the shCHSY1 group was decreased compared with that in the shCtrl group, which indicated successful lentivirus-mediated knockdown.

Knockdown of CHSY1 inhibits the proliferation and migration of OC cells in vitro

To examine whether CHSY1 promotes the growth of OC cells, we observed the proliferation of cells after CHSY1 knockdown via Celigo cell counting. The HO-8910 cells in the shCHSY1 group exhibited a lower proliferation rate (P < 0.01, fold change = -3.8) than those in the shCtrl group. SK-OV-3 cells in the shCHSY1 group exhibited a lower proliferation rate than those in the shCtrl group (P < 0.001, fold change = -14.6) (Fig. 3A).

The proliferation of cells in different groups was detected with an EdU assay. The results revealed that the percentage of EdU-positive cells in the shCHSY1 group was significantly higher (P < 0.05) than that in the shCtrl group. The percentage of EdU-positive cells in the shCHSY1 group was significantly higher (P < 0.01) than that in the shCtrl group (Fig. 3B). The results showed that the number of replicating cells was reduced, which means that the cell proliferative ability was weakened when CHSY1 was knocked down.

The results of flow cytometry demonstrated that after lentivirus infection, the percentage of apoptotic HO-8910 cells was significantly increased in the shCHSY1 group compared with the shCtrl group (P < 0.001, fold change = 7.4). The percentage of apoptotic SK-OV-3 cells was significantly increased in the shCHSY1 group (P < 0.001, fold change = 3.0) (Fig. 3C).

To assess the effect of CHSY1 on the metastasis and migration ability of OC cells, wound healing and Transwell assays were performed. The wound healing assay showed that the migration rate of HO-8910 cells in the shCHSY1 group (24 h) was decreased by 65% (P < 0.001) compared with that in the shCtrl group of SK-OV-3 cells. The migration rate of cells in the shCHSY1 group (24 h) was decreased by 42% (P < 0.01) (Fig. 3D). The Transwell assay showed that compared with the shCtrl group, the migration rate of HO-8910 cells in the shCHSY1 group was decreased by 48% (P < 0.01). In SK-OV-3 cells, the migration rate of cells in the shCHSY1 group was decreased by 85% (P < 0.001) (Fig. 3E). The above results indicated that knockdown of CHSY1 significantly reduced the migration ability of OC cells.

Collectively, the results proved that the knockdown of CHSY1 could inhibit the proliferation and migration of the HO-8910 and SK-OV-3 OC cell lines.

Total RNA quality inspection of the chip samples

The results of quality inspection of chips are shown in Fig. 4A ~ D.

Knockdown of CHSY1 caused the aberrant expression of related genes

The above results showed that CHSY1 is highly expressed in OC and is associated with prognosis, but the mechanism and related pathways are not clear. Therefore, we used transcriptome sequencing to identify differentially expressed genes between the CHSY1 knockdown and control groups. HO8910 cells were grouped into the NC (shCtrl group) and KD (shCHSY1 group) groups. We calculated the significance of the difference between groups based on the P value using a linear model ^[10] based on the empirical Bayesian distribution and used the Benjamini‒Hochberg method to correct the false discovery rate (FDR). The screening criteria for significantly differentially expressed genes were |fold change| ≥1.3 and FDR < 0.05.

Seventy-three genes were upregulated and 219 genes were downregulated in the KD group compared with the NC group. A volcano plot was drawn to reveal the differentially expressed genes between the two groups based on the fold change and significance level (Fig. 4E). Hierarchical clustering analysis was carried out. The clustering results revealed subsets of genes with different expression patterns from the target gene sets; genes with similar expression patterns may have similar functions, participate in the same biological pathways, or be in adjacent regulatory positions in the pathway(Fig. 4F).

Using the above methods, we identified the main genes that were differentially expressed after CHSY1 knockdown and identified them by q-PCR (primers of all differentially expressed genes are shown in Table 3). According to qPCR in HO-8910 cells, the MZT1 and OLR1 genes were upregulated (P < 0.05), while the TIAM1, COMT, RAD23B, DUSP3, CALU, KIAA1191, C4orf32, ARPC1A, CFL2, and ITGA2 genes were downregulated (P < 0.05), and significant differences were observed in the expression of the PPP1CB, PTCH1 and LAMC1 genes (Fig. 4G). Among these differentially expressed genes, T-lymphoma invasion and metastasis-inducing protein-1 (TIAM1) was the most downregulated when CHSY1 was knocked down. Based on the previous literature, we found that TIAM1 promoted tumour metastasis and drug resistance in some malignancies, including OC, so it is likely to act as a downstream gene of CHSY1, so it was used in the following research.

Knockdown or overexpression of CHSY1 causes the synchronous expression of TIAM1

To verify whether TIAM1 may be a downstream gene of CHSY1, qPCR and western blotting were applied to assess TIAM1 expression in HO8910 and SK-OV-3 cells when CHSY1 was knocked down or overexpressed. According to qPCR, the CHSY1 and TIAM1 genes were downregulated in the shCHSY1 group in HO-8910 and SK-OV-3 cells compared with the shCtrl group (P < 0.05). The CHSY1 and TIAM1 genes were upregulated in the CHSY1 group in HO-8910 and SK-OV-3 cells relative to the shCtrl group (P < 0.05). The same results were observed by western blotting: both CHSY1 and TIAM1 protein expression levels were decreased in the shCHSY1 group in the two cell lines. Both CHSY1 and TIAM1 protein expression levels were increased in the CHSY1-overexpressing group (Fig. 4H,I).

CHSY1 affects the proliferation and metastatic ability of OC cells through TIAM1

Through the above experiments, we confirmed that CHSY1 can directly affect the expression of TIAM1, but whether CHSY1 regulates cell functions via TIAM1 was verified by the next steps. We first constructed a lentiviral vector containing the shTIAM1 plasmid and confirmed that shTIAM1-1 was highly effective for TIAM1 knockdown by qPCR (P < 0.05) (Fig. 5A). Therefore, shTIAM1-1 was used in the following experiments.

The control and targeted lentivirus-infected cells were grouped as shown in Table 4 and observed for 72 hours under a microscope, which showed that the cell infection efficiency reached more than 80% and that the cell state was normal (Fig. 5B).

Then, the proliferation and migration abilities of the cells were assessed to determine the role of CHSY1 and TIAM1 in OC cell function. In both HO-8910 and SK-OV-3 cells, the CHSY1 + NC-shTIAM1 group had significantly increased cell proliferation (P < 0.05) compared with the NC (OE + KD) group, while it was significantly enhanced in the shTIAM1 + NC-CHSY1 group (P < 0.05). The cell proliferation rate in the CHSY1 + shTIAM1 group was significantly reduced (P < 0.05) compared with that in the CHSY1 + NC-shTIAM1 group and was significantly increased compared with that in the shTIAM1 + NC-CHSY1 group (Fig. 5C).

The migration ability of HO-8910 and SK-OV-3 cells was assessed via Transwell assay, which showed that the Transwell migration rate was significantly higher in the CHSY1 + NC-shTIAM1 group than in the NC (OE + KD) group (P < 0.001), while it was significantly reduced in the shTIAM1 + NC-CHSY1 group compared with the NC (OE + KD) group (P < 0.001). After lentiviral infection, the Transwell migration rate in the CHSY1 + shTIAM1 group was lower than that in the CHSY1 + NC-shTIAM1 group but higher than that in the shTIAM1 + NC-CHSY1 group (P < 0.001) (Fig. 5D).

The above experiments indicated that CHSY1 affects TIAM1 gene and protein expression, that TIAM1 is a downstream gene of CHSY1, and that CHSY1 affects the proliferation and metastatic ability of OC cells through TIAM1 in vitro.

CHSY1 affects the proliferation and metastasis of OC cells via the ERK signalling pathway

By analysing the sequencing results via Ingenuity Pathway Analysis (IPA), the interaction network of the target gene and CHSY1 was constructed. The network involving classical pathway genes is shown in Fig. 6. Some pathways were found to be aberrantly expressed in the shCHSY1 group, and we selected several of the signalling pathways related to OC, including the MAPK/ERK signalling pathway, based on a literature search. Proteins related to the signalling pathway were assessed by western blotting in SK-OV-3 cells transfected with lentiviral shRNA. mTOR, p-mTOR, and p-ERK protein levels were decreased, while ERK, P38, P53, TNF-α, and β-catenin levels were not significantly different in the shCHSY1 group compared with the shCtrl group (Fig. 7A). To verify the role of the ERK pathway in CHSY1, an ERK inhibitor was added to HO-8910 cells infected with lentivirus facilitating CHSY1 overexpression. Western blot assays showed that CHSY1 and p-ERK were upregulated in the overexpression group compared with the control group, but there was no significant change in ERK protein expression. CHSY1 and p-ERK were downregulated in the ERK inhibitor group compared with the CHSY1 group (P < 0.001) and upregulated in the CHSY1 + ERK inhibitor group (P < 0.001), while no difference was noticed in ERK protein. The above results indicate that ERK signalling is a pathway affecting the action of CHSY1. The same result was observed in SK-OV-3 cells (Fig. 7B).

Cell Counting Kit-8 (CCK-8) assays were used to examine the proliferation of HO8910 cells with lentivirus-mediated CHSY1 overexpression and ERK inhibitor treatment. Cells transfected with only CHSY1 lentivirus had the strongest proliferative capacity. Proliferation decreased after the ERK inhibitor was added, while cells treated with only ERK inhibitors had the weakest proliferative capacity, even lower than that of the control group (P < 0.001). The same results were observed in SK-OV-3 cells, which means that the effect of CHSY1 on cell proliferation was ERK-dependent (Fig. 7C).

The results of HO8910 cell apoptosis detection by flow cytometry showed that the apoptosis level was decreased in the CHSY1 overexpression group compared with the control group, and it was increased significantly after the addition of ERK inhibitor (P < 0.001). The same result was observed in SK-OV-3 cells (Fig. 7D). Thus, the inhibitory effect of CHSY1 on apoptosis is achieved through the ERK pathway.

CHSY1 promotes the growth of OC via TIAM1 in vivo

We next investigated the function of CHSY1 and TIAM1 in OC tumorigenesis in vivo. Tumour size and tumour weight (Fig. 8A ~ B) indicated that CHSY1 is indispensable for in vivo tumorigenesis, and CHSY1-mediated tumour growth was inhibited after TIAM1 was knocked down. Therefore, TIAM1 is a downstream gene of CHSY1 and is a key factor in its tumour-promoting role in vivo. Histological analysis confirmed that xenograft tumours showed a high positive Ki67 staining rate, which means that the cells are highly proliferative. The Ki67 protein level was reduced after TIAM1 was knocked down (Fig. 8C). Collectively, these results suggest that CHSY1 promotes cancer growth in vivo and that this effect is achieved through the downstream gene TIAM1.

In the present study, we observed that the upregulation of CHSY1 is significantly associated with a poor prognosis in patients with OC. We also identified TIAM1 as a downstream gene involved in CHSY1-mediated OC cell proliferation and metastasis. The tumour-regulatory effect of CHSY1 is associated with the ERK signalling pathway.

CHSY1 is important for the normal development of cells as a protein with 802 amino acids and is located in the chromosome 15q26.3 region. The methylation level of CHSY1 is associated with T-cell differentiation ^[11], and it is also necessary for bone development ^[12]. Studies have revealed that loss of CHSY1 causes temtamy preaxial brachydactyly syndrome ^[13]. However, some studies have also revealed that CHSY1 can promote tumour development and metastasis. For example, studies have confirmed that CHSY1 is highly expressed in colorectal cancer; it has a role in promoting tumour proliferation and inhibiting apoptosis, and high expression of CHSY1 predicts a worse prognosis^[14]. In addition, CHSY1 was also found to be abnormally highly expressed in liver and glioblastoma cancers, and it enhanced the invasion and metastasis ability of tumour cells ^{[8, 15]}. The latest research shows that CHSY1 is upregulated and acts as a tumour promoter in gastric cancer by regulating cell proliferation, apoptosis, and migration. In that study, CHSY1 was significantly upregulated in gastric cancer, and high CHSY1 expression was associated with advanced tumour stage and a poorer prognosis than low CHSY1 expression. In vitro loss-of-function experiments demonstrated inhibition of cell proliferation, colony formation, and cell migration as well as promotion of cell apoptosis upon CHSY1 knockdown; in addition, gastric cancer cells with CHSY1 knockdown showed reduced tumorigenicity and slower tumour growth in vivo^[16]. However, there are no studies on CHSY1 in OC.

OC has characteristics similar to those of other solid tumours, such as gastrointestinal tumours. Although there has been some progress in therapy for OC in the past few years, such as targeted therapy and immunotherapy, the overall prognosis improvement is not obvious^[17]. Therefore, it is particularly important to continuously explore more therapeutic targets for OC. In this study, we first examined CHSY1 expression in cancerous tissues and adjacent normal tissues in a TMA via IHC and found that CHSY1 was highly expressed in OC tissues. By correlation analysis, we found that the expression of CHSY1 was positively correlated with pathological parameters such as pathological grade, T value, tumour lymph node metastasis (N value), tumour distant tumour metastasis (M value), clinical stage and recurrence. According to Kaplan‒Meier survival analysis, the expression of the CHSY1 gene is significantly associated with the OS and DFS of OC patients, which means that the survival period is shorter in patients with high expression of the CHSY1 gene. This result indicated that CHSY1 might be used as an indicator of the prognosis of OC.

Cells with CHSY1 knockdown constructed by lentiviral transfection exhibited decreased proliferation and invasion abilities, indicating that CHSY1 promotes the growth and metastasis of malignant tumours in vitro. However, the mechanisms are unknown. Therefore, in the next step, we identified the expression changes in other genes after CHSY1 knockdown through transcriptome sequencing and identified the main abnormally expressed genes, including TIAM1. TIAM1, a guanine nucleotide exchange factor, was originally identified as an invasion and metastasis-inducing gene in T lymphoma cells^[18]. Studies have revealed that TIAM1 is also expressed at abnormally high levels in colorectal cancer and promotes chemoresistance and tumour invasiveness; TIAM1 exerts this effect by enhancing stemness^[19]. The role of TIAM1 in OC has been poorly studied. It was reported that high expression of TIAM1 was correlated with a poorer prognosis in patients with OC, and repressing TIAM1 to inactivate the Notch signalling pathway could inhibit OC growth^[20]. In the current study, TIAM1 was identified among the genes altered by CHSY1 knockdown, and we proved that knockdown or overexpression of CHSY1 caused the synchronous expression of TIAM1 by qRT‒PCR and western blotting. Further experiments confirmed that the cell proliferation and metastatic capacity were enhanced when CHSY1 was overexpressed but decreased when TIAM1 was knocked down, indicating that TIAM1 is a necessary factor facilitating the tumour-promoting role of CHSY1. The same results were confirmed in animal experiments: in mice, tumours derived from cells with CHSY1 overexpression grew fast and became large, while the tumours grew slower when TIAM1 was knocked down, which also demonstrated that CHSY1 exerts its tumour-promoting role through TIAM1 in vivo. Therefore, we confirmed for the first time that CHSY1 affects the development and progression of OC by regulating TIAM1 both in vitro and in vivo.

IPA classical pathway analysis based on the gene sequencing data was performed to build a pathway network; the results revealed that CHSY1 could affect TIAM1, which is involved in the ERK signalling pathway. By western blotting, we confirmed that the mTOR, p-mTOR, and p-ERK1 proteins were downregulated, while ERK, P38, P53, TNF-α, and β-catenin showed no significant difference in the shCHSY1 group compared with the shCtrl group. When an ERK inhibitor was added to the shCHSY1 group, the tumour-promoting effects of CHSY1 were suppressed. Thus, the ERK signalling pathways regulates the action of CHSY1 in OC.

This study first found that CHSY1 is highly expressed in OC and can be used as a prognostic factor. CHSY1 exerts a tumour-promoting role through its downstream gene TIAM1 and the ERK signalling pathway.

Full name	Abbreviation
Chondroitin synthase-1	CHSY1
T-lymphoma invasion and metastasis-inducing protein 1	TIAM1
tissue microarray	TMA
quantitative real-time polymerase chain reaction	qRT‒PCR
ovarian cancer	OC
Chondroitin sulfate	CS
Immunohistochemistry	IHC
standard deviation	SD
disease-free survival	DFS
overall survival	OS
false discovery rate	FDR
Ingenuity Pathway Analysis	IPA
Cell Counting Kit-8	CCK-8

Ethics approval and consent to participate

This study was approved by the Ethics Committee of the Renmin Hospital of Wuhan University, and ethical application acceptance number is WDRY2023-K054.

This study was approved by the Laboratory Animal Ethics Committee of Renmin Hospital of Wuhan University. The IACUC issue No. Is WDRM20230206A.

Consent for publication

Not applicable.

Availability of data and materials

The whole raw sequencing data of this study have been uploaded at GEO and the data number is GSE232722.The data is still private, but a 'private access token' has be created for distribution to journal reviewers.To review GEO accession GSE232722:

Go to https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE232722

Enter token ejkpyoairlalbyb into the box

Competing interests

The authors declare that they have no competing interests.

Funding

The study was supported by two funds.

Natural Science Foundation of Shanxi Province(202103021224387)
Tianjin Key Medical Discipline(Specialty) Construction Project（TJYXZDXK-009A）

Authors' contributions

Jinling Huang¹*, Qinmei Feng²*, Huijuan Wu³* are first authors and these co-authors contributed equally to this work; They developed the methodology and wrote, reviewed and revised the paper;

Corresponding author：Liangbin Xia, conceived and designed the study;

Qinmei Feng, Huijuan Wu, Jinling Huang, Sihan Xia and Liyan Wang acquired, analysed and interpreted the data and performed statistical analysis.

All authors read and approved the final paper.

Acknowledgements

Not applicable

Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin. 2016;66:7–30.
Volpi N, Maccari F, Mantovani V. Chondroitin sulfate and glucosamine as disease modifying anti- osteoarthritis dru gs (DMOADs). Curr Med Chem. 2016;23:1139–51.
Mikami T, Kitagawa H. Biosynthesis and function of chondroitin sulfate. Biochim et Biophys Acta (BBA). 2013;1830:4719–33.
Nadanaka S, Kinouchi H, Kitagawa H. Chondroitin sulfates-mediated N-cadherin/β-catenin signaling is associated with basal-like breast cancer cell invasion. J Biol Chem. 2017;293:444–65.
Pantazaka E, Papadimitriou E. Chondroitin sulfate-cell membrane effectors as regulators of growth factor-mediated vascular and cancer cell migration. Biochim Biophys Acta. 2014;1840:2643–50.
Wilson DG, Phamluong K, Lin WY, Kai Barck, Richard AD, Carano L, Diehl, et al. Chondroitin sulfate synthase 1 (Chsy1) is required for bone development and digit patterning. Dev Biol. 2012;363:413–25.
Momose T, Yoshimura Y, Harumiya S, Ken'ichi Isobe M, Kito M, Fukushima, et al. Chondroitin sulfate synthase 1 expression is associated with malignant potential of soft tissue sarcomas with myxoid substance. Hum Pathol. 2016;50:15–23.
Liu CH, Tseng TJ, Chou JF, To-Jung, Tseng. Wen-Chieh Liao. CHSY1 promotes aggressive phenotypes of hepatocellular carcinoma cells via activation of the hedgehog signaling pathway. Cancer Lett. 2017;403:280–8.
Zeng L, Qian J, Luo X, Zhou A, Zhang Z, Fang Q. CHSY1 promoted proliferation and suppressed apoptosis in colorectal cancer through regulation of the NFκB and/or caspase-3/7 signaling pathway. Oncol Lett. 2018;16:6140–6.
Matthew E, Ritchie B, Di Phipson Y, Charity Hu, Law W, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43(7):e47.
Hashimoto SI, Ogoshi K, Sasaki A, Abe J, Qu W, Nakatani Y, et al. Coordinated changes in DNA methylation in antigen–specific memory CD4 T cells. J Immunol. 2013;190:4076–91.
Wilson DG, Phamluong K, Lin WY, Barck K, Carano RA, Diehl L, Peterson AS, Martin F, Solloway MJ. Chondroitin sulfate synthase 1 (Chsy1) is required for bone development and digit patterning. Dev Biol. 2012;363:413–25.
Li Y, Laue K, Temtamy S, Aglan M, Kotan LD, Yigit G, et al. Temtamy preaxial brachydactyly syndrome is caused by loss-of-function mutations in chondroitin synthase 1, a potential target of BMP signaling. Am J Hum Genet. 2010;87:757–67.
Wu ZY, He YQ, Wang TM, Yang DW, Li DH, Deng CM et al. Glycogenes in Oncofetal Chondroitin Sulfate Biosynthesis are Differently Expressed and Correlated With Immune Response in Placenta and Colorectal Cancer. Front Cell Dev Biol 2021 Dec 13;9:763875.
Momose T, Yoshimura Y, Harumiya S, Isobe K, Kito M, Fukushima M, et al. Chondroitin sulfate synthase 1 expression is associated with malignant potential of soft tissue sarcomas with myxoid substance. Hum Pathol. 2016;50:15–23.
Liu J, Tian Z, Liu T, Wen D, Ma Z, Liu Y, et al. CHSY1 is upregulated and acts as tumor promotor in gastric cancer through regulating cell proliferation, apoptosis, and migration. Cell Cycle. 2021;20(18):1861–74.
Morand S, Devanaboyina M, Staats H, Stanbery L, Nemunaitis J. Ovarian Cancer Immunotherapy and Personalized Medicine. Int J Mol Sci 2021 Jun 18;22(12):6532–50.
Li H, Cui X, Chen D, Yang Y, Piao J, Lin Z, et al. Clinical implication of Tiam1 overexpression in the prognosis of patients with serous ovarian carcinoma. Oncol Lett. 2016 Nov;12(5):3492–8.
Izumi D, Toden S, Ureta E, Ishimoto T, Baba H, Goel A. TIAM1 promotes chemoresistance and tumor invasiveness in colorectal cancer. Cell Death Dis. 2019 Mar 19;10(4):267–278.
Han FJ, Li J, Shen Y, Guo Y, Liu YC, Yu Y et al. microRNA-1271-5p/TIAM1 suppresses the progression of ovarian cancer through inactivating Notch signaling pathway. J Ovarian Res 2020 Sep 18;13(1):110.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Title：CHSY1 promotes the tumorigenesis and progression of ovarian cancer. Running title：CHSY1 in ovarian cancer

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Background

Materials and Methods

TMA and antibodies

Immunohistochemistry (IHC)

Cell culture and transfection

Vector construction and lentivirus infection

Construction of the vector for overexpression of target gene

Quantitative real-time polymerase chain reaction (qRT‒PCR)

Western blotting

Celigo Cell Counting Assay

EdU cell proliferation detection

Flow cytometric analysis of apoptosis

Wound healing assay

Transwell assay

Transcriptome sequencing

Xenograft assay

Statistical analysis

Results

Knockdown of CHSY1 in OC cells in vitro by lentivirus

Knockdown of CHSY1 inhibits the proliferation and migration of OC cells in vitro

Total RNA quality inspection of the chip samples

Knockdown of CHSY1 caused the aberrant expression of related genes

Knockdown or overexpression of CHSY1 causes the synchronous expression of TIAM1

CHSY1 affects the proliferation and metastatic ability of OC cells through TIAM1

CHSY1 affects the proliferation and metastasis of OC cells via the ERK signalling pathway

CHSY1 promotes the growth of OC via TIAM1 in vivo

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1