This study was approved in the Faculty of Rehabilitation Sciences of Shiraz and was approved with the code of ethics 144021. Experiments were performed on40 male Wistar rats weighing 230–280 g prepared from the animal reproduction center of Shiraz University, Iran. The rats were kept in a room with 22 ± 2ºC temperature under 12 hours dark/12 hours light cycle with access to food and water. Rats were first randomly divided into four groups: healthy without inactivity, healthy with combined exercise, diabetic without exercise, and diabetic with combined exercise. Induction of diabetes in rats of two diabetic groups was performed by one intraperitoneal injection of streptozotocin solution (STZ) dissolved in 0.1 M citrate buffer, pH = 4.5 and 55 mg/kg rat weight healthy animals were also injected with the equivalent volume of citrate buffer. Five days after injection, blood glucose concentration was measured using a glucometer and blood samples taken from the caudal vein of rats, and rats with more than 200 mg/dl fasting glucose were considered diabetic [11].
After adapting to the laboratory environment and getting acquainted with the rodent treadmill and ladder, special resistance training for rodents and swimming pool, daily training was performed for ten to 15 minutes in a week.
Insulin measurement method
Serum insulin concentration using chemical immunometric method using analyzer (Immulite2000) Made in America was determined.
BDNF levels: In this study, hippocampal BDNF levels were determined through western blotting.
BDNF was measured in the hippocampus of the brain. In order to extract protein, 100 mg of hippocampal tissue was combined with 500 microliters of PBS and 100 mg of standard calcium homogenizer and lysed with the help of a disseminator. Then the samples are centrifuged at 16000 rpm and the Bradford method was used to measure the protein concentration.
The BDNF measurement kit made by American company Promega, Madison, WI, USA was selected in terms of picograms per milligram.
Maximum speed measurement method
At first, the rats were introduced to living conditions in the laboratory and how to run on a treadmill for 7 days, at the beginning of the, the rats performed a warm-up program at a speed of 10 meters per minute for 10 minutes. Then they entered the test phase and for every two minutes, the treadmill speed increased by 0.03 m/s until the rats were unable to continue the test (inability to run on the treadmill and go to the end space of the treadmill). After the test was over, the speed at which the rat ran (the last speed in the exhaustion phase) was recorded [12].
Exercise protocol
The training consisted of a combination of endurance and resistance training (Table 1).
Table 1
| | | first week | second week | third week | forth week | fifth week | sixth week | seventh week | eighth week |
| Aerobic | intensity | 40% | 50% | 50% | 60% | 65% | 70% | 75% | 75% |
| Aerobic | Period | 10 | 10 | 15 | 20 | 25 | 30 | 30 | 30 |
| resistance | intensity | 5% | 10% | 15% | 15% | 20% | 35% | 40% | 45% |
| resistance | Period | 4*3 | 4*3 | 4*3 | 4*3 | 4*3 | 4*3 | 4*3 | 4*3 |
Table 2
Sequence of primers used in real time
| Gene | Forward | Reverse |
| GAPDH | CAAGATCATCAGCAATGCCTCC | GCCATCACGCCACAGTTTCC |
| miR − 132 | GACAGGGACCGTGGCTTTC | CCAGTGCAGGGTCCGAGGTA |
In order to perform endurance training, in the first and second weeks, the duration of running on the treadmill is 10 minutes with 40 and 50% intensity. In the fifth week 25 minutes of 65%, and finally in the last two weeks up to 30 minutes of activity and its intensity was 70 and 75% of the maximum rate of piloted diabetic rats, which was performed for 8 weeks.
Resistance training included climbing a one-meter ladder by adding weights to the tails. Exercise 5 days a week in 3 cycles with 4 repetitions, the rest interval between repetitions was one minute and between periods was 3 minutes. rats were weighed every week and in the first week the amount of weight was 5% and in the second 10% of the weight of the rats, in the third and fourth weeks 15 and 20%, in the fifth week 30%, in the sixth week 35%, in the seventh and eighth weeks 40 and 45%. Resistance was selected and performed by rats and only introverted contraction was used to avoid inflammation and muscle contusion. The rats then rested for one hour, after which aerobic activity began [13].
Mensuration of spatial learning and memory
The test was performed 3 days. The whole experiment consisted of three days of training and one 1day of testing, and every day and exercise during which transfer, recall, retention and open platform tests were performed. The training consisted of dropping the animal four times in a blue maze. To do this, the maze was divided into four equal parts.
(INSR3T) The time (seconds) that the animal was exactly at the location of the plexiglass platform (hidden platform. The time (seconds) it takes for the animal to reach the Plexiglas platform for the first time (FGT)
In this way, four points were created around the maze, four points north, south, west and east, and each time the animal was released into the water, the mouse was released into the water from one of these points. The mouse had 60 seconds to find the platform. If he found the platform during this time, he would be allowed to stand on the platform for 10 seconds and then exit the pool. At the end of the experiments each day, the animal was gently returned to the cage with a dry towel. On the last day, the platform was taken out of the pool and each animal was placed inside the pool. During the 60 seconds the animal was in the pool, the length of time the animal swam every 15 seconds in a quarter of the target (a quarter of the pool where the platform was located) was measured [13].
RNA purification
First, about 500 mg of the desired tissue was separated and placed inside the grinder, and then 700 microliters of Trizol solution was added and completely homogenized using the grinder. Then, the resulting solution was cooled for 10–15 minutes. Then about 200 microliters of chloroform were added to it and incubated on ice for 10 minutes. the resulting mixture was completely homogenized and incubated again for 10–15 minutes in ice. the tube was centrifuged for 15 minutes at 4°C and at 12000 rpm.
After centrifugation, the solution inside the tube had 3 phases, the clear blue upper phase containing RNA, the white middle phase, and the red (organic) microtube bottom phase containing protein and DNA. The upper phaseThe clear blue containing RNA was transferred to a new microtube and 1 ml of isopropanol at temperatureminus 24 degrees was added to it (if RNA is present in the medium by adding isopropanol).
The solution becomes cloudy. Then the microtube is placed in the freezer at minus 20 for 20–30 minutes. The grade was transferred. Then the desired tube was centrifuged for 10 to 20 minutes.
All the supernatant was removed and then 1 ml of 75% ethanol was added to the microtube and centrifuged at 7500 rpm for 10 minutes. Then the supernatant was removed and the washing step was repeated with 75% ethanol. Then the plate was completely dried for 10 minutes. Then about 40 microliters of water Depc solution was added and the tube
It is placed in the Bath dry machine at a temperature of 65 degrees Celsius for 10 minutes and during this. The tubes were shaken several times to dissolve sediment and RNA in water. At the end of the tubes to the freezer was transferred to minus 80 degrees Celsius.
cDNA synthesis
After determining the concentration and purity of the extracted RNAs and ensuring the absence of phenolic, protein and DNA contamination in the extraction solution, cDNA was synthesized using the TAKARA cDNA synthesis kit in a final volume of 20 microliters.
First, according to the concentration of RNAs, the appropriate volume of the desired RNAs was obtained with the following formula:
Sample volume of = 𝑚𝑅𝑁𝐴 concentration𝑚𝑅𝑁𝐴 𝜇𝑔𝑟
Real time PCR
Real time PCR was performed using Real time PCR lightcynler device manufactured by Roche company to ensure correct cDNA synthesis. In this step, each sample was prepared in a final volume of 10 microliters. First, 2 microliters of water, 5 microliters of Cybergreen master mix, 2 microliters of diluted cDNA and 1 microliter of specific primers or GAPDH (as a reference gene) were added to the strip microtube. Then the microtubes were spun with a centrifuge and placed inside the real time PCR machine under specific temperature conditions.
Then it was mixed with an appropriate amount of Depc water so that the final concentration of RNA in the samples reached 2–3 mg per microliter, the final volume of the mixture of water and RNAs was equal to 13 microliters, to which 1 microliter of randomhexmer primer and 1 microliter of oligodt primer was added and the above combination was incubated for 5 minutes at a temperature of 65 degrees Celsius in a thermocycler, the reason for this incubation is the opening of the secondary structures in the RNA structure and making it single-stranded so that the primer is connected to the template, then the mixture of 1 microliter of enzyme Reverse Transcriptase and 4 microliters of 1 x 5 buffer for the synthesis of cDNAs in the kit were added to synthesize cDNA according to the following program. For this purpose, a thermocycler made by the company - BIORAD was used. For long-term storage, cDNA was kept at minus 20 degrees, but it must be refrigerated for use.
The following formula was used to analyze the data:
Δ CT = Target GeneCt- House keeping GeneCt
ΔΔCT(Margin) = Ct – Target Gene (Margun)- Ct House keeping Gene (margin)
The amount of miR-132 in hippocampus was measured in this study through real time test.
The method of measuring the level of mir132 in blood serum was performed through gene expression.
Statistical analysis
one-way analysis of variance was used was performed using SPSS software version 26. Significance level was considered p ≤ 0.05.