The molecular mechanism of MiR-26a-5p regulates excessive autophagy and activates NLRP3 inflammasome to mediate cardiomyocyte hypertrophy

doi:10.21203/rs.3.rs-3108457/v1

Download PDF

Research Article

The molecular mechanism of MiR-26a-5p regulates excessive autophagy and activates NLRP3 inflammasome to mediate cardiomyocyte hypertrophy

https://doi.org/10.21203/rs.3.rs-3108457/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 03 Jan, 2024

Read the published version in BMC Cardiovascular Disorders →

You are reading this latest preprint version

Objective: Many studies have found that miR-26a-5p plays an essential role in the progression of pathological cardiac hypertrophy, but whether the role of miR-26a-5p is related to the regulation of autophagy leading to activation of NLRP3 inflammasome. And the mechanism of miR-26a-5p and NLRP3 inflammasome aggravating pathological cardiac hypertrophy remain unclear.

Methods: Cardiomyocytes were treated with 200μM PE to induce cardiac hypertrophy and intervened with 10mM NLRP3 inhibitor INF39. In addition, we also used the pLL3.7 lentiviral vector to construct sh-RNA-miR-26a-5p interference plasmid and PLL3.7-cmv-miR-26a-5p overexpression plasmid to transfect PE-induced cardiac hypertrophy. RT-qPCR and western blotting were used to detect the expressions of miR-26a-5p, NLRP3, ASC and Caspase-1 in each group, and we used α-SMA immunofluorescence to detect changes in the cardiomyocyte area. The expression levels of autophagy proteins LC3, beclin-1 and p62 were detected by western blotting. Finally, we induced the SD rat cardiac hypertrophy model through aortic constriction (TAC) surgery. In the experimental group, rats were intervened with miR-26a-5p overexpression lentivirus, miR-26a-5p interference lentivirus, autophagy inhibitor 3-MA, and autophagy activator Rapamycin.

Results:In cell experiments, the expression of miR-26a-5pwas associated with cardiomyocyte hypertrophy and increased surface area. In addition, miR-26a-5ppromoted autophagy and NLRP3 inflammasome pathway activation, increasing or decreasing the gene and protein expression of LC3, Bclin1, p62, ACS, NLRP3, and Caspase-1. We found similar results in the TAC rat model, where miR-26a-5pexpression was associated with cardiomyocyte enlargement and cardiac interstitial and perivascular fibrosis. miR-26a-5p adenovirus transfection regulates the activation of the NLRP3 pathway.

Conclusion: Our research observed the expression of miR-26a-5p is related to cardiomyocyte hypertrophy, and its mechanism may be associated with the activation of the NLRP3 inflammasome pathway caused by miR-26a-5p's excessive promotion of autophagy. Therefore, targeting the expression of miR-26a-5p, inhibiting the activation of autophagy and NLRP3 inflammasome pathway, may bring more options for treating pathological cardiac hypertrophy.

miR-26a-5p

cardiac hypertrophy

apoptosis

autophagy

cardiomyocytes

Pathological myocardial hypertrophy is an independent risk factor for cardiovascular diseases. The continuous development of myocardial hypertrophy will cause myocardial ischemia, decreased myocardial compliance, arrhythmia, etc., eventually leading to severe consequences such as heart failure and sudden death^{[1, 2]}. Therefore, the prevention and treatment of pathological myocardial hypertrophy have always been important in medical research. Pathological cardiac hypertrophy is often accompanied by pathological changes such as the increased size of cardiomyocytes, increased number of sarcomeres, increased protein synthesis, a proliferation of interstitial cells, and hyperplasia of fibrous tissue^[3–6]. Although some genes and signalling pathways were involved in the pathological process of cardiac hypertrophy, their mechanism has yet to be fully elucidated, and further research is needed^[7–10].

Relevant studies have found that interleukin-lβ (IL-1β) plays a vital role in the pathogenesis of cardiac hypertrophy. For example, IL-1β expression increased in cultured primary cardiomyocytes and animal experiments. And the increase of IL-1β expression is more evident in heart failure^{[11, 12]}, And transgenic mice overexpressing IL-1β had cardiomyocyte hypertrophy and increased expression of ANP and β-MHC^[13]. However, the splicing and maturation of IL-1β precursor require the participation of NLRP3 inflammasome^[14]. In the previous study of our research group^[15], we found that knocking down miR-26a-5p can improve pathological cardiac hypertrophy by regulating autophagy, but whether miR-26a-5p regulates autophagy is associated with NLRP3 inflammasome, which leads to the aggravation of pathological cardiac hypertrophy, and the regulatory mechanism between them need further study.

Therefore, our study intends to explore the expression and role of the NLRP3 inflammasome signalling pathway in pathological cardiac hypertrophy by constructing cell and animal models of pathological cardiac hypertrophy; Then, the regulation of miR-26a-5p on the NLRP3 inflammasome signalling pathway was explored through cell and animal experiments, and whether miR-26a-5p is a key molecule regulating pathological cardiomyocyte hypertrophy mediated by the NLRP3 inflammasome signalling pathway. Finally, the molecular mechanism of miR-26a-5p regulating excessive autophagy leading to NLRP3 inflammasome activation was further explored, and the potential clinical value of miR-26a-5p molecule as a diagnostic and therapeutic target for cardiac hypertrophy was elucidated.

Cell culture and treatments

Cardiomyocytes were cultured in DMEM medium containing 10% fetal bovine serum, and the incubator environment was 37°C, including 5% carbon dioxide and saturated humidity. The medium was changed and subcultured regularly. After a stable cell state, cardiomyocyte hypertrophy was induced with PE (200 µM).

RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR)

According to the experimental grouping, after extracting total RNA from cardiomyocytes, the purity and concentration of RNA were determined, and the RNA was reverse transcribed into cDNA with Revertaid First Strand cDNA Synthesis Kit (THERMO). Then cDNA, primers and DEPC water were added in a 20ul system, and the SsoAdvance Universal SYBR Green SuperMix (BIO-RAD) system was used for automatic sample amplification. The results were calculated using the quantitative PCR analysis software BIO-RAD CFX Manager 3.1. Finally, using the target gene/GAPDH, the relative expression level of the target gene was determined by the 2^−ΔΔCt method. The primers of genes were as follows (Table 1).

Table 1

The primers of target genes
Name	Sequence(5’-3’)
GAPDH	CTCTCTGCTCCTCCCTGTTC
	TACGGCCAAATCCGTTCACA
miR-26a-5p	CGCGTTCAAGTAATCCAGGA
	AGTGCAGGGTCCGAGGTATT
NLRP3	CTGCATGCCGTATCTGGTTG
	ATGTCCTGAGCCATGGAAGC
ASC	ACAGTACCAGGCAGTTCGTG
	GGTCTGTCACCAAGTAGGGC
Caspase-1	CACGAGACCTGTGCGATCAT
	GCGCCACCTTCTTTGTTCAG

Western blotting analysis

The treated cells were added with appropriate RIPA lysis buffer (Beyotime Biotech, Shanghai, China) to extract total protein. Quantification and sample preparation were performed after complete protein extraction. After loading, the protein was separated by SDS-PAGE, transferred to the PVDF membrane, and blocked with 5% skimmed milk. Next, incubated overnight at 4°C with the primary antibody and then incubated with the secondary antibody for 1h at room temperature. After the PVDF membrane was washed for 30 minutes, the protein was developed with enhanced ECL reagent, and results were detected with a gel imaging system. Primary antibody concentrations were: LC3 (1/1000, Sangon Biotech Co., Ltd., Shanghai, China), beclin1 (1/1000, Sangon Biotech Co., Ltd., Shanghai, China), P62 (1/1000, Sangon Biotech Co., Ltd., Shanghai, China), GAPDH (1/5000, Atagenix, Wuhan, China). And secondary antibody: goat anti-rabbit secondary antibody (1/5000). NLRP3 (1/1000, Shanghai Sangong Biotechnology Co., Ltd., China), ASC (1/1000, Shanghai Sangong Biotechnology Co., Ltd., China), Caspase-l (1/1000, Shanghai Sangong Biotechnology Co., Ltd., China). Secondary antibody concentration: goat anti-rabbit secondary antibody (1/5000). GAPDH was used as an internal reference, and the relative protein expression was calculated using the ImageJ system to read the grey values.

Immunofluorescence and confocal microscopic assay

The cardiomyocytes were stained with α-SMA immunofluorescent after cell slides were made, and the image area changes were observed under a confocal fluorescence microscope. The detailed operation has been illustrated in our previous study^[15].

Construction of lentiviral vector for SLC26A4 interference and overexpression

The sh-RNA- miR-26a-5p interference plasmid and PLL3.7-cmv- miR-26a-5p over-expression plasmid were constructed using the pLL3.7 lentiviral vector. The constructed plasmids were co-transfected in 293T cells and packaged shRNA-PLAC1 interference lentivirus and PLL3.7-cmv- miR-26a-5p overexpressing lentivirus. Then cardiomyocytes were infected with packaged lentivirus, and the infection effect of lentivirus was tested and verified.

Animals and treatments

A total of 45 healthy SD rats were purchased from Hangzhou Medical College (Hangzhou, China), weighing 250 ± 20 g.SD rats were randomly divided into sham operation group, aortic constriction (TAC) operation group, model (TAC) + INF39 treatment group, model (TAC) + miR-26a-5p overexpression lentivirus group, model (TAC) + miR-26a-5p overexpression lentivirus + autophagy Inhibitor 3-MA treatment group, model (TAC) + miR-26a-5p interference lentivirus group, model (TAC) + miR-26a-5p interference lentivirus + autophagy activator Rapamycin group,5 rats in each group. In the TAC operation group, the model of pathological cardiac hypertrophy was established by transverse TAC operation. SD rats were intraperitoneally injected with a mixed anaesthetic of ketamine (8mg/100g), xylazine (2mg/100g) and atropine (0.06mg/100g), and then intubated tube connected ventilator to control breathing, tidal volume is 2-3ml and respiratory rate is 90–110 times/min. The surgical area was cleaned, and a median anterior chest incision was made to open thoracotomy to the second rib, separated thymus exposed aortic arch. selected the needle pad hole according to the diameter of the aortic arch (1.0-1.1mm), and prick the needle with a 26-27G pad (0.4-0.6mm in diameter). Used No. 5 silk thread to narrow the aorta at 0.3 cm after the branch of the right common carotid artery. After the ligation is firm, pull out the pad, prick the needle and close the mediastinum layer by layer. After the spontaneous breathing of SD rats recovered, the tracheal intubation was removed and transferred rats to the cage for routine feeding. Aortic arch ligation was not performed in the sham operation group, and the rest of the procedure was the same as in the operation group. In the model (TAC) INF39 treatment group, NLRP3 inhibitor INF3 was injected intraperitoneally once every 2 days while the routine feeding was carried out, and the model group was injected with normal saline as a control, SD rats were sacrificed with spinal cord dislocation 4 weeks later. The gene and protein expressions of miR-26a-5p, NLRP3, ASC, pro-Caspase-1 and Caspase-1 were detected by q-PCR and Western blot. The primers of target genes are listed in Table 1. In addition, the heart tissues of the rats were observed by haematoxylin–eosin (HE) staining.

Immunohistochemical analysis

Fresh heart tissue from mice was fixed in 4% paraformaldehyde for over 24 hours. After dehydration, the paraffin-soaked heart tissue was embedded in an embedding machine. After the wax solidified, the trimmed wax blocks were placed on a paraffin microtome and cut into 4 µm thick sections, and then the paraffin sections were dewaxed. Then, nuclei were stained with hematoxylin for 5–10 min. Stain the cytoplasm with eosin for 1–3 min. Placed the dehydration sealing sheet, put the section into 95% ethanol I 5min, 95% ethanol II 5min, absolute ethanol I 5min, absolute ethanol II 5min, xylene I 5min, xylene II 5min dehydration, then use neutral gum seal. Finally, staining results were checked with an upright optical microscope (Olympus Corporation, Japan), followed by image acquisition and analysis.

Statistical analysis

All data were statistically analyzed using GraphPad Prism software (Graph Pad Software, Inc., San Diego, California, USA) and expressed as mean ± standard deviation. The t-test was used to compare two groups, and used one-way analysis of variance was used to compare multiple groups, and multiple comparisons were performed. The results were considered statistically significant when a P value < 0.05.

miR-26a-5p and pyroptosis-associated proteins were up-regulated in PE-induced cardiac hypertrophy

Firstly, according to our previous study, we utilized 200 µM PE to induce the hypertrophy model of cardiomyocytes. The results of immunofluorescence and confocal microscopy showed that the expression of α-SMA in the myocardial tissue of rats with PE-induced cardiac hypertrophy was significantly higher compared with the control group (Fig. 1A). After PE treatment, the cell surface area increased (p < 0.001), and after INF39 intervention, it was significantly down-regulated (p < 0.05), as shown in Fig. 1B. And we further detected miR-26a-5p and pyroptosis-associated protein by q-PCR and Western blotting; we found that the expressions of miR-26a-5p was significantly up-regulated in the PE group (p < 0.001), and the gene expression was significantly increased after INF39 intervention down-regulated (p < 0.05), as shown in Fig. 1C. Western blotting analysis also found the expressions of miR-26a-5p, ACS, NLRP3, Caspase-1 were significantly up-regulated in the PE group (p < 0.001), and the gene expression was significantly increased after INF39 intervention down-regulated (p < 0.01) (Fig. 1D-G).

miR-26a-5p overactivated autophagy leading to NLRP3 inflammasome activation in a PE-induced cardiomyocyte hypertrophy model

We found that miR-26a-5p was up-regulated in PE-induced cardiac hypertrophy, which could participate in the processes of cardiac hypertrophy. Therefore, we further explored the mechanism of miR-26a-5p-induced cardiomyocyte hypertrophy. Firstly, we detected the expression of miR-26a-5p after overexpression and interference adenovirus infection of cardiomyocytes; q-PCR results showed (Fig. 2A) after miR-26a-5p overexpression adenovirus transfected cells, the expression of miR-26a-5p was significantly increased (p < 0.001), after sh-RNA- miR-26a-5p adenovirus transfection, the expression of miR-26a-5p was inhibited considerably (p < 0.001). Furthermore, in the PE model, we observed that the expression of miR-26a-5p, ACS, NLRP3, and Caspase-1 in the PE group was significantly higher than the control group (p < 0.001), after transfection of cardiomyocytes with miR-26a-5p adenovirus, compared with a control group, the expression of miR-26a-5p, ACS, NLRP3, and Caspase-1 in miR-26a-5p adenovirus PE group was more significantly increased (p < 0.001). Gene expression was down-regulated considerably after the autophagy inhibitor 3-MA treatment (p < 0.001). However, after sh-RNA-miR-26a-5p adenovirus transfected cardiomy-ocytes, compared with the control group, the expression of miR-26a-5p, ACS, NLRP3, and Caspase-1 was significantly inhibited in sh-RNA- miR-26a-5p adenovirus group (P < 0.01), and similar results were also found in sh-RNA- miR-26a-5p adenovirus + PE group (p < 0.05). After treatment with autophagy activator Rapamycin, there was no significant difference between the sh-RNA- miR-26a-5p adenovirus + PE + Rapa group and the control group; results are shown in Fig. 2B-E.

Then we examined the expression of autophagy and pyroptosis proteins. We observed that compared with the control group, the expression levels of LC3 and Bclin1 were significantly increased (p < 0.001), the expression levels of ACS, NLRP3, and Caspase-1 also increased (p < 0.01), but p62 was significantly decreased in PE group (p < 0.01). After miR-26a-5p adenovirus transfected cardiomyocytes, the expression levels of LC3, Bclin1, ACS, NLRP3, and Caspase-1 was more significantly increased (p < 0.001), p62 was more significantly decreased (p < 0.001). After treatment with the autophagy inhibitor 3-MA, the expression levels of LC3, Bclin1, ACS, NLRP3, and Caspase-1 were significantly decreased (p < 0.001), and p62 was significantly up-regulated (p < 0.001). We also observed that the expression levels of LC3, Bclin1, ACS, NLRP3, and Caspase-1 were inhibited considerably (p < 0.001), and p62 was significantly up-regulated (p < 0.001) after sh-RNA- miR-26a-5p adenovirus transfected cardiomyocytes. When we treated with the autophagy activator Rapamycin, the protein expression of LC3, Bclin1, p62, ACS, NLRP3, and Caspase-1 was mildly inhibited or showed no significant difference compared with the control group; results were shown in Fig. 2F-L.

Expression of miR-26a-5p was associated with PE-induced changes in the cardiomyocyte area

Then we used Immunofluorescence and confocal microscopic assay to detect whether the expression of miR-26a-5p was related to the change of cardiomyocyte area induced by PE. We observed that PE significantly increased the cell surface area (p < 0.001), and the increase was more significant after transfection with miR-26a-5p adenovirus (p < 0.001), but the cell surface area decreased after the intervention of autophagy inhibitor 3-MA (p < 0.05). Conversely, the cell surface area was significantly down-regulated after transfection with sh-RNA- miR-26a-5p adenovirus (p < 0.01), but the cell surface area was significantly increased after the intervention of autophagy activator Rapamycin (p < 0.01) (Fig. 3). This phenomenon shows the expression of miR-26a-5p is associated with PE-induced changes in the cardiomyocyte area.

Expression of miR-26a-5p leaded to cardiac structural changes in TAC model rats

Our study explored the structural changes in the heart of TAC model rats after miR-26a-5p and sh-RNA-miR-26a-5p adenovirus transfection. The HE staining showed that the heart's shape in the sham operation group was standard, the cardiomyocytes were arranged neatly, and the intercellular space was clear. Compared with the model (TAC) group, the model (TAC) INF39 group and the model (TAC) miR-26a-5p interference lentivirus group had significantly improved cardiomyocyte enlargement and cardiac interstitial and perivascular fibrosis. The myocardial cells in the other groups were disorderly arranged, and the myocardial fibres were obviously thickened and thickened (Fig. 4).

miR-26a-5p was associated with NLRP3 inflammasome activation in TAC model rats

Firstly, we used Immunohistochemical analysis to analyze the specific mechanism of miR-26a-5p -induced cardiac hypertrophy in TAC rats. We observed that compared with the control group, the expression of NLRP3 and IL-β in the TAC group was significantly up-regulated (p < 0.001) and significantly decreased after the intervention of INF39. We also found that the TAC miR-26a-5p adenovirus group expression was even more significant (p < 0.001). However, it was improved after autophagy inhibitor 3-MA treatment or transfection with sh-RNA-miR-26a-5p adenovirus (Fig. 5).

Then we extracted rat heart tissue to further detect the expression levels of NLRP3 and IL-β mRNA and proteins. Q-PCR results showed (Fig. 6A-E) the expression of miR-26a-5p, ACS, NLRP3, Caspase-1 and IL-1-β in the TAC model group was significantly higher than the control group (p < 0.001), after transfection of cardiomyocytes with miR-26a-5p adenovirus, compared with a control group, the expression of miR-26a-5p, ACS, NLRP3, Caspase-1 and IL-1-β was more significantly increased (p < 0.001). Gene expression was significantly down-regulated after the autophagy inhibitor 3-MA treatment (p < 0.001). However, after sh-RNA-miR-26a-5p adenovirus transfection, compared with the control group, the expression of miR-26a-5p, ACS, NLRP3, Caspase-1, and IL-1-β was no significant difference in TAC + sh-RNA- miR-26a-5p adenovirus group (P > 0.05), and similar results were also found in TAC + sh-RNA-miR-26a-5p adenovirus + Rapa group (p > 0.05).

We also observed that compared with the control group, the TAC model group's expression levels of ACS, NLRP3, pro-Caspase-1, and Caspase-1 increased (p < 0.001). After miR-26a-5p adenovirus transfected cardiomyocytes, the expression levels of ACS, NLRP3, pro-Caspase-1 and Caspase-1 were more significantly increased (p < 0.001), And after treatment with the autophagy inhibitor 3-MA, the expression levels of ACS, NLRP3, pro-Caspase-1 and Caspase-1 was significantly decreased (p < 0.001). Furthermore, we observed that the expression levels of NLRP3 and pro-Caspase-1 were significantly inhibited (p < 0.001), and the expression of ACS and Caspase-1 was no significant difference compared with the control group (p > 0.05) after sh-RNA-miR-26a-5p adenovirus transfection. When we treated with the autophagy activator Rapamycin, the protein expression of ACS and pro-Caspase-1 was significantly increased (p < 0.001), and NLRP3 also increased(p < 0.01); results were shown in Fig. 6F-J.

NLRP3 inflammasome is one of the more in-depth researched inflammasomes at present and composed of NOD-like receptors, adapter protein ASC and effector protein Caspase-1 (IL-1β converting enzyme), which can promote IL-1β, IL-18 and IL-33 splicing and maturation^[16]. NLRP3 inflammasome can be activated by various exogenous or endogenous stress factors such as infection, reactive oxygen species ROS, damage and metabolites, and adenosine triphosphate ATP^[17–20]. The above results suggest that NLRP3 inflammasome may play an essential role in the pathogenesis of cardiac hypertrophy, but whether and how NLRP3 inflammasome participates in the molecular mechanism of cardiac hypertrophy is unclear. It has been reported in the literature that autophagy is closely related to inflammasomes. On the one hand, inflammasomes can induce autophagy; on the other hand, autophagy can also regulate inflammasomes^[21–24].

Many studies have shown that autophagy can negatively or positively regulate the activation of NLRP3 inflammasome. At the same time, the NLRP3 inflammasome also reverses the effect of autophagy^{[25, 26]}. For example, a study found that the acetylation of Atg5 can inhibit the maturation of autophagosomes^[27], and SIRT3 can form a complex with Atg5 in cells to inhibit the acetylation of endogenous Atg5, thereby promoting the maturation of autophagosomes. However, the NLRP3 inflammasome was much more abundant in SIRT3-deficient cells than in normal cells. Therefore, there is a certain negative regulatory relationship between autophagy and NLRP3 inflammasome. Similarly, Chang et al.^[28] resveratrol (RSV), a polyphenolic compound naturally produced in plants, can induce autophagy by activating the p38 gene, inhibit the activation of NLRP3 inflammasome in macrophages, and alleviate the body's inflammatory response. Zhou et al.^[29] found that berberine can inhibit the activation of NLRP3 inflammasome by up-regulating the autophagy level of macrophages to inhibit the inflammatory response. Reducing the level of Beclin-1 in cells, or adding an autophagy inhibitor, could reverse the inhibition of berberine on NLRP3 inflammasome. However, Dupont et al.^[30] found that autophagy can also positively regulate the activation of NLRP3 inflammasomes. In this study, autophagy under starvation conditions can enhance the activation of caspase 1 through an Atg5-dependent non-canonical pathway, promote the activation of inflammasomes, and increase IL-1β, IL-18 Synthesis of pro-inflammatory cytokines. At the same time, because some cytoplasmic proteins lack signal peptides, pro-inflammatory factors such as IL-1β and IL-18 are degraded, which instead promotes their excretion in the cytoplasm, further aggravating the inflammatory damage of tissue.

In summary, autophagy has a dual role in regulating inflammatory response, which depends on a certain cellular environment. Cellular autophagy can regulate inflammatory response^[31], and autophagy can also be induced by cytokines^{[32, 33]}. The specific mechanism remains to be further researched. The role of miR-26a-5p on cardiac hypertrophy has been elucidated in many studies^{[15, 34–36]}, and its mechanism may be related to the regulation of autophagy. Therefore, we constructed cell and animal cardiac hypertrophy models to explore whether miR-26a-5p could regulate autophagy, activate inflammasomes and lead to the aggravation of pathological cardiac hypertrophy.

In our research, we observed that the expression of miR-26a-5p is associated with cardiomyocyte hypertrophy and rat heart structure, and miR-26a-5p can overactive autophagy leading to the activation of NLRP3 inflammasome to increase cardiac hypertrophy. Our research results have deepened the understanding of the NLRP3 inflammasome signalling pathway on the pathological mechanism of cardiac hypertrophy; secondly, miR-26a-5p regulates excessive autophagy and activates NLRP3 inflammasome to mediate cardiomyocyte hypertrophy, which provided new ideas for early diagnosis and drug development of cardiac hypertrophy.

However, our research still needs to improve, and the specific mechanism of miR-26a-5p regulating the NLRP3 signalling pathway still needs further discussion. Whether targeting the NLRP3 inflammasome pathway will benefit the treatment of myocardial hypertrophy is unknown, and whether miR-26a-5p can regulate the NLRP3 pathway to prevent myocardial hypertrophy needs more research to verify. But in general, research on the regulatory relationship between autophagy and inflammasome may provide new ideas for the treatment and prognosis of cardiac hypertrophy.

Our research observed the expression of miR-26a-5p is related to cardiomyocyte hypertrophy, and its mechanism may be associated with the activation of the NLRP3 inflammasome pathway caused by miR-26a-5p's excessive promotion of autophagy. Therefore, targeting the expression of miR-26a-5p, inhibiting the activation of autophagy and NLRP3 inflammasome pathway, may bring more options for treating pathological cardiac hypertrophy.

Ethics approval and consent to participate：

Study approval statement:This study protocol was reviewed and approved by [Experimental Animal Welfare and Ethics Committee of Zhejiang Academy of Agricultural Sciences], approval number [2021ZAASLA46]. All methods were carried out in accordance with relevant guidelines and regulations, and all methods were reported in accordance with ARRIVE guidelines for the reporting of animal experiments.

Consent for publication：

Not applicable.

Availability of data and materials:

The datasets supporting the conclusions of this article are included within the article (and its additional files).

Competing interests :

All authors have no conflict of interest.

Funding:

1.This research was supported by the Jiont Funds of the Zhejiang Provincial Natural

Science Foundation of China Under Grant No.BY21H250002.

2.Zhejiang Medical and Health Research Fund:2021KY057

3.Zhejiang Medical and Health Research Fund:2022488544

Acknowledgements:

Thanks for the support of the Jiont Funds of the Zhejiang Provincial Natural

Science Foundation and Zhejiang Medical and Health Research Fund.

Author Contributions:

Li-qun Tang conceived and designed the study. Wei Wang, Qi-feng Tang, conducted most of the experiments and data analysis, and wrote the manuscript. Ling-ling Wang participated in collecting data and helped to draft the manuscript. All authors reviewed and approved the manuscript.

SHIMIZU I. Physiological and pathological cardiac hypertrophy [J]. J Mol Cell Cardiol. 2016;97:245–62.
ADZIKA G K, MACHUKI J O, SHANG W, et al. Pathological cardiac hypertrophy: the synergy of adenylyl cyclases inhibition in cardiac and immune cells during chronic catecholamine stress [J]. J Mol Med (Berl). 2019;97(7):897–907.
YOTTI R, SEIDMAN C E, SEIDMAN JG. Advances in the Genetic Basis and Pathogenesis of Sarcomere Cardiomyopathies [J]. Annu Rev Genomics Hum Genet. 2019;20:129–53.
NAKAMURA M, SADOSHIMA J. Mechanisms of physiological and pathological cardiac hypertrophy [J]. Nat Rev Cardiol. 2018;15(7):387–407.
CHACAR S, HAJAL J, SALIBA Y, et al. Long-term intake of phenolic compounds attenuates age-related cardiac remodeling [J]. Aging Cell. 2019;18(2):e12894.
STEWART RM, RODRIGUEZ E C, KING MC. Ablation of SUN2-containing LINC complexes drives cardiac hypertrophy without interstitial fibrosis [J]. Mol Biol Cell. 2019;30(14):1664–75.
HO M Y, WANG C Y. Role of Irisin in Myocardial Infarction, Heart Failure, and Cardiac Hypertrophy [J]. Cells, 2021, 10(8).
LI PL, LIU H, CHEN G P, et al. STEAP3 (Six-Transmembrane Epithelial Antigen of Prostate 3) Inhibits Pathological Cardiac Hypertrophy [J]. Hypertension. 2020;76(4):1219–30.
SHI S, JIANG P. Therapeutic potentials of modulating autophagy in pathological cardiac hypertrophy [J]. Biomed Pharmacother. 2022;156:113967.
ZHAO D, ZHONG G, LI J, et al. Targeting E3 Ubiquitin Ligase WWP1 Prevents Cardiac Hypertrophy Through Destabilizing DVL2 via Inhibition of K27-Linked Ubiquitination [J]. Circulation. 2021;144(9):694–711.
QIU Z, HE Y, MING H et al. Lipopolysaccharide (LPS) Aggravates High Glucose- and Hypoxia/Reoxygenation-Induced Injury through Activating ROS-Dependent NLRP3 Inflammasome-Mediated Pyroptosis in H9C2 Cardiomyocytes [J]. J Diabetes Res, 2019, 2019: 8151836.
BAI Y, SUN X. CHU Q, Caspase-1 regulate AngII-induced cardiomyocyte hypertrophy via upregulation of IL-1β [J]. Biosci Rep, 2018, 38(2).
SUN M, CHEN M, DAWOOD F, et al. Tumor necrosis factor-alpha mediates cardiac remodeling and ventricular dysfunction after pressure overload state [J]. Circulation. 2007;115(11):1398–407.
ZHEN Y, ZHANG H. NLRP3 Inflammasome and Inflammatory Bowel Disease [J]. Front Immunol. 2019;10:276.
TANG L, XIE J, YU X, et al. MiR-26a-5p inhibits GSK3β expression and promotes cardiac hypertrophy in vitro [J]. PeerJ. 2020;8:e10371.
XIE Q, SHEN W W, ZHONG J, et al. Lipopolysaccharide/adenosine triphosphate induces IL–1β and IL-18 secretion through the NLRP3 inflammasome in RAW264.7 murine macrophage cells [J]. Int J Mol Med. 2014;34(1):341–9.
TARTEY S, KANNEGANTI TD. Differential role of the NLRP3 inflammasome in infection and tumorigenesis [J]. Immunology. 2019;156(4):329–38.
MINUTOLI L, PUZZOLO D, RINALDI M et al. ROS-Mediated NLRP3 Inflammasome Activation in Brain, Heart, Kidney, and Testis Ischemia/Reperfusion Injury [J]. Oxid Med Cell Longev, 2016, 2016: 2183026.
ZHANG Y Z, SUI X L, XU Y P, et al. NLRP3 inflammasome and lipid metabolism analysis based on UPLC-Q-TOF-MS in gouty nephropathy [J]. Int J Mol Med. 2019;44(1):172–84.
COLL RC, HILL J R, DAY C J, et al. MCC950 directly targets the NLRP3 ATP-hydrolysis motif for inflammasome inhibition [J]. Nat Chem Biol. 2019;15(6):556–9.
DERETIC V, SAITOH T. Autophagy in infection, inflammation and immunity [J]. Nat Rev Immunol. 2013;13(10):722–37.
HAN X, SUN S, SUN Y, et al. Small molecule-driven NLRP3 inflammation inhibition via interplay between ubiquitination and autophagy: implications for Parkinson disease [J]. Autophagy. 2019;15(11):1860–81.
HARRIS J, LANG T, THOMAS J P W, et al. Autophagy and inflammasomes [J]. Mol Immunol. 2017;86:10–5.
TAO Y, WANG N, QIU T et al. The Role of Autophagy and NLRP3 Inflammasome in Liver Fibrosis [J]. Biomed Res Int, 2020, 2020: 7269150.
BIASIZZO M, KOPITAR-JERALA N. Interplay Between NLRP3 Inflammasome and Autophagy [J]. Front Immunol. 2020;11:591803.
QIAO L, MA J, ZHANG Z, et al. Deficient Chaperone-Mediated Autophagy Promotes Inflammation and Atherosclerosis [J]. Circ Res. 2021;129(12):1141–57.
LIU P, HUANG G, WEI T, et al. Sirtuin 3-induced macrophage autophagy in regulating NLRP3 inflammasome activation [J]. Biochim Biophys Acta Mol Basis Dis. 2018;1864(3):764–77.
CHANG Y P, KA S M, HSU W H, et al. Resveratrol inhibits NLRP3 inflammasome activation by preserving mitochondrial integrity and augmenting autophagy [J]. J Cell Physiol. 2015;230(7):1567–79.
ZHOU H, FENG L, XU F, et al. Berberine inhibits palmitate-induced NLRP3 inflammasome activation by triggering autophagy in macrophages: A new mechanism linking berberine to insulin resistance improvement [J]. Biomed Pharmacother. 2017;89:864–74.
DUPONT N, JIANG S, PILLI M, et al. Autophagy-based unconventional secretory pathway for extracellular delivery of IL-1β [J]. Embo j. 2011;30(23):4701–11.
WU M Y, LU JH. Autophagy and Macrophage Functions: Inflammatory Response and Phagocytosis [J]. Cells, 2019, 9(1).
HU F, SONG D, YAN Y, et al. IL-6 regulates autophagy and chemotherapy resistance by promoting BECN1 phosphorylation [J]. Nat Commun. 2021;12(1):3651.
JIANG GM, TAN Y, WANG H, et al. The relationship between autophagy and the immune system and its applications for tumor immunotherapy [J]. Mol Cancer. 2019;18(1):17.
CHENG X, XING JIAND. Circulating cardiac MicroRNAs safeguard against dilated cardiomyopathy [J]. Clin Transl Med. 2023;13(5):e1258.
PFEIFER P, ZIETZER A, HöLSCHER M, et al. Transverse aortic constriction-induced heart failure leads to increased levels of circulating microparticles [J]. Int J Cardiol. 2022;347:54–8.
SHI H, LI H, ZHANG F, et al. MiR-26a-5p alleviates cardiac hypertrophy and dysfunction via targeting ADAM17 [J]. Cell Biol Int. 2021;45(11):2357–67.

No competing interests reported.

Download PDF

Journal Publication

published 03 Jan, 2024

Read the published version in BMC Cardiovascular Disorders →

Editorial decision: Major revision
25 Oct, 2023
Reviews received at journal
12 Sep, 2023
Reviewers agreed at journal
04 Sep, 2023
Reviewers invited by journal
04 Sep, 2023
Editor assigned by journal
04 Sep, 2023
Editor invited by journal
22 Aug, 2023
Submission checks completed at journal
22 Aug, 2023
First submitted to journal
25 Jun, 2023

You are reading this latest preprint version

The molecular mechanism of MiR-26a-5p regulates excessive autophagy and activates NLRP3 inflammasome to mediate cardiomyocyte hypertrophy

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and Methods

Cell culture and treatments

RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR)

Western blotting analysis

Immunofluorescence and confocal microscopic assay

Construction of lentiviral vector for SLC26A4 interference and overexpression

Animals and treatments

Immunohistochemical analysis

Statistical analysis

Results

miR-26a-5p and pyroptosis-associated proteins were up-regulated in PE-induced cardiac hypertrophy

miR-26a-5p overactivated autophagy leading to NLRP3 inflammasome activation in a PE-induced cardiomyocyte hypertrophy model

Expression of miR-26a-5p was associated with PE-induced changes in the cardiomyocyte area

Expression of miR-26a-5p leaded to cardiac structural changes in TAC model rats

miR-26a-5p was associated with NLRP3 inflammasome activation in TAC model rats

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1