FimH of uropathogenic Escherichia coli influenced the infection in prostate cells by the modulation of JAK/STAT signaling pathway

doi:10.21203/rs.3.rs-3113496/v1

Download PDF

Research Article

FimH of uropathogenic Escherichia coli influenced the infection in prostate cells by the modulation of JAK/STAT signaling pathway

https://doi.org/10.21203/rs.3.rs-3113496/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: The FimH expression may be a key factor affecting prostatitis caused by UPEC infection. Whether its regulation by the JAK/STAT pathway increases resistance to inflammation caused by infection with high FimH-expressing UPEC strains requires investigation.

Methods: The effect of FimH on the ability of knockout ΔFimH UPEC, FimH^over-expressed UPEC, and wild-type strains to invade prostate cells and induce inflammation and the effects of different FimH levels on testosterone-treated UPEC and regulation of the JAK/STAT pathway were analyzed.

Results: Comparison of the three strains revealed the inhibitory effects of testosterone were more significant in the ΔFimH strain. Testosterone-pretreated ΔFimH UPEC showed weak inflammatory responses and JAK/STAT expression. FimH^overUPEC better resisted the inhibitory effects of testosterone, which there was no significantly decreases except 20 μg/ml pretreated group in most JAK/STAT-related proteins. The effects of FimH showed a concentration-dependent response to testosterone, particularly to JAK1, STAT3, and pSTAT3, which also affected the subsequent expression of TLR4, IL-6, and IFN-γ. It has been suggested that regulation of the JAK1/STAT3 pathway may be associated with the effects of the FimH virulence factor on the inhibition of testosterone in UPEC infection.

Conclusion: The inhibitory effect of testosterone on UPEC infection in prostate epithelial cells was affected by the virulence factor FimH of UPEC, and reduced the production of inflammatory factors. The JAK/STAT pathway plays a key role in regulating UPEC infection and influences testosterone suppression responses in prostate cells. Our study provides a possible guideline for using testosterone to treat clinical recurrent UPEC infection and persistent prostatitis.

FimH

JAK/STAT pathway

prostatitis

testosterone

UPEC

Pathogenic Escherichia coli (UPEC) expresses a variety of adhesins that specifically attach to the sugar receptors of urothelial cells. [1] The adhesion of UPEC to invade and subsequently proliferate in host urothelial cells is critical to its pathogenicity in the urinary system. [2] The diversity of adhesins and cell surface receptors in different parts of the urinary tract causes different clinical UPEC infections. For example, P-fused UPEC causes pyelonephritis by binding to galactose-containing receptors in the kidney epithelium, whereas mannose-containing bacteria cause cystitis through the directional adhesion of type 1 pili to the surface of the bladder. [3] The filaments of UPEC flagella can firmly adhere to the urothelium to invade urinary tract cells. [4] E. coli strains with P-fimbriae cause more urinary tract infections and are more likely to cause bacteremia and pyelonephritis. [5]

FimH is a specific adhesin located at the tips of UPEC type 1 pili, and is an important UPEC virulence factor. UPEC uses FimH to bind to the urothelium by interacting with mannosylated urea receptors. [6] Studies have shown that ΔFimH E. coli have a decreased ability to adhere to and invade intestinal epithelial cells compared to wild-type strains. Similarly, ΔFimH strains have a decreased capacity to translocate to other organs such as the kidney, spleen, and lung. [7] FimH of type 1 pili can directly bind to Toll-Like Receptor 4 (TLR4) to initiate the innate immune response. In the case of natural infection, FimH is a strong inducer of the innate antibacterial immune response, and is confirmed to be associated with the generation of type 1 IFN and the pathways of TLR4, MyD88, and IRF-3 transduction. [8, 9] FimH adhesion enables UPEC to invade bladder epithelial cells via TLR-4-dependent endocytosis and escape to the cytoplasm through a TRPML3-dependent mechanism, forming a biofilm-like intracellular bacterial community (IBC). [10] Cystitis infection experiments in mice showed that ΔFimH UPEC had significantly weaker infection ability compared to wild-type strains. [6, 11] Although UPEC strains with stronger FimH may have higher infectivity and toxicity to prostate cells, it remains unknown whether this affects regulation by TLR-4 or the downstream Janus kinase (JAK)/signal transducer and activator of transcription (STATs) pathway in host inflammation.

Testosterone and dihydrotestosterone bind to androgen receptors located in the brain, skin, muscle, kidney, liver, and bone. [12] In males, aging leads to lower testosterone concentrations, which is associated with metabolic syndrome, type 2 diabetes mellitus, carotid intima-media thickness, and aortic and lower extremity arterial disease. [13–15] In previous studies, we treated UPEC-infected or LPS-induced prostate cells PZ-HPV-7 with testosterone, and found that its anti-inflammatory effect was downregulated by JAK/STAT1 signaling pathways. [16] We also demonstrated that testosterone effectively inhibits UPEC infection and the size of IBCs in prostate cells by suppressing STAT3 expression, especially in the more virulent strain. [17] However, whether bacterial adhesins (such as FimH) in more virulent strains affect inhibition of UPEC-infected prostate cells by testosterone and the actual mechanism of action are rarely discussed.

The coordinated activation of inflammatory factors by IFN-γ and TLR-4 signaling is essential for the pathogenesis of the innate immune inflammatory response. [18] STATs are important mediators of biological responses to TLR-4 and are crucial for their regulatory mechanism contributing to inflammatory diseases. [19] One study showed that the expression levels of IFN-γ, TNF-α, and IL-1β are increased in the semen of patients with CP/CPPS. [20] Our previous study also confirmed that inhibiting the JAK and STAT1 signaling pathway can attenuate LPS-induced inflammation in prostate cells. [21] SOCS proteins play an important role in modulating inflammation by directly interacting with the JAK family and inhibiting their catalytic activity, or by acting on cellular receptors with phosphorylated tyrosine residues in the cytoplasm. [22, 23] In particular, SOCS1 and SOCS3 play an important role in regulating inflammation reactions. [24, 25] The transcription factor STAT3 is essential for the functioning of immune system several mediators, such as IL-6, IL-10, and IL-22. [26] IL-6 induces a large amount of SOCS3 protein, which can act as a negative regulator of IL-6 activation of STAT3. [27] Our previous research showed that the cooperative interaction of TLR-4 and the JAK/STAT1 signaling pathway is responsible for increased UPEC infection in urothelial cells in a high glucose environment. [28] Furthermore, IFN-γ-related signaling pathways, such as STAT-1, play an important role in the anti-prostatitis response in mice with experimental autoimmune prostatitis. [29] Therefore, understanding how UPEC binds to and subsequently regulates signal transduction, particularly the role played by FimH adhesin in UPEC infection, is key to reducing bacterial prostate infection.

The strength of FimH expression may be a key factor affecting cystitis caused by UPEC infection. Regulation of the JAK/STAT pathway to increase resistance to inflammation caused by infection with UPEC strains highly expressing FimH requires investigation. This study evaluated the influence of UPEC FimH on inflammation in prostate cells by comparing knockout ΔFimH UPEC, FimH^over-expressed UPEC, and wild-type strains. Additionally, the effect of different levels of FimH on testosterone-treated UPEC and regulation of the JAK/STAT signaling pathway were analyzed. This study can provide guidelines for the treatment and prevention of bacterial prostatitis.

Bacterial strain

As a model, we used the UPEC strain CFT073 from the American Type Culture Collection (ATCC 700928) [30]. Bacterial strains were cultured in Luria Bertani (LB) broth supplemented with ampicillin (100 µg/mL) and incubated at 37°C for overnight. Bacterial growth was spectrophotometrically determined at an optical density of 600 nm (OD₆₀₀). For in vitro infections, bacteria were suspended in culture medium at a multiplicity of infection (MOI) of 1:10.

ΔFimH CFT-073 and FimH^over CFT- 073 UPEC strains construction

We constructed a fimH-deficiency mutant in E. coli CFT073, named ΔFimH CFT-073, using the lambda Red recombinase system [PMID: 10829079]. Two oligonucleotide primers (fimH_H1_FRT20: 5’-AGGGAACCATTCAGGCAGTGATTAGCATCACCTATACCTACA GCTGAACCCAAAGAGATGATTCCGGGGATCCGTCGACC-3’ and fimH_H2_FRT19: 5’-CAG GTTTTAGCTTCAGGTAATATTGCGTACCTGCATTAGCAATGCCCTGTGATTTCTTTATGTAGGCTGGAGCTGCTTC-3’) were designed for generating a fimH replacement cassette, which contained an apramycin resistance gene flanking with homologous sequences of fimH. Primer sequences in the first 60 base pair are homolog to either the upstream sequences from the start codon of fimH or the downstream from the stop codon. The 3’ end of primer sequences with underline indicate regions annealed to a template plasmid with apramycin resistance pIJ773 [PMID: 12563033]. After PCR amplification and purification, a fimH replacement cassette was electroporated into E. coli CFT073 harboring an expression plasmid, pKD46, which had been expressed lambda Red recombinase after arabinose induction. Transformants grown in LB agar containing apramycin were tested by PCR for replacement of fimH by apramycin resistance gene. Amplicon sizes of the parental strain and ΔFimH CFT-073 were 4.3Kb and 2.9Kb, respectively. To overexpress fimH in E. coli CFT073, a fimH expression plasmid under IPTG induction, named pQE31, was constructed. Plasmid pQE31-FimH was transformed into E. coli CFT073 and transformants were selectively grown on ampicillin-containing plate. Plasmids from the transformants were analyzed using restriction enzyme digestion. We applied Western blot against anti-FimH antibody to confirm high FimH production while the transformants were cultured in the presence of IPTG.

Prostate cell culture, testosterone pretreatment, and UPEC infection

The human normal prostate cell line RWPE-1 was cultured in Keratinocyte-serum free medium (GIBCO-BRL #17005-042) containing 5 ng/ml human recombinant epidermal growth factor and 50 ng/ml bovine pituitary extract at 37°C in a 5% CO2 incubator. The culture medium was replaced every 2–3 days. The cells were then treated with testosterone (MyBioSource, San Diego, CA, USA) at different concentrations (5, 10, and 20 µg/mL) for 24 h and infected with pGFP-UPEC at MOI 1:10 for 4 h. Untreated cells were used as the normal control group, and cells infected with pGFP-UPEC only were used as the positive control group. The other group of cells undergoing the same treatment were mixed with radioimmunoprecipitation assay (RIPA) buffer, and the cell protein was collected for subsequent protein expression determination.

UPEC infection and quantification by colony-forming unit (CFU) counting

After a 4 h UPEC incubation period, the infected monolayers were washed four times with phosphate-buffered saline (PBS) and incubated for 30 min in a growth medium containing gentamicin (100 µg/mL; Sigma-Aldrich, St. Louis, MO, USA). To measure bacterial invasion, the cells were lysed and harvested using 0.5% trypsin (Gibco) and 0.1% Triton X-100 (Amresco, Solon, OH, USA), and then plated onto nutrient broth (NB) medium containing ampicillin. The total CFUs were counted after 24 h of incubation to quantify bound bacteria.

Cell protein extraction

The treated cells were centrifuged at 500xg for 5 min at 4°C, and the supernatant was poured out and the cell pellet was placed in a protein lysis buffer (Pierce, Rockford, IL). The pellet was homogenized with a micro grinder and evenly mixed to collect the expressed proteins. After all the samples were collected, they were thawed on ice and centrifuged at 12,000 rpm at 4°C for 10 min. The supernatant was collected to obtain total protein. The samples were stored in a refrigerator at − 80°C for later use.

Western blot analysis

The proteins in the samples were harvested using RIPA lysis buffer (Millipore). The experimental procedure was conducted as per our previous publication [29]. The antibodies used were as follows: anti-JAK1 (BD Biosciences), anti-JAK2, anti-STAT1 (Cell Signaling, Beverly, MA); anti-pSTAT1, anti-STAT3 (Cell Signaling, Beverly, MA), anti-pSTAT3, anti-suppressor of cytokine signaling 3 (SOCS3, Abcam), anti-interferon (IFN)-γ (Abcam), anti-TLR-4 (Proteintech), anti-interleukin (IL)-6 (Bioworld Technology), and anti-β-actin (Santa Cruz) at room temperature (~ 25°C) for 1 h. After incubation with an appropriate secondary horseradish peroxidase-conjugated IgG antibody (R&D Systems) for 30 min at room temperature, the protein bands on the membrane were detected using an ECL-Plus Western Blot Detection system (GE Healthcare UK Ltd.) according to the manufacturer’s instructions. All experiments were performed at least thrice. Graphical analysis of band density was performed using ImageJ software (version 1.41o) (National Institutes of Health, Bethesda, MD, USA) (http://rsb.info.nih.gov/ij/).

Cytometric bead array (CBA) immunoassay

The cell culture medium was centrifuged (13,000 ×g, 20 min, 4°C), and the supernatant was assessed using a human inflammatory cytokine CBA (BD Biosciences, San Diego, USA) for the cytokines IL-8, IL-10, IL-1β, and IL-6. The cytokine capture bead, PE detection reagent, and recombinant standards or test samples were incubated for 3 h at room temperature. FACSCanto flow cytometer (BD Biosciences, San Diego, USA) was used to acquire the data, which were analyzed using the BD CBA analysis software to produce graphs [31, 32].

Statistical analysis

Data are expressed as mean ± standard deviation (SD). Analysis of variance was used to evaluate differences between various treatment groups and controls. Statistical differences between groups were determined using the Student’s t-test. Statistical significance was set at p < 0.05.

UPEC CFT073 FimH overexpression and knockout ΔFimH strains

CFT073 FimH overexpression and knockout ΔFimH strains were produced by electroporation and gene transformation, respectively (Fig. 1A). Following antibiotic selection and PCR processing, the DNA of each strain was extracted and the FimH content of each strain was estimated by DNA colloid electrophoresis. Figure 1B shows that ΔFimH had the lowest FimH DNA fragment content of the three strains, while the FimH overexpression strain had significantly higher FimH DNA fragment content than the wild type (Fig. 1C). The concentration of the bacterial tubes shows that the strains established after electroporation are resistant to antibiotics, which is convenient for the culture of subsequent strains (Fig. 1D).

FimH levels of UPEC and testosterone inhibition in infected RWPE-1 cells

RWPE-1 cells were pretreated with different doses of testosterone (5, 10, and 20 µg/mL) for 24 h then infected with different UPEC strains (ΔFimH, wild-type, and FimH^over CFT-073). The lysed cells were cultured on LB medium to count the intracellular bacteria. Figure 2 shows the effect of 5 µg/mL testosterone pretreatment on ΔFimH CFT-073 and wild-type strains was not significant; however, after increasing the doses to 10 and 20 µg/mL (p < 0.01 and 0.0001 in ΔFimH strain; p < 0.05 and 0.001 in wild-type strain), colony formation was inhibited by testosterone in a dose-dependent manner, and the inhibitory effect on ΔFimH strain was more noticeable. A large number of colonies were formed in the FimH^over group even after testosterone pretreatment, but colony reduction occurred with the highest dose (20 µg/mL) (p < 0.01). The FimH^over strain only showed a slight reduction compared to other strains at the same doses, except the 20 µg/ml group showed a similar reduction to the wild-type strain. This suggests that UPEC FimH is associated with UPEC resistance to testosterone treatment in UPEC-infected prostate cells.

Inflammatory cytokines in RWPE-1 cells infected with UPEC with different FimH levels after testosterone pretreatment

Following infection of RWPE-1 cells with UPEC with different FimH levels, we detected the cytokines in supernatants (Fig. 3) and found that the secretion of IL-6 and IL-8 increased significantly with increasing testosterone concentration in the ΔFimH and FimH^over infection groups (p < 0.05). The wild type strain only exhibited cytokine secretion at the 20 µg/ml dose, but cytokine levels remained significantly lower than those in the other groups (p < 0.001). The ΔFimH group exhibited the most significant IL-8 secretion, even higher than that of the FimH^over infection group (p < 0.05); it increased rapidly at a testosterone dose of 5 µg/ml, peaked at 10 µg/ml, and then slightly decreased at 20 µg/ml. No significant difference in IL-10 secretion was observed among the testosterone concentrations. Additionally, IL-10 was largely absent in the ΔFimH group, but slightly decreased in the FimH^over group at testosterone doses of 10 and 20 µg/ml. The secretion of IL-1β was not significantly different, suggesting that it may not be relevant.

Inhibition of protein expression of JAK/STAT pathway-related factors in RWPE-1 cells infected with UPEC with different FimH levels after testosterone pretreatment

RWPE-1 cells were pretreated with different doses of testosterone (5, 10, and 20 µg/mL) for 24 h, and then infected with different strains of UPEC (ΔFimH, wild-type, and FimH^over CFT-073). Total protein from all groups was collected and detected by western blotting. Figure 4 shows that the expression levels of JAK1, STAT3, TLR-4, inflammatory IL-6, and IFN-γ in the FimH^over groups were significantly higher than those in the wild-type groups, especially in the ΔFimH groups (p < 0.05). The effects of testosterone-induced inhibition were weak in the FimH^over groups with increasing doses. However, in the ΔFimH group, the effect of testosterone on JAK/STAT-related proteins was more significant than that on inflammation-related factors (IL-6, TLR-4, and IFN-γ). Additionally, the expression levels of STAT1, phosphorylated STAT1, and STAT3 only differed between the FimH^over and ΔFimH groups in the 10 and 20 µg/mL testosterone pretreated groups (p < 0.05).

As shown in Fig. 4B, the protein expression of the STAT antagonist SOCS3 showed the opposite trend to that of JAK and STAT expression after testosterone pretreatment of UPEC-infected cells. The SOCS3 expression in the FimH^over group was lower than that in the other two groups (p < 0.05). Moreover, the effect of testosterone dose on JAK2 was not significant, and the difference between UPEC strains with different FimH levels was insignificant. The results suggested that the JAK/STAT pathway and inflammatory factors in UPEC-induced prostatitis reduced by testosterone pretreatment were indeed associated with FimH expression.

JAK/STAT inhibitors influenced the effects of testosterone on RWPE-1 cells infected with UPEC with different FimH levels

RWPE-1 cells were pretreated with testosterone (20 µg/mL) for 24 h, and JAK (25 µM) or STAT inhibitors (50 µM) were added for another 24 h. After infection with different UPEC strains (ΔFimH CFT-073, wild-type and FimH^over CFT-073) (MOI = 1:10), the cells were lysed and cultured on LB medium to count intracellular bacteria and demonstrate the modulation of JAK/STAT pathway. As shown in Fig. 5, the inhibitory effects of testosterone on UPEC infection in RWPE-1 cells were significantly blocked by JAK inhibitors, especially in the ΔFimH UPEC group (p < 0.01). Additionally, colony formation in the FimH^over group was higher than that in the ΔFimH group under testosterone pretreatment with or without STAT inhibitor co-culture and was also higher than that in the wild-type group under testosterone and JAK inhibitor pretreatment (p < 0.05). Notably, the colony numbers of STAT inhibitor-treated group were higher than the testosterone and STAT inhibitor co-cultured group only in the wild-type strain (p < 0.05).

JAK/STAT inhibitors interfered with the protein expression of JAK/STAT pathway-related factors in RWPE-1 cells infected with UPEC with different FimH levels under testosterone pretreatment

RWPE-1 cells were pretreated with testosterone (20 µg/mL) for 24 h, and JAK (25 µM) or STAT inhibitors (50 µM) were added for another 24 h. Subsequently, following infection with different UPEC strains (ΔFimH, Wild type and FimH^over CFT- 073) infection (MOI = 1:10), the total proteins of all cell groups were collected for detection of the expression of the JAK/STAT pathway.

Figure 6 shows that the inhibitory effect of testosterone on the expression of JAK1, STAT3, and TLR-4 proteins was significantly higher in both the FimH^over and wild-type infection groups compared to the ΔFimH group, regardless of treatment with or without inhibitors (p < 0.05). However, STAT1, phosphorylated STAT1, and SOCS3 appeared not to be affected by UPEC FimH, which did not differ among the three groups. The expression of JAK2 and IFN-γ was significantly lower in the ΔFimH group than in the FimH^over group when co-treated with testosterone and JAK/STAT inhibitors, but not when treated with the inhibitor alone. The difference in IL-6 appeared only with STAT inhibitor treatment (p < 0.05). The data suggest that the effect of FimH on testosterone suppression in UPEC prostatitis may be mainly related to regulation of the JAK1/STAT3 pathway and TLR-4.

Our previous studies confirmed that UPEC infection affects the JAK/STAT signaling pathway in human urothelial cells and induces the expression of mediators involved in the inhibition of host cytokines. [29] The activation of adenosine A receptors inhibits STAT3 phosphorylation, thereby affecting the IL-8 response of UPEC-infected human urothelial cells. [33] We confirmed that testosterone inhibited the pathogenicity of UPEC in prostate cells, as well as induced inflammatory responses through the JAK/STAT1 pathway. [21] The structural composition of urothelial cells is affected in the UPEC-infected host, making it prone to chronic or recurrent infection, depending on differences in the virulence of different strains. [34] We previously revealed that prostate cells pretreated with testosterone showed a dose-dependent reduction in the number of UPEC colonizations and inhibited the size of the formed IBC, especially in the highly virulent strains. [17] However, the role of STAT proteins in the adhesion of UPEC FimH to host cells and regulation of host inflammatory responses during UTIs is not yet fully understood. Here, we demonstrated that testosterone can effectively inhibit UPEC infection in prostate cells through the JAK/STAT pathway, and the regulation of the JAK/STAT pathway and UPEC infection is related to the virulence of UPEC, especially FimH, which has a decisive influence.

Previous studies have shown that testosterone can prevent UPEC from forming a biofilm-like community in the urinary tract to reduce the incidence of renal abscess and prevent its progression, which has been observed in both female and male mice. [35] Comparison of the three strains (ΔFimH CFT-073, wild-type, and FimH^over CFT-073) revealed that the inhibitory effects of testosterone were more substantial in the ΔFimH strain, indicating that the effectiveness of testosterone in treating prostate infections may be affected by the virulence of UPEC FimH. Although testosterone can enhance prostate protection against UPEC infection, this treatment against intractable or persistently recurrent UTI still depends on differential FimH virulence. Further analysis of the effects of these three UPEC strains with different FimH expression on testosterone-induced secretion of inflammatory cytokines from prostate cells revealed that the ΔFimH UPEC resulted in the highest production of IL-6 and IL-8. The FimH^over UPEC showed similar results and the wild type showed the lowest. No IL-10 expression was observed in the ΔFimH group, in contrast to that in the wild-type and FimH^over strains. This suggests that the immunosuppression of IL-10 in prostate cells may be closely associated with the function of FimH in UPEC, such as bacterial attachment or invasion. H4, H1, and H7 flagella of E. coli are involved in motility, epithelial cell adhesion, and invasion; H4 flagella can enhance the induction of anti-inflammatory IL-10, a property that contributes to the adaptability of UPEC in UTI. [36]

Under testosterone pretreatment, the ΔFimH UPEC showed weak inflammatory responses and expression of the JAK/STAT pathway, whereas FimH^over UPEC was better at resisting the inhibitive effects of testosterone, with no significant decreases except in the 20 µg/ml pretreated group in most JAK/STAT-related proteins. This interfering effect of FimH showed a concentration-dependent effect of testosterone, especially on JAK1, STAT3, and pSTAT3, which also affected the subsequent expression of TLR4, IL-6, and IFN-γ. STAT3 acts synergistically with pro-inflammatory pathways during Helicobacter pylori infection to regulate bacterial immune tolerance to persistent infection, leading to subsequent inflammatory and carcinogenic outcomes. [19, 37] We found that prostate cells co-incubated with testosterone and JAK/STAT inhibitors had the greatest effect on ΔFimH UPEC, especially the JAK inhibitor, which significantly weakened the inhibitive effect. This shows that the presence or absence of FimH is important for testosterone to regulate the JAK/STAT pathway for inhibiting inflammation and infection. Moreover, inhibitor experiments revealed that the inhibitory effect of testosterone differed significantly among the three UPEC strains, especially on JAK1, STAT3, pSTAT3, and IL-6. It has been suggested that regulation of the JAK1/STAT3 pathway may be closely associated with the effects of the FimH virulence factor on the inhibition of testosterone in UPEC infection. Additionally, the STAT inhibitor SOCS3 revealed significantly reversed differences among the three strains. To limit the production of inflammatory cytokines in the bladder mucosa, UPEC in persistent UTI causes SOCS3 upregulation and thus suppresses JAK/STAT pathway-mediated pro-inflammatory factors in urothelial cells. [38, 39] Utilization of sugar alcohol metabolites and maintaining resistance to ROS are important for the establishment and progression of UPEC IBCs in bladder epithelial cells, [6, 40] whereas STAT inhibition using testosterone may help interfere with IBC growth and attenuate UPEC virulence to urinary tract cells. [17] Therefore, UTI caused by UPEC strains with strong FimH expression may be more difficult to treat using testosterone and other hormones, likely due to the poor anti-inflammatory effect and downregulation of the JAK/STAT pathway of testosterone against strains with strong FimH virulence.

Stærk et al. demonstrated in pig infection experiments that type 1 pili is a key virulence factor in urinary tract infection and is critical for UPEC to overcome the initial bottleneck of infection. [41] The FimH and FliC proteins of UPEC were involved in the release of IL-6 and IL-8 in the co-culture model of HTB-5 and HMC-1 cells and promoted the adhesion of UPEC to cells. [42] In a previous study, we demonstrated that treating RWPE-1 cells with testosterone significantly decreased UPEC infection via regulation of the JAK/STAT pathway in a dose-dependent manner. [21] Testosterone inhibits the infection of different virulence UPEC strains differently; the effect is stronger on more virulent UPEC, and the JAK/STAT pathway-mediated anti-inflammatory effect is also more substantial. [17]

This study confirmed that the inhibitory effect of testosterone on UPEC infection in prostate epithelial cells was affected by the virulence factor FimH of UPEC, which reduced the production of inflammatory factors. The JAK/STAT pathway also plays a key role in promoting UPEC infection and is involved in testosterone suppression responses in prostate cells. UPEC strains interfere with the regulation and inhibition of inflammation, especially those closely associated with the FimH virulence factor. All the suppressive effects were distinctly observed in UPEC with weak FimH expression but were less effective in strains with strong FimH expression. Aggregate-forming pili (AFP) and type I fimbriae (TIF) have synergistic effects on the adhesion and colonization of intestinal and urinary epithelial cells; therefore, mixed E. coli strains possessing AFP and TIF may infect both the intestinal and urinary tracts and are therefore more difficult to treat. [43] However, whether testosterone can be used as an anti-infective agent for defending UPEC to continuously infect prostate epithelial cells, especially against strains with strong virulence factors, such as FimH, remains to be further studied. In conclusion, our study indicates that testosterone can be used to treat clinical recurrent UPEC infection and persistent prostatitis. Future studies should explore the underlying molecular mechanism, including the regulation of the JAK/STAT pathway.

Ethical Approval

We hereby declare that our research has not involved the use of human and/or animal related materials.

Competing interests

The authors do not have a commercial or other association that might pose a conflict of interest.

Authors' contributions

CHH, SPL and PCC established the experimental concept and designed the experimental framework, also provided the funding; CHH, TWH and PCC mainly performed the experiments; CHH and PCC wrote the main manuscript text and prepared figures. CKF assisted in obtaining experimental materials; All authors reviewed the manuscript.

Funding

This study was supported by grant 2022SKHADR011 from Shin Kong Memorial Wu Ho-Su Hospital, Taipei, Taiwan; and in part by grants: MOST 109-2314-B-341-005 and MOST 110-2314-B-341-003 from the National Science and Technology Council, Taipei, Taiwan.

Availability of Data and Materials

Not applicable

Westerlund-Wikstrom B, Korhonen TK. Molecular structure of adhesin domains in Escherichia coli fimbriae. Int J Med Microbiol. 2005;295(6–7):479–86.
Kim WJ, Shea AE, Kim JH, Daaka Y. Uropathogenic Escherichia coli invades bladder epithelial cells by activating kinase networks in host cells. J Biol Chem. 2018;293(42):16518–27.
Terlizzi ME, Gribaudo G, Maffei ME. UroPathogenic Escherichia coli (UPEC) Infections: Virulence Factors, Bladder Responses, Antibiotic, and Non-antibiotic Antimicrobial Strategies. Front Microbiol. 2017;8:1566.
Andersen TE, Khandige S, Madelung M, Brewer J, Kolmos HJ, Moller-Jensen J. Escherichia coli uropathogenesis in vitro: invasion, cellular escape, and secondary infection analyzed in a human bladder cell infection model. Infect Immun. 2012;80(5):1858–67.
Plos K, Connell H, Jodal U, Marklund B-I, Mårild S, Wettergren B, Svanborg C. Intestinal Carriage Of P Fimbriated Escherichia Coli And The Susceptibility To Urinary Tract Infection In Young Children. J Infect Dis. 1995;171(3):625–31.
Wright KJ, Seed PC, Hultgren SJ. Development of intracellular bacterial communities of uropathogenic Escherichia coli depends on type 1 pili. Cell Microbiol. 2007;9(9):2230–41.
Poole NM, Green SI, Rajan A, Vela LE, Zeng XL, Estes MK, Maresso AW. Role for FimH in Extraintestinal Pathogenic Escherichia coli Invasion and Translocation through the Intestinal Epithelium. Infect Immun 2017, 85(11).
Ashkar AA, Mossman KL, Coombes BK, Gyles CL, Mackenzie R. FimH adhesin of type 1 fimbriae is a potent inducer of innate antimicrobial responses which requires TLR4 and type 1 interferon signalling. PLoS Pathog. 2008;4(12):e1000233.
Mossman KL, Mian MF, Lauzon NM, Gyles CL, Lichty B, Mackenzie R, Gill N, Ashkar AA. Cutting edge: FimH adhesin of type 1 fimbriae is a novel TLR4 ligand. J Immunol. 2008;181(10):6702–6.
Conover MS, Ruer S, Taganna J, Kalas V, De Greve H, Pinkner JS, Dodson KW, Remaut H, Hultgren SJ. Inflammation-Induced Adhesin-Receptor Interaction Provides a Fitness Advantage to Uropathogenic E. coli during Chronic Infection. Cell Host Microbe. 2016;20(4):482–92.
Bouckaert J, Mackenzie J, de Paz JL, Chipwaza B, Choudhury D, Zavialov A, Mannerstedt K, Anderson J, Pierard D, Wyns L, et al. The affinity of the FimH fimbrial adhesin is receptor-driven and quasi-independent of Escherichia coli pathotypes. Mol Microbiol. 2006;61(6):1556–68.
Zitzmann M, Nieschlag E. Testosterone levels in healthy men and the relation to behavioural and physical characteristics: facts and constructs. Eur J Endocrinol. 2001;144(3):183–97.
Muller M, Grobbee DE, den Tonkelaar I, Lamberts SW, van der Schouw YT. Endogenous sex hormones and metabolic syndrome in aging men. J Clin Endocrinol Metab. 2005;90(5):2618–23.
Laaksonen DE, Niskanen L, Punnonen K, Nyyssonen K, Tuomainen TP, Valkonen VP, Salonen R, Salonen JT. Testosterone and sex hormone-binding globulin predict the metabolic syndrome and diabetes in middle-aged men. Diabetes Care. 2004;27(5):1036–41.
Makinen J, Jarvisalo MJ, Pollanen P, Perheentupa A, Irjala K, Koskenvuo M, Makinen J, Huhtaniemi I, Raitakari OT. Increased carotid atherosclerosis in andropausal middle-aged men. J Am Coll Cardiol. 2005;45(10):1603–8.
Ho C-H, Fan C-K, Yu H-J, Wu C-C, Chen K-C, Liu S-P, Cheng P-CJPo. Testosterone suppresses uropathogenic Escherichia coli invasion and colonization within prostate cells and inhibits inflammatory responses through JAK/STAT-1 signaling pathway. 2017, 12(6):e0180244.
Ho CH, Lu YC, Fan CK, Yu HJ, Liu HT, Wu CC, Chen KC, Liu SP, Cheng PC. Testosterone regulates the intracellular bacterial community formation of uropathogenic Escherichia coli in prostate cells via STAT3. Int J Med Microbiol. 2020;310(7):151450.
Qiao Y, Giannopoulou EG, Chan CH, Park SH, Gong S, Chen J, Hu X, Elemento O, Ivashkiv LB. Synergistic activation of inflammatory cytokine genes by interferon-gamma-induced chromatin remodeling and toll-like receptor signaling. Immunity. 2013;39(3):454–69.
Wang YC, Chen CL, Sheu BS, Yang YJ, Tseng PC, Hsieh CY, Lin CF. Helicobacter pylori infection activates Src homology-2 domain-containing phosphatase 2 to suppress IFN-gamma signaling. J Immunol. 2014;193(8):4149–58.
Alexander RB, Ponniah S, Hasday J, Hebel JR. Elevated levels of proinflammatory cytokines in the semen of patients with chronic prostatitis/chronic pelvic pain syndrome. Urology. 1998;52(5):744–9.
Ho CH, Fan CK, Yu HJ, Wu CC, Chen KC, Liu SP, Cheng PC. Testosterone suppresses uropathogenic Escherichia coli invasion and colonization within prostate cells and inhibits inflammatory responses through JAK/STAT-1 signaling pathway. PLoS ONE. 2017;12(6):e0180244.
Alexander WS. Suppressors of cytokine signalling (SOCS) in the immune system. Nat Rev Immunol. 2002;2(6):410–6.
O'Shea JJ, Gadina M, Schreiber RD. Cytokine signaling in 2002: new surprises in the Jak/Stat pathway. Cell. 2002;109(Suppl):121–31.
Federici M, Giustizieri ML, Scarponi C, Girolomoni G, Albanesi C. Impaired IFN-gamma-dependent inflammatory responses in human keratinocytes overexpressing the suppressor of cytokine signaling 1. J Immunol. 2002;169(1):434–42.
Suzuki A, Hanada T, Mitsuyama K, Yoshida T, Kamizono S, Hoshino T, Kubo M, Yamashita A, Okabe M, Takeda K, et al. CIS3/SOCS3/SSI3 plays a negative regulatory role in STAT3 activation and intestinal inflammation. J Exp Med. 2001;193(4):471–81.
El Kasmi KC, Holst J, Coffre M, Mielke L, De Pauw A, Lhocine N, Smith AM, Rutschman R, Kaushal D. Shen YJTJoI: General nature of the STAT3-activated anti-inflammatory response. 2006, 177(11):7880–8.
Croker BA, Krebs DL, Zhang J-G, Wormald S, Willson TA, Stanley EG, Robb L, Greenhalgh CJ, Förster I. Clausen BEJNi: SOCS3 negatively regulates IL-6 signaling in vivo. 2003, 4(6):540.
Ho CH, Fan CK, Wu CC, Yu HJ, Liu HT, Chen KC, Liu SP, Cheng PC. Enhanced uropathogenic Escherichia coli-induced infection in uroepithelial cells by sugar through TLR-4 and JAK/STAT1 signaling pathways. J Microbiol Immunol Infect 2019.
Breser ML, Motrich RD, Sanchez LR, Mackern-Oberti JP, Rivero VE. Expression of CXCR3 on specific T cells is essential for homing to the prostate gland in an experimental model of chronic prostatitis/chronic pelvic pain syndrome. J Immunol. 2013;190(7):3121–33.
Saldana Z, De la Cruz MA, Carrillo-Casas EM, Duran L, Zhang Y, Hernandez-Castro R, Puente JL, Daaka Y, Giron JA. Production of the Escherichia coli common pilus by uropathogenic E. coli is associated with adherence to HeLa and HTB-4 cells and invasion of mouse bladder urothelium. PLoS ONE. 2014;9(7):e101200.
Baune BT, Ponath G, Golledge J, Varga G, Arolt V, Rothermundt M, Berger K. Association between IL-8 cytokine and cognitive performance in an elderly general population–the MEMO-Study. Neurobiol Aging. 2008;29(6):937–44.
Dhabhar FS, Viswanathan K. Short-term stress experienced at time of immunization induces a long-lasting increase in immunologic memory. Am J Physiol Regul Integr Comp Physiol. 2005;289(3):R738–744.
Save S, Persson K. Effects of adenosine A(2A) and A(2B) receptor activation on signaling pathways and cytokine production in human uroepithelial cells. Pharmacology. 2010;86(3):129–37.
Abraham SN, Miao Y. The nature of immune responses to urinary tract infections. Nat Rev Immunol. 2015;15(10):655–63.
Olson PD, McLellan LK, Hreha TN, Liu A, Briden KE, Hruska KA, Hunstad DA. Androgen exposure potentiates formation of intratubular communities and renal abscesses by Escherichia coli. Kidney Int. 2018;94(3):502–13.
Kakkanat A, Totsika M, Schaale K, Duell BL, Lo AW, Phan MD, Moriel DG, Beatson SA, Sweet MJ, Ulett GC, et al. The role of H4 flagella in Escherichia coli ST131 virulence. Sci Rep. 2015;5:16149.
Menheniott TR, Judd LM, Giraud AS. STAT3: a critical component in the response to Helicobacter pylori infection. Cell Microbiol. 2015;17(11):1570–82.
Demirel I, Save S, Kruse R, Persson K. Expression of suppressor of cytokine signalling 3 (SOCS3) in human bladder epithelial cells infected with uropathogenic Escherichia coli. APMIS. 2013;121(2):158–67.
Yoshimura A, Naka T, Kubo M. SOCS proteins, cytokine signalling and immune regulation. Nat Rev Immunol. 2007;7(6):454–65.
Conover MS, Hadjifrangiskou M, Palermo JJ, Hibbing ME, Dodson KW, Hultgren SJ. Metabolic Requirements of Escherichia coli in Intracellular Bacterial Communities during Urinary Tract Infection Pathogenesis. MBio. 2016;7(2):e00104–00116.
Staerk K, Gronnemose RB, Nielsen TK, Petersen NA, Palarasah Y, Torres-Puig S, Moller-Jensen J, Kolmos HJ, Lund L, Andersen TE. Escherichia coli type-1 fimbriae are critical to overcome initial bottlenecks of infection upon low-dose inoculation in a porcine model of cystitis. Microbiol (Reading) 2021, 167(10).
Vega-Hernandez R, Ochoa SA, Valle-Rios R, Jaimes-Ortega GA, Arellano-Galindo J, Aparicio-Ozores G, Ibarra JA, Hernandez-Castro R, Cruz-Cordova A, Xicohtencatl-Cortes J. Flagella, Type I Fimbriae and Curli of Uropathogenic Escherichia coli Promote the Release of Proinflammatory Cytokines in a Coculture System. Microorganisms 2021, 9(11).
Schuroff PA, Abe CM, Silva JW, de Paula Coelho C, Andrade FB, Hernandes RT, Dobrindt U, Gomes TAT, Elias WP. Role of aggregate-forming pilus (AFP) in adherence and colonization of both intestinal and urinary tracts. Virulence. 2022;13(1):1423–33.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

FimH of uropathogenic Escherichia coli influenced the infection in prostate cells by the modulation of JAK/STAT signaling pathway

Status:

Version 1

Abstract

Figures

Background

Methods

Bacterial strain

ΔFimH CFT-073 and FimH^over CFT- 073 UPEC strains construction

Prostate cell culture, testosterone pretreatment, and UPEC infection

UPEC infection and quantification by colony-forming unit (CFU) counting

Cell protein extraction

Western blot analysis

Cytometric bead array (CBA) immunoassay

Statistical analysis

Results

UPEC CFT073 FimH overexpression and knockout ΔFimH strains

FimH levels of UPEC and testosterone inhibition in infected RWPE-1 cells

Inflammatory cytokines in RWPE-1 cells infected with UPEC with different FimH levels after testosterone pretreatment

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

FimH of uropathogenic Escherichia coli influenced the infection in prostate cells by the modulation of JAK/STAT signaling pathway

Status:

Version 1

Abstract

Figures

Background

Methods

Bacterial strain

ΔFimH CFT-073 and FimHover CFT- 073 UPEC strains construction

Prostate cell culture, testosterone pretreatment, and UPEC infection

UPEC infection and quantification by colony-forming unit (CFU) counting

Cell protein extraction

Western blot analysis

Cytometric bead array (CBA) immunoassay

Statistical analysis

Results

UPEC CFT073 FimH overexpression and knockout ΔFimH strains

FimH levels of UPEC and testosterone inhibition in infected RWPE-1 cells

Inflammatory cytokines in RWPE-1 cells infected with UPEC with different FimH levels after testosterone pretreatment

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

ΔFimH CFT-073 and FimH^over CFT- 073 UPEC strains construction