Repeated ketamine anesthesia during the neonatal period impairs hippocampal neurogenesis and long-term neurocognitive function by inhibiting Mfn2-mediated mitochondrial fusion in neural stem cells

doi:10.21203/rs.3.rs-3116136/v1

Download PDF

Research Article

Repeated ketamine anesthesia during the neonatal period impairs hippocampal neurogenesis and long-term neurocognitive function by inhibiting Mfn2-mediated mitochondrial fusion in neural stem cells

https://doi.org/10.21203/rs.3.rs-3116136/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 10 Jan, 2024

Read the published version in Molecular Neurobiology →

You are reading this latest preprint version

The mechanism of ketamine-induced neurotoxicity development remains elusive. Mitochondrial fusion/fission dynamics play a critical role in regulating neurogenesis. Therefore, this study was aimed to evaluate whether mitochondrial dynamics were involved in ketamine-induced impairment of neurogenesis in neonatal rats and long-term synaptic plasticity dysfunction. In the in vivo study, postnatal day 7 (PND-7) rats were intraperitoneally injected with 40 mg/kg ketamine four consecutive times at 1 h intervals. Our work revealed that ketamine induced mitochondrial fusion dysfunction in hippocampal NSCs by downregulating Mfn2 expression. In the in vitro study, ketamine treatment at 100 µM for 6 h significantly decreased the Mfn2 expression, and increased ROS generation, decreased mitochondrial membrane potential and ATP levels in cultured hippocampal NSCs. For the interventional study, lentivirus (LV) overexpressing Mfn2 (LV-Mfn2) or control LV vehicle was microinjected into the hippocampal dentate gyrus (DG) 4 days before ketamine administration. Targeted Mfn2 overexpression in the DG region could restore mitochondrial fusion in NSCs and reverse the inhibitory effect of ketamine on NSC proliferation and its faciliatory effect on neuronal differentiation. In addition, synaptic plasticity was evaluated by transmission electron microscopy, Golgi-Cox staining and long-term potentiation (LTP) recordings at 24 h after the end of the behavioral test. Our work revealed that preconditioning with LV-Mfn2 improved long-term cognitive dysfunction after repeated neonatal ketamine exposure by reversing the inhibitory effect of ketamine on synaptic plasticity in the hippocampal DG. The present findings demonstrated that Mfn2-mediated mitochondrial fusion dysfunction plays a critical role in the impairment of long-term neurocognitive function and synaptic plasticity caused by repeated neonatal ketamine exposure by interfering with hippocampal neurogenesis. Thus, Mfn2 might be a novel therapeutic target for the prevention of the developmental neurotoxicity of ketamine.

Ketamine

Mfn2

Mitochondrial dynamics

Neurogenesis

Synaptic plasticity

Neurocognition

General anesthetics are generally considered safe to administer during pediatric surgery. However, preclinical evidence has suggested that general anesthetic exposure induces neurotoxicity and long-term neurocognitive dysfunction [1]. Moreover, currently available clinical evidence has demonstrated an association between multiple exposures to general anesthetics during the neonatal stage and an increased risk of learning disabilities in childhood [2–5]. Therefore, the findings from animal and clinical studies have led to a serious concern regarding the safety of pediatric anesthesia in the medical community and the public.

Ketamine, a NmethylDaspartate (NMDA) receptor antagonist, is widely used as a perioperative sedative, analgesic and general anesthetic in pediatric examination and surgical operation. However, a series of studies on rodent and nonhuman primate brains showed that prolonged and/or repeated ketamine exposure in the neonatal period could cause significant neuroapoptosis and long-term neurobehavioral abnormalities [6–8]. In addition, ketamine-induced neuronal apoptosis has been demonstrated in human embryonic stem cell (hESC)-derived neurons [9]. Therefore, neuroapoptosis was one of the first reported mechanisms of developmental neurotoxicity induced by ketamine.

During the period of brain growth spurt (BGS), neurogenesis lays the foundation for the structure and function of the neural network [10, 11]. A series of studies have shown that hippocampal dentate gyrus (DG) neurogenesis during BGS is particularly susceptible to outside stimulation, such as hypoxia–ischemia, hyperoxia and stress [12–14]. Therefore, disturbance of neurogenesis may be an important variable to be considered in evaluating the potential adverse effects of anesthetics on neurodevelopment. Our recent findings demonstrated that four intraperitoneal administrations of 40 mg/kg ketamine disrupted the proliferation and differentiation of hippocampal neural stem cells (NSCs) in postnatal Day 7 (PND-7) rats and finally affected hippocampus-dependent learning and memory function [15]. However, the potential molecular mechanisms have not been fully elucidated.

Mitochondria, an important organelle of eukaryotes, maintain the homeostasis of reticulate structures through continuous fission and fusion, and the process is called mitochondrial dynamics [16]. In mammals, mitochondrial fission is mediated by the conserved dynamin-related GTPase Drp1, which assembles on the surface of mitochondria. Mitochondrial fusion involves two processes: fusion of the outer mitochondrial membrane depends on mitofusins (Mfn1 and Mfn2), and fusion of the inner mitochondrial membrane is mediated by optic atrophy 1 (OPA1) [17]. The balance between mitochondrial fission and fusion is essential for the maintenance of mitochondrial populations and the morphology, distribution and function of mitochondria.

For the past few years, the role of mitochondrial dynamics in regulating neurogenesis and cognitive function has attracted increasing attention [18]. A recent study demonstrated that mitochondrial dynamics were closely associated with the fate plasticity of NSCs during mouse and human cortical neurogenesis. NSCs destined to self-renew undergo mitochondrial fusion, whereas those that retain high levels of mitochondrial fission become neurons [19]. To date, it is unclear how mitochondrial fission and fusion of NSCs respond to general anesthetics during the postnatal period. Herein, we investigated the effects of repeated ketamine anesthesia on the mitochondrial ultrastructure of developing hippocampal NSCs by in vivo and in vitro experiments. The present study aimed to explore whether repeated neonatal ketamine exposure interferes with the proliferation and neuronal differentiation of hippocampal NSCs and synaptic plasticity by affecting mitochondrial dynamics, thereby leading to long-term neurocognitive dysfunction.

2.1. Animal care

The experimental protocol was approved by the Institutional Animal Care and Ethics Committee of Xuzhou Medical University and in accordance with the Guide for the Care and Use of Laboratory Animals of the National Research Council. All efforts were made to minimize animal suffering and to reduce the number of animals used. Pregnant Sprague‒Dawley (SD) rats were obtained from the Laboratory Animal Centre of Xuzhou Medical University. The pregnant rats were individually housed under temperature-controlled (23°C-25°C) conditions on a 12-h light/dark cycle and had access to food and water. Before the experiment, PND-7 rats (11–14 g) were placed in an anesthesia induction box to acclimate to the environment.

2.2. Ketamine anesthesia model

The PND-7 rats were randomly divided into a normal saline group (NS) and a ketamine group (Ket). The construction of the ketamine anesthesia model was employed following the protocol described in our previous study [15]. The rats in the Ket group were intraperitoneally administered four injections of 40 mg/kg ketamine (10 mg/ml) at 1 h intervals (40 mg/kg × 4). The rats in the NS group were intraperitoneally injected with 4 µl of NS per gram of body weight as a control.

During the intervals between NS/ketamine injections, the animals were placed in a transparent chamber, and the body temperature was monitored and kept between 36°C and 37°C by using heating plates integrated into the floor of the chamber. This approach was used to help maintain body temperature and reduce stress. When the rats recovered from anesthesia, they were returned to their home cages. The experimental procedure is shown in Fig. 1A.

2.3. Primary NSC separation, culture and treatment

Hippocampal NSCs were obtained from PND-1 rats. The tissues were cut into pieces and digested at 37°C for 20 mins with 0.25% trypsin (T1300, Solarbio). The dissociated cells were seeded in NSC medium: DMEM/F12 (10565-018, Gibco) with epidermal growth factor (EGF) (20 ng/ml, N10504031, Cyagen), basic fibroblast growth factor (bFGF) (20 ng/ml, CM25, Novopnotin), B27 (2%; 17504-044; Gibco), and N2 (1%; 17502-048; Gibco) to form primary neurospheres and grown in 5% CO₂ in air at 37°C. The isolated NSCs were successfully detected by Nestin immunofluorescence (1:200, DF7754, Affinity). Control group: no treatment. Ketamine group: NSCs were treated with 100 µM ketamine for 6 h.

2.4. Analysis of mitochondrial ultrastructure in hippocampal NSCs

2.4.1. Immune Electron Microscopy

After the end of treatment in each group, a targeted tissue block of approximately 1 mm × 1 mm × 1 mm was rapidly cut from the hippocampal DG on ice and transferred into fresh immune electron microscopy fixative for further fixation. After washes with 0.1 M phosphate buffer, the tissue blocks were dehydrated in graded ethanol on an ice box, penetrated in resin, and finally embedded in a capsule containing resin at 4 ℃. Next, the resin blocks were cut into 70–80 nm thick sections on an ultramicrotome, and the tissues were dried on nickel grids. Immunolabeling: Nickel grids with tissues were blocked in 1% BSA TBS solution for 30 mins at room temperature and then incubated in the Nestin primary antibody (1:20; Servicebio) overnight at 4 ℃. On the second day, the nickel grids were removed and recovered to room temperature and rinsed on a TBS drop for 5 mins at room temperature. Then, the nickel grids were incubated in the secondary antibody for 1 h at 37 ℃. Finally, the nickel grids with tissues were stained in 2% uranium acetate saturated alcohol solution in the dark for 8 mins and rinsed in 70% ethanol and ultrapure water 3 times. After washing, the nickel grids were dried in a 37 ℃ oven for application. The mitochondrial morphology of NSCs in the hippocampal DG was observed under transmission electron microscopy (Hitachi, HT7800). The black golden particles are positive signals.

2.4.2. Transmission Electron Microscopy (TEM)

NSCs cultured on Matrigel-coated coverslips from each experimental condition were fixed with 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer at 4°C and postfixed with 1% osmium tetroxide for 2–3 h on ice. Cells were then dehydrated through graded methanol (50%, 20 mins; 70%, 20 mins; 90%, 20 mins; 100%, 3 × 20 mins) and 100% acetone (20 mins). The cells were infiltrated with epoxy resin and polymerized overnight at 70°C. Ultrathin sections (70 nm) were cut, stained with uranyl acetate and lead citrate according to standard procedures and viewed with TEM (JEM-1400).

2.5. Mitochondrial function.

2.5.1. Detection of mitochondrial membrane potential in hippocampal NSCs

A mitochondrial membrane potential test kit (JC-1) was used to detect changes in mitochondrial membrane potential. First, 1 × 10⁶ cells from each group were obtained and resuspended in 1 ml of medium, and then, the same volume of JC-1 working solution (BB-4105, Bestbio) was added. The samples were incubated at 37 ℃ for 20 mins. Cells were washed with JC-1 staining buffer preheated at 37 ℃ and detected by flow cytometry.

2.5.2. Analysis of ATP concentration in hippocampal NSCs

The level of ATP was detected by a biochemical kit. The NSC samples were centrifuged at 1000 × g for 15 mins, and the supernatant was removed to obtain cell precipitates. ELISAs were performed according to the kit instructions (A095-1-1, JianchengBio), and the absorbance (OD) values of each well were measured at 636 nm with an enzyme label instrument.

2.5.3. Measurement of reactive oxygen species (ROS) in hippocampal NSCs

Two groups of NSCs were collected, and the medium was discarded. A reactive oxygen species assay kit was purchased from KeyGen Biotec (KGT010-1). DCFH-DA (1:1000) was added to each sample, and the samples were incubated at 37 ℃ for 20 mins. Then, the samples were washed with serum-free medium 3 times and washed again with PBS, and the supernatant was centrifuged and discarded. After suspension with 300 µl of PBS, flow cytometry was used for detection.

2.6. Viral stereotaxic microinjection

In the overexpression study, the rats were randomly divided into 4 groups: control lentiviral (LV) vehicle (VEH) + NS group (LV-VEH + NS), control LV-VEH + Ket group (LV-VEH + Ket), LV-Mfn2 vector + NS group (LV-Mfn2 + NS), and LV-Mfn2 vector + Ket group (LV-Mfn2 + Ket). The LV vectors pSLenti-CMV-HA-Mfn2-P2A-EGFP-3 × FLAG-WPRE and pSLenti-CMV-EGFP-3 × FLAG-WPRE were generated by OBiO Technology (Shanghai, China). Stereotactic injections into the hippocampal DG were performed according to the method described in our previous study [20]. The PND-3 rat pups were anesthetized with 3% isoflurane and placed in a stereotaxic apparatus with an adapter for neonatal rats (David Kopf, CA). A scalp incision was made in the skull surface, and the bregma was exposed. LV-VEH or LV-Mfn2 was microinjected into the bilateral hippocampal DG by using a 10-µl precise syringe under a stereotaxic instrument. The coordinates used for the hippocampal DG microinjection followed the atlas of the neonatal rat brain (2.2 mm posterior to the bregma on the midline, 0.85 mm left or right of the midline and 2.55 mm below the meninges). The injection volume of the viral suspension was 0.5 µl/side, which was released over 2 mins. The tip of the syringe was left in the injection site for 10 mins before it was slowly removed. After the end of microinjection, all rats were allowed to recover from the virus injection for 4 days before NS or ketamine administration.

2.7. NSC proliferation and differentiation assay

Bromodeoxyuridine (BrdU) was used to assess the proliferation and differentiation of NSCs by double immunofluorescence. The protocol of BrdU injection was performed using the method described in our previous study [15]. The rats in each group received a single intraperitoneal injection of 100 mg/kg BrdU (B5002, Sigma) immediately after the last treatment.

All animals were transcardially perfused with 0.9% saline followed by 4% paraformaldehyde at 24 h after BrdU injection. The brain tissue was removed and postfixed overnight in 4% paraformaldehyde and placed in 30% sucrose. Coronal slices of the brains were consecutively cut at a thickness of 30 µm. Based on the atlas of the developing rat brain (www.ial-developmental-neurobiology.com) and previous reports [21], when the hippocampal structure began to be exposed, the fifteenth slice containing the dorsal hippocampus was collected from each rat. For BrdU immunofluorescence detection, DNA was denatured to expose the antigen. After incubation with 50% formamide for 2 h at 65°C, the samples were incubated with 2 normal hydrochloric acid for 30 mins at 45°C. Then, the brain slices were incubated with primary antibodies for BrdU (1:1000, B5002, Sigma) combined with Nestin primary antibody (1:200, ab221660, Abcam) and DCX primary antibody (1:200, ab207175, Abcam) at 4°C overnight and then incubated with secondary fluorescent antibodies for 2 h.

The immunofluorescence images were visualized under a laser scanning confocal microscope (Fluoview 1000, Olympus). ImageJ 1.4 software (National Institutes of Health, Bethesda, MD, USA) was used to quantify positive cells in the slice by a researcher who was blinded to this study. To evaluate the proliferation and differentiation of hippocampal NSCs, we calculated the percentages of Nestin⁺/BrdU⁺ cells to Nestin⁺ cells and DCX⁺/BrdU⁺ cells to BrdU⁺ cells and the densities of Nestin⁺/BrdU⁺ cells and DCX⁺/BrdU⁺ cells in the hippocampal DG.

2.8. Golgi-Cox staining

Golgi-Cox staining was used to visualize the synaptic structural plasticity of neurons. In the present study, the brain tissues were removed immediately after the end of the behavioral test in each group. The Golgi-Cox OptimStain PreKit (Hitobiotec Corp, Kingsport, TN, USA) was employed according to the manufacturer’s instructions. Specifically, the brain tissues were immersed in solutions 1 and 2 for 24 h, the solutions were changed, and the tissues were stored in the dark at room temperature for 2 weeks. Next, solution 3 was used, and the brains were stored in the dark at 4°C for another 72 h. A vibratome (chamber temperature − 22°C) was used to prepare brain sections (100 µm). An Olympus BX53 microscope was used for the imaging and analysis of the dendrites and dendritic spines within the hippocampal DG.

2.9. Analysis of synapse ultrastructure

After the end of the behavioral test in each experimental group, a targeted tissue block of approximately 1 mm × 1 mm × 1 mm was rapidly cut from the hippocampal DG on ice, fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer for 2 h at room temperature and then postfixed in 1% osmium tetroxide in 0.1 M phosphate buffer. Then, the tissue blocks were dehydrated in graded ethanol and embedded in beam capsules. Next, approximately 50–70 nm thick sections were cut from the embedded tissue block and dried on nickel grids. The sections were stained with 2% uranyl acetate for 30 mins and lead citrate for 15 mins, and the ultrastructure of synapses was observed under TEM.

2.10. Multichannel field potential recording

Long-term potentiation (LTP) recordings were used to evaluate functional synaptic plasticity immediately after the end of the behavioral test in each group. The 64-channel recording system (MED64, Panasonic Alpha-Med Sciences) was used as described previously [22]. One of 64 microelectrodes was selected as a stimulating electrode within the DG region of the hippocampus. The evoked field excitatory postsynaptic potentials (fEPSPs) were used for recording from the other channels. Theta burst stimulation (TBS) (5 trains of bursts with 4 pulses at 100 Hz, repeated 5 times at 10 s intervals) was used in this study. Averaged fEPSP slopes over the last 20 mins of the recording were used for analysis.

2.11. Other methods

Procedures related to Western blot analysis, real-time quantitative PCR (qRT‒PCR) analysis, behavioral tests and Mfn2 immunofluorescence staining are provided in the Supplementary material.

2.12. Data analysis

The statistical analysis was conducted using SPSS software (version 17.0; SPSS, Inc., Chicago, IL, USA), and the graphs were generated using GraphPad Prism 5. All the data conformed to a normal distribution and are presented as the mean ± standard error of the mean for each group. The significant differences between two groups were analyzed with an unpaired two-tailed t test. Multiple comparisons were performed using one-way ANOVA. The interaction between time and group factors in a repeated-measures two-way ANOVA was used to analyze the differences in the escape latency data from the MWM test among the different groups. P < 0.05 was considered statistically significant.

3.1. Neonatal ketamine anesthesia reduced Mfn2 expression in hippocampal NSCs

The expression of mitochondrial fission-related protein (Drp1) and mitochondrial fusion-related proteins (Mfn1 and Mfn2) in the hippocampal DG was measured in the NS and Ket groups. Quantification of the Western blot results showed that 4 injections of 40 mg/kg ketamine did not affect Drp1 protein expression (1.05 ± 0.13 vs. 1 ± 0.16; P = 0.81, Fig. 1B). Compared with the control rats, the ketamine-treated rats exhibited significantly decreased Mfn2 protein expression (0.59 ± 0.04 vs. 1 ± 0.05; P < 0.01, Fig. 1B) but showed no change in Mfn1 protein expression (0.998 ± 0.02 vs. 1 ± 0.02; P = 0.94, Fig. 1B).

As shown in Fig. 1C, the Nestin-positive cells in the DG region were regarded as hippocampal NSCs. To quantify the levels of Mfn2 in hippocampal NSCs, we labeled Mfn2/Nestin double-positive cells by fluorescence staining. After statistical analysis, ketamine was found to significantly decrease the mean fluorescence intensity of Mfn2 (0.034 ± 0.003 vs. 0.062 ± 0.003; P < 0.01, Fig. 1D) and the density of Mfn2⁺/Nestin⁺ cells (157.3± 10.4 cells/mm²vs. 220.6 ± 18.9 cells/mm², P < 0.05, Fig. 1E).

In the in vitro study, primary NSCs isolated from the hippocampal DG were identified successfully by Nestin immunofluorescence assays (Fig. 2A). Fig. 2B shows neurospheres consisting of NSCs. Compared with the control treatment, ketamine treatment at 100 μM for 6 h significantly decreased Mfn2 mRNA expression (0.78 ± 0.03 vs. 1 ± 0.04; P < 0.01, Fig. 2C) and Mfn2 protein expression (0.52 ± 0.07 vs. 1 ± 0.05; P < 0.01, Fig. 2D) in NSCs. Through immunofluorescence detection, ketamine significantly decreased the mean fluorescence expression of Mfn2 in the neurospheres (0.013 ± 0.0029 vs. 0.025 ± 0.0023; P < 0.01, Fig. 2E and F).

3.2. Ketamine damaged mitochondrial fusion in hippocampal NSCs

The effect of neonatal ketamine exposure on mitochondrial dynamics in hippocampal NSCs was investigated in vivo by using immune electron microscopy. As shown in Fig. 3A, black golden particles with Nestin-positive signals were widely distributed in the cytoplasm, and these cells could be identified as hippocampal NSCs. Compared with those of the NS group, the mitochondria in the ketamine group changed from an elongated structure to a fragmented morphology, and shorter and smaller mitochondria were distributed in the cytosol. Statistical analysis showed that the normalized length of mitochondria in hippocampal NSCs was significantly shortened in the Ket group compared with the NS group (0.56 ± 0.05 vs. 1 ± 0.13; P < 0.05, Fig. 3B).

In the in vitro experiment, the structure of hippocampal NSCs was observed by transmission electron microscopy. Untreated cells had elongated mitochondria with intact inner and outer membranes, and mitochondrial cristae were neatly arranged without damage (Fig. 3C). After treatment with 100 μM ketamine for 6 h, the mitochondria in NSCs became discrete and swollen, and the crista fractured or even disappeared. After statistical analysis, the normalized length of mitochondria in NSCs was found to be significantly decreased in the Ket group compared with the control group (0.45 ± 0.02 vs. 1 ± 0.12; P < 0.01, Fig. 3D).

Taken together, the above results indicated that neonatal repeated ketamine anesthesia decreased the expression of Mfn2 and induced dysfunction of mitochondrial fusion in the hippocampal NSCs.

3.3. Ketamine induced mitochondrial dysfunction and bioenergetic deficits in cultured hippocampal NSCs

Impaired mitochondrial fusion and fractured mitochondrial cristae cause defective mitochondria to be unable to produce energy. Next, the in vitro study detected indicators related to the bioenergeticfunction of mitochondria in hippocampal NSCs. To this end, mitochondrial membrane potential was measured by JC-1. As shown in the results of flow cytometry in Fig. 4A, we found that the ratio of red fluorescence to green fluorescence in the ketamine group was significantly decreased compared with that in the control group (P < 0.01, Fig. 4B), suggesting that ketamine significantly reduced the mitochondrial membrane potential in hippocampal NSCs. In the ATP level test, 100 μM ketamine exposure for 6 h significantly decreased the ATP level compared with that in the control cells (357.9 ± 17.9 μmol/gprot vs. 508.4 ± 9.1 μmol/gprot; P < 0.01, Fig. 4C). Instead, compared with the control treatment, ketamine significantly enhanced ROS generation, as shown by analyzing the mean fluorescence intensity (262115 ± 4335 vs. 219783 ± 5975; P < 0.01, Fig. 4D and E), indicating that ketamine induced mitochondrial dysfunction in hippocampal NSCs.

3.4. Neonatal ketamine anesthesia attenuated the hippocampal-dependent neurocognitive ability during the adult stage

In this study, the spatial learning and memory function of 2-month-old rats were tested by the MWM experiment. During the reference training period, the time required to reach the platform in the rats of the Ket group was significantly longer than that in the NS group from training days 2 to 5 (Fig. 5A). In the probe test, compared with those in the NS group, the rats in the Ket group required a significantly longer time to find the previous platform position on Day 6 (37.3 ± 8.67 s vs. 8.5 ± 1.22 s; P < 0.01, Fig. 5B). The percentage of time spent in the target quadrant was significantly reduced in the Ket group compared to the NS group (40.3 ± 2.36% vs. 58.3 ± 1.71%; P < 0.01, Fig. 5C). Additionally, the number of rats that crossed the location of the previous platform was significantly decreased in the Ket group compared to the NS group (3.9 ± 0.61 vs. 8.1 ± 0.73; P < 0.01, Fig. 5D). Fig. 5E shows the typical swim patterns in the hidden platform trial.

3.5. Neonatal ketamine anesthesia impaired synaptic plasticity in the hippocampal DG during the adult stage

Synaptic plasticity plays a critical role in the formation of learning and memory. Therefore, the present study evaluated the synaptic structure and function in the hippocampal DG at 24 h after the MWM test. First, the synaptic structure was investigated by Golgi-Cox staining. The morphology of neurons and camera tracings in the hippocampal DG from the NS and Ket groups are shown in Fig. 5F-G. Sholl analysis was used to measure dendritic branching and spine density in the DG region of the hippocampus. Compared with that of the NS group, the total number of dendritic intersections at 90-190 μm from the soma was significantly decreased in the Ket group (P < 0.01, Fig. 5I). The statistical analysis showed that ketamine decreased the total dendritic length (869 ± 43.6 μm vs. 1189 ± 61.8 μm; P < 0.01, Fig. 5J) and reduced the number of spines/10 μm (7.5 ± 0.43 vs. 10.5 ± 0.48; P < 0.01, Fig. 5H and K).

Transmission electron microscopy is another effective method to observe the ultrastructure of synapses. The typical images showed that synapses in the Ket group were swollen, the synaptic vesicles were sparse, and the synaptic space was blurred (Fig. 5L). The statistical results showed that ketamine decreased the length of the synaptic active zone (309.8 ± 24.75 nm vs. 417.1 ± 27.2 nm; P < 0.01, Fig. 5M) and reduced the postsynaptic density (PSD) thickness (33.3 ± 1.86 nm vs. 41.4 ± 1.83 nm; P < 0.01, Fig. 5N) compared with those in the NS group. Moreover, the width of the synaptic cleft was increased in the Ket group (19.5 ± 0.62 nm vs. 16.5 ± 0.51 nm; P < 0.01, Fig. 5O).

Synaptic function was measured by electrophysiological methods after the behavior test. Long-term potentiation (LTP) in the hippocampal DG was evaluated using a 64-channel multielectrode (MED64) system. The sample image shows the location of the recording electrode and stimulating electrode in the DG region (Fig. 5P). As shown in Fig. 5Q, the magnitude of LTP in the hippocampal DG region induced by high-frequency stimulation was obviously decreased in the Ket group compared to the NS group. The averaged fEPSP amplitude during the period of 40-60 mins after stimulation was significantly reduced from 153.6 ± 14.07% in the NS group to 110.2 ± 2.13% in the Ket group (P < 0.05, Fig. 5R).

3.6. Targeted Mfn2 overexpression in the hippocampal DG reversed ketamine-induced mitochondrial fusion dysfunction in hippocampal NSCs of neonatal rats

To verify the contribution of Mfn2 to ketamine-induced dysfunction of mitochondrial fusion in hippocampal NSCs, we microinjected the LV capable of overexpressing Mfn2 (LV-Mfn2) or control LV vehicle (LV-VEH) into the bilateral hippocampal DG four days prior to ketamine anesthesia (PND-3), and then, all rats were allowed to recover from the virus injection for 4 days before NS or ketamine administration (PND-7) (Fig. 6A). According to the experimental protocol, we detected the mitochondrial fusion parameters of hippocampal NSCs by using Western blotting, immunofluorescence staining and immune electron microscopy.

The Western blot results verified that targeted overexpression of Mfn2 in the hippocampal DG could result in a significant increase in Mfn2 protein expression compared with that in the LV-VEH + NS group (1.25 ± 0.02 vs. 1 ± 0.04; P < 0.01, Fig. 6B). Importantly, the downregulation of Mfn2 protein expression induced by ketamine could be reversed by targeted Mfn2 overexpression before ketamine anesthesia (0.71 ± 0.07 vs. 1.03 ± 0.04; P < 0.01, Fig. 6B).

As shown in the typical confocal images in Fig. 6C, the rats in the LV-Mfn2 + NS group presented higher Mfn2 expression in the hippocampal DG than the rats in the LV-VEH + NS group, and the mean fluorescence intensity of Mfn2 was 0.063 ± 0.003 in the LV-Mfn2 + NS group and 0.05 ± 0.004 in the LV-VEH + NS group (P < 0.05, Fig. 6D). In addition, the density of Mfn2⁺/Nestin⁺cells was increased in the LV-Mfn2 + NS group compared to the LV-VEH + NS group (207.3± 3.1/mm²vs. 166.3 ± 10.8/mm², P < 0.01, Fig. 6E). Strikingly, the reduced fluorescence intensity of Mfn2 and density of Mfn2⁺/Nestin⁺cells in the LV-VEH + Ket group were restored by Mfn2 overexpression in the LV-Mfn2 + Ket group (mean fluorescence intensity: 0.028 ± 0.002 vs. 0.048 ± 0.003, P < 0.01, Fig. 6D; density: 136.3± 3.9/mm²vs. 184.9 ± 5.7/mm², P < 0.01, Fig. 6E).

We then examined the effect of Mfn2 overexpression on mitochondrial morphology in hippocampal NSCs by using immune electron microscopy. The typical ultrastructure is shown in Fig. 6F. Compared with that of the LV-VEH + NS group, the normalized length of mitochondria was significantly increased in the LV-Mfn2 + NS group (1.76 ± 0.07 vs. 1 ± 0.15; P < 0.01, Fig. 6G), and more elongated mitochondria were observed in the cytosol of hippocampal NSCs. However, the morphology of mitochondria in the LV-VEH + Ket group exhibited fragmentation. Importantly, our results showed that Mfn2 overexpression before anesthesia in the rats of the LV-Mfn2 + Ket group could reverse the inhibitory effect on mitochondrial fusion of hippocampal NSCs induced by ketamine, the normalized length of mitochondria was significantly increased (0.95 ± 0.11 vs. 0.48 ± 0.02; P < 0.05, Fig. 6G), and mitochondria again exhibited an elongated morphology in NSCs compared with those of the LV-VEH + Ket group.

Taken together, these findings demonstrated that repeated neonatal ketamine anesthesia caused mitochondrial fusion dysfunction in hippocampal NSCs through downregulation of Mfn2 expression.

3.7. Targeted Mfn2 overexpression in the hippocampal DG reversed ketamine-induced disturbances in the proliferation and differentiation of neonatal hippocampal NSCs

Representative immunofluorescence images of NSC proliferation in the hippocampal DG are shown in Fig. 7A. The statistical findings showed that compared with the LV-VEH + NS group treatment, ketamine treatment significantly inhibited the proliferation of NSCs, as indicated by a decreased density and a decreased percentage of Nestin⁺/BrdU⁺ cells (density: 85.7± 13.3/mm²vs. 194.1 ± 12.1/mm², P < 0.01, Fig. 7B; percentage: 11.23 ± 0.88% vs. 16.9 ± 0.34%, P < 0.01, Fig. 7C). Targeted overexpression of Mfn2 in NSCs significantly promoted the proliferation of NSCs (density: 352.8 ± 11.4/mm²vs. 194.1 ± 12.1/mm², P < 0.01, Fig. 7B; percentage: 22.5 ± 0.92% vs. 16.9 ± 0.34%, P < 0.01, Fig. 7C). Importantly, before ketamine anesthesia, targeted overexpression of Mfn2 in hippocampal NSCs could reverse the inhibitory effect on NSC proliferation induced by ketamine (density: 218.2 ± 14.4/mm²vs. 85.7± 13.3/mm², P < 0.01, Fig. 7B; percentage: 17 ± 0.79% vs. 11.23 ± 0.88%, P < 0.01, Fig. 7C).

Doublecortin (DCX), as a marker of neuronal precursor cells, is mainly used in the study of neuronal differentiation. Fig. 8A shows typical images of neuronal differentiation in the hippocampal DG by using DCX/BrdU double-labeling immunofluorescence. Compared with the LV-VEH + NS group treatment, ketamine significantly promoted the neuronal differentiation of NSCs (density: 545.6 ± 19/mm²vs. 462.6± 8.4/mm², P < 0.01, Fig. 8B; percentage: 30.6 ± 0.82% vs. 25.2 ± 0.41%, P < 0.01, Fig. 8C), while LV-Mfn2 pretreatment significantly inhibited neuronal differentiation, as indicated by a decreased density and percentage of DCX⁺/BrdU⁺ cells (density: 372.6 ± 16.2/mm²vs. 462.6± 8.4/mm², P < 0.01, Fig. 8B; percentage: 21.9 ± 0.59% vs. 25.2 ± 0.41%, P < 0.01, Fig. 8C). Of note, the rats in the LV-Mfn2 + Ket group showed a significant decrease in the density and percentage of DCX⁺/BrdU⁺ cells compared to those in the LV-VEH + Ket group (density: 443.5 ± 10.6/mm²vs. 545.6± 19/mm², P < 0.01, Fig. 8B; percentage: 26.2 ± 0.59% vs. 30.6 ± 0.82%, P < 0.01, Fig. 8C).

3.8. Targeted Mfn2 overexpression in the hippocampal DG prevented the adult neurocognitive decline induced by neonatal repeated ketamine anesthesia

During the reference training period, the time required for the rats to reach the platform in the four groups showed a downward trend from training day 3 to day 5. The results showed that the escape latency of the rats in the LV-Mfn2 + Ket group was significantly shorter than that of the rats in the Ket group (Fig. 9A). On Day 6, the platform was removed in the probe test, and the escape latency of the rats in the LV-Mfn2 + Ket group was significantly shortened compared to that in the LV-VEH + Ket group (12.9 ± 2.3 s vs. 25 ± 5.1 s, P < 0.05, Fig. 9B). Additionally, the rats in the LV-Mfn2 +Ket group stayed in the target quadrant significantly longer than those in the LV-VEH + Ket group (66.5 ± 1.4% vs. 53 ± 2.7%, P < 0.01, Fig. 9C). The number of crossings over the previous platform position was significantly increased in the LV-Mfn2 +Ket group compared to the LV-VEH + Ket group (8.3 ± 1.2 vs. 4.4 ± 0.6; P < 0.05, Fig. 9D). The representative swim patterns in the probe test are shown in Fig. 9E.

3.9. Targeted Mfn2 overexpression in the hippocampal DG reversed the adult synaptic plasticity dysfunction induced by neonatal repeated ketamine anesthesia

Synaptic plasticity in the hippocampal DG was investigated by Golgi-Cox staining at 24 h after the MWM test. The representative morphology of neurons in the four groups is shown in Fig. 10A, and the camera tracings are presented in Fig. 10B. The Sholl analysis showed that compared with that in the LV-VEH + Ket group, the total number of dendritic intersections at 110-190 μm from the soma in the hippocampal DG was significantly increased in the rats in the LV-Mfn2 + Ket group (P < 0.01, Fig. 10D), and Mfn2 overexpression before ketamine anesthesia significantly increased the total dendritic length (1204 ± 61.0 μm vs. 825 ± 16.6 μm; P < 0.01, Fig. 10E). Additionally, the number of spines/10 μm in the LV-Mfn2 + Ket group was significantly increased compared to that in the LV-VEH + Ket group (10.72 ± 0.31 vs. 6.95 ± 0.22; P < 0.01, Fig. 10C and F).

Fig. 10G presents typical transmission electron microscopy images of the four groups. Compared with the rats in the LV-VEH + Ket group, those with Mfn2 overexpression treatment ketamine anesthesia in the LV-Mfn2 + Ket group showed an increased length of the synaptic active zone (334.9 ± 20.97 nm vs. 248.7 ± 8.84 nm; P < 0.01, Fig. 10H) and the PSD thickness (54.1 ± 1.51 nm vs. 35.7 ± 1.70 nm; P < 0.01, Fig. 10I). However, the width of the synaptic cleft was decreased in the LV-Mfn2 + Ket group compared with the LV-VEH + Ket group (18.5 ± 0.73 nm vs. 21.4 ± 0.56 nm; P < 0.05, Fig. 10J).

During the detection of synaptic function, the magnitude of LTP induced by high frequency stimulation was obviously suppressed in the 2-month-old rats of the LV-VEH + Ket group compared to that in the LV-VEH + NS group. However, Mfn2 overexpression treatment before ketamine anesthesia significantly recovered the magnitude of LTP (Fig. 10K). The averaged fEPSP amplitude during the period of 40-60 min was significantly increased from 115.8 ± 3.52% in the LV-VEH + Ket group to 138.3 ± 8.90% in the LV-Mfn2 + Ket group (Fig. 10L).

Taken together, the above findings demonstrated that Mfn2 overexpression could reverse the interfering effect of ketamine on NSC proliferation and neuronal differentiation by rescuing the function of mitochondrial fusion in NSCs, which could play a critical role in protecting structural and functional synaptic plasticity in the hippocampal DG during adulthood.

Ketamine is widely used in pediatric sedation and anesthesia [23]. However, preclinical studies have noted that ketamine anesthesia in the early stage may lead to developmental neurotoxicity and long-term neurocognitive impairment [24]. Clinical evidence has further demonstrated that infants who are subjected to repeated and/or prolonged anesthesia exhibit significant abnormalities in behavior, executive function and reading in childhood [3, 5]. Therefore, the concern regarding developmental anesthetic neurotoxicity raised by the U.S. Food and Drug Administration has become a focus in the medical community and the public [25].

The brain growth spurt (BGS) in rodents lasts from the end of pregnancy to the first 2–3 weeks after birth [26]. During the critical period, the balance between NSC proliferation and differentiation plays a role in the structure and function of the hippocampus. Multiple preclinical studies, including one from our research group, have demonstrated that intravenous (propofol and ketamine) and inhalation anesthetics (isoflurane and sevoflurane) during the BGS phase interfered with the proliferation and differentiation of hippocampal NSCs and led to neurocognitive dysfunction in the adult stage [15, 27–29]. However, due to the complexity of the developing brain, the precise mechanism of developmental anesthetic neurotoxicity has not been fully elucidated.

Mitochondria, important organelles of eukaryotes, are regulated dynamically with a continuous cycle of fusion and fission. The regulation of mitochondrial fusion and fission could restore mitochondrial homeostasis and leave healthy mitochondria inside the cell [30, 31]. Abnormalities in mitochondrial dynamics block mitochondrial transport in neurons and increase the production of reactive oxygen species, which lead to signal transduction disorders, synaptic degeneration and neuronal apoptosis. Accumulating evidence has confirmed that unbalanced mitochondrial fusion/fission dynamics are closely related to various psychiatric and neurological diseases. For example, the reduced expression of Mfn2 combined with mitochondrial fusion dysfunction was observed in the nucleus accumbens of highly anxious rats exhibiting depression-like behaviors [32]. Moreover, mitochondrial dynamics disorder is involved in the development of Alzheimer's disease [33]. Aβ overproduction accelerated mitochondrial fission by increasing Drp1, simultaneously inhibited mitochondrial fusion by decreasing Mfn2, and finally caused mitochondrial fragmentation and neuronal apoptosis [34]. Furthermore, the importance of mitochondrial dynamics in developmental anesthetic neurotoxicity has attracted increased attention. Numerous studies have shown that isoflurane/sevoflurane can induce the apoptosis of developing neurons by promoting mitochondrial fission through upregulation of Drp1 and inhibiting mitochondrial fusion through downregulation of Mfn2 [35–37].

Based on the results of the present study, we found that four administrations of 40 mg/kg ketamine specifically inhibited the expression of Mfn2 protein in the hippocampal DG of neonatal rats. Immunofluorescence staining analysis also showed that ketamine decreased the fluorescence intensity of Mfn2 and the density of Mfn2⁺/Nestin⁺ positive cells in the hippocampal DG. The in vitro study further confirmed that 100 µM ketamine decreased the expression of Mfn2 in the cultured hippocampal NSCs after treatment for 24 h. These findings suggested that Mfn2 in hippocampal NSCs was sensitive to ketamine anesthesia during the neonatal period in the form of reduced expression.

However, ultrastructural details are much more valuable than focusing only on changes in the expression level of Mfn2. Presently, in vivo studies regarding the effect of anesthetics on the mitochondrial morphology of developing hippocampal NSCs are very limited. The main reason might be that transmission electron microscopy could not distinguish the observed mitochondria belonging to which cell type in the hippocampal DG region. This in vivo study was the first to show the mitochondrial morphology of hippocampal NSCs by using immune electron microscopy, and the black particles with Nestin-positive signals in the cytoplasm could be used to identify hippocampal NSCs. The ultrastructural analysis further indicated that ketamine could induce mitochondria to be much shorter and swollen. In conclusion, these findings revealed that dysfunction of mitochondrial fusion began to occur in hippocampal NSCs after long-term ketamine anesthesia.

Recently, mitochondrial dynamics have been demonstrated to play a critical role in the regulation of neurogenesis [18, 38, 39]. The new findings revealed that cortical stem cells retained the ability to self-renew and undergo mitochondrial fusion, whereas those that retained high levels of mitochondrial fission became neurons [19, 40]. The present study constructed a lentivirus that could overexpress Mfn2 and observed its effect on the proliferation and differentiation of hippocampal NSCs in PND-7 rats repeatedly exposed to ketamine. Our findings revealed that upregulation of Mfn2 in the hippocampal DG ameliorated the ketamine-induced imbalance of mitochondrial fusion/fission dynamics in hippocampal NSCs, and the mitochondrial length of hippocampal NSCs in the rats of the LV-Mfn2 + Ket group was recovered by immune electron microscopy. Importantly, upregulation of Mfn2 in the hippocampal DG before ketamine anesthesia could reverse the inhibitory effect of ketamine on NSC proliferation and its faciliatory effect on neuronal differentiation, and remodeling of mitochondrial dynamics could restore the conversion process of NSCs into neurons during postnatal development. Taken together, these results demonstrated that Mfn2-related mitochondrial fusion dysfunction in hippocampal NSCs played a critical role in the ketamine-induced disorder of NSC proliferation and differentiation during the neonatal period.

The precise balance between fission and fusion is critical not only to maintain the normal structure of mitochondria but also to maintain mitochondrial function. For example, NSC proliferation and differentiation mainly depend on energy production from healthy mitochondria. In the in vitro study, we preliminarily observed that 100 µM ketamine exposure for 24 h led to marked mitochondrial fragmentation in the hippocampal NSCs, combined with fractured cristae. The bioenergetic tests revealed that accumulation of defective mitochondria induced by ketamine increased ROS generation and prevented energy production in the hippocampal NSCs. These findings suggested that the oxidative stress and energy supply disturbance induced by mitochondrial fusion dysfunction might be a critical mechanism of ketamine-induced disorder of NSC proliferation and differentiation during the neonatal period. In the future, we will continue to conduct in-depth research on these issues.

In rodents, the generation of granule neurons in the hippocampal DG begins during gestation, and most of them are produced postnatally with a peak during the first postnatal week [41, 42]. The newly generated granule neurons migrated into the granular cell layer (GCL), extended axons along the mossy fiber tract to the CA3 region and were finally incorporated into the hippocampal circuit (DG-CA3-CA1 loop) [43]. A recent study revealed that granule neurons generated at PND-6 displayed 15% cell death during adulthood [44]. The authors proposed that early postnatally generated granule neurons had a unique function in hippocampal plasticity and strengthened the ability to learn new things and to acquire new information. However, our findings showed that repeated ketamine anesthesia promoted hippocampal neuronal differentiation in PND-7 rats, but learning and memory dysfunction were still observed during the adult stage. These contradictory results indicated that the role of newly generated granule neurons in adult hippocampal function remains a matter of debate.

In the developing brain, many more neurons are created than are actually needed, and the selective removal of immature neurons that have not yet established synaptic connections is involved in the adaptive response to experience and regarded as critical for shaping functional neural networks [45]. A previous experiment reported that spatial learning promotes the survival of newborn neurons that are relatively more mature and induces the death of cells that are more immature [46]. Therefore, we speculated that the accelerated generation of immature neurons induced by neonatal ketamine exposure might not be beneficial to the formation of synaptic connections in adulthood. To verify our hypothesis, we used three methods to evaluate synaptic plasticity at 24 h after the behavior test: a) the morphology of neurons in the DG region was analyzed by Golgi-Cox staining, including dendrites and dendritic spines; b) the synaptic ultrastructure in the DG region, including the length of the synaptic active zone, PSD thickness and synaptic cleft, was detected by electron microscopy; and c) the synaptic function in the DG region was reflected by LTP. Our data showed that repeated neonatal ketamine exposure impaired the structure and function of synapses during the adult stage. The preconditioning of Mfn2 overexpression in hippocampal NSCs could reverse the long-term cognitive dysfunction induced by ketamine and restore the impaired synaptic plasticity. These results suggested that maintaining an optimum balance between neuronal differentiation and NSC proliferation during early postnatal hippocampal neurogenesis was beneficial to the survival of newborn immature neurons into adulthood. This procedure was essential for the formation of synaptic connections and hippocampus-dependent cognitive function.

There are still some limitations in this study. The mitochondrial dynamics of newly differentiated neurons induced by ketamine, the ultimate fate of these cells and how they are functionally incorporated into hippocampal neural circuits during the adult stage remain unclear. A previous study revealed that dysfunction of mitochondrial dynamics led to abnormalities in synaptic development, plasticity and function [47]. Mitochondria at synaptic terminals provide ATP to neurons and modulate synaptic connections; if mitochondria are unable to reach the signal exchange center during development, neuronal function will be impaired [34]. In our future study, we will elucidate the potential mechanism by which ketamine interferes with the synaptogenesis of newly differentiated neurons in the hippocampal DG from this perspective.

In conclusion, we proposed a model represented schematically in Fig. 11 based on the results of the current study. Mitochondrial fusion dysfunction mediated by Mfn2 downregulation plays a critical role in the ketamine-induced developmental neurogenic pathological process. These findings demonstrated that Mfn2 might be a novel therapeutic target for the prevention of the developmental neurotoxicity of ketamine. Our results will contribute to further understanding of the developmental neurotoxicity of anesthetic and the underlying mechanisms from the perspective of mitochondrial dynamics regulating neurogenesis.

Authors' contributions

Project conception: HH, YW, CZ, HZ

Study design: HH, YW, CZ, HZ

Performance of experiments: HH, NW, JL, YQ, WW, QL, CC,

Initial data collection and analysis: HW, YL, WD, JW

Final data analysis: HW, YL, WD, JW

Writing of paper: HH, YW, CZ, HZ

Funding

This work is supported by the National Natural Science Foundation of China (grant number: 82171191, 81971051 to YW, 81901100 to HH) and Jiangsu Province Special Program for Young Medical Talent (QNRC2016587 to HH).

Ethics approval The experimental protocol was approved by the Institutional Animal Care and Ethics Committee of Xuzhou Medical University and in accordance with the Guide for the Care and Use of Laboratory Animals of the National Research Council.

Consent to participate Not applicable.

Consent for Publication Yes.

Conflict of Interest The authors declared no conflict of interest.

Data availability For further inquiries on the original data of this study, the corresponding authors can be contacted directly.

Acknowledgements Not Applicable.

Jevtovic-Todorovic, V., et al., Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci, 2003. 23(3): p. 876-82.
Davidson, A.J., et al., Neurodevelopmental outcome at 2 years of age after general anaesthesia and awake-regional anaesthesia in infancy (GAS): an international multicentre, randomised controlled trial. Lancet, 2016. 387(10015): p. 239-50.
McCann, M.E., et al., Neurodevelopmental outcome at 5 years of age after general anaesthesia or awake-regional anaesthesia in infancy (GAS): an international, multicentre, randomised, controlled equivalence trial. Lancet, 2019. 393(10172): p. 664-677.
Lee, J.J., L.S. Sun, and R.J. Levy, Report on the Sixth Pediatric Anesthesia Neurodevelopmental Assessment (PANDA) Symposium, "Anesthesia and Neurodevelopment in Children". J Neurosurg Anesthesiol, 2019. 31(1): p. 103-107.
Warner, D.O., et al., Neuropsychological and Behavioral Outcomes after Exposure of Young Children to Procedures Requiring General Anesthesia: The Mayo Anesthesia Safety in Kids (MASK) Study. Anesthesiology, 2018. 129(1): p. 89-105.
Ikonomidou, C., et al., Blockade of NMDA receptors and apoptotic neurodegeneration in the developing brain. Science, 1999. 283(5398): p. 70-4.
Paule, M.G., et al., Ketamine anesthesia during the first week of life can cause long-lasting cognitive deficits in rhesus monkeys. Neurotoxicol Teratol, 2011. 33(2): p. 220-30.
Dong, C., C.R. Rovnaghi, and K.J. Anand, Ketamine exposure during embryogenesis inhibits cellular proliferation in rat fetal cortical neurogenic regions. Acta Anaesthesiol Scand, 2016. 60(5): p. 579-87.
Ito, H., T. Uchida, and K. Makita, Ketamine causes mitochondrial dysfunction in human induced pluripotent stem cell-derived neurons. PLoS One, 2015. 10(5): p. e0128445.
Fuentealba, L.C., et al., Embryonic Origin of Postnatal Neural Stem Cells. Cell, 2015. 161(7): p. 1644-55.
Bandeira, F., R. Lent, and S. Herculano-Houzel, Changing numbers of neuronal and non-neuronal cells underlie postnatal brain growth in the rat. Proc Natl Acad Sci U S A, 2009. 106(33): p. 14108-13.
Bartley, J., et al., BrdU-positive cells in the neonatal mouse hippocampus following hypoxic-ischemic brain injury. BMC Neurosci, 2005. 6: p. 15.
Belnoue, L., et al., Prenatal stress inhibits hippocampal neurogenesis but spares olfactory bulb neurogenesis. PLoS One, 2013. 8(8): p. e72972.
Porzionato, A., et al., Effects of postnatal hyperoxia exposure on the rat dentate gyrus and subventricular zone. Brain Struct Funct, 2015. 220(1): p. 229-47.
Huang, H., et al., Ketamine Affects the Neurogenesis of the Hippocampal Dentate Gyrus in 7-Day-Old Rats. Neurotox Res, 2016. 30(2): p. 185-98.
Westermann, B., Mitochondrial fusion and fission in cell life and death. Nat Rev Mol Cell Biol, 2010. 11(12): p. 872-84.
Chan, D.C., Mitochondrial fusion and fission in mammals. Annu Rev Cell Dev Biol, 2006. 22: p. 79-99.
Khacho, M., et al., Mitochondrial Dynamics Impacts Stem Cell Identity and Fate Decisions by Regulating a Nuclear Transcriptional Program. Cell Stem Cell, 2016. 19(2): p. 232-247.
Iwata, R., P. Casimir, and P. Vanderhaeghen, Mitochondrial dynamics in postmitotic cells regulate neurogenesis. Science, 2020. 369(6505): p. 858-862.
Huang, H., et al., Neonatal Anesthesia by Ketamine in Neonatal Rats Inhibits the Proliferation and Differentiation of Hippocampal Neural Stem Cells and Decreases Neurocognitive Function in Adulthood via Inhibition of the Notch1 Signaling Pathway. Mol Neurobiol, 2021. 58(12): p. 6272-6289.
Khazipov, R., et al., Atlas of the Postnatal Rat Brain in Stereotaxic Coordinates. Front Neuroanat, 2015. 9: p. 161.
Wan, J., et al., Repeated exposure to propofol in the neonatal period impairs hippocampal synaptic plasticity and the recognition function of rats in adulthood. Brain Res Bull, 2021. 169: p. 63-72.
Schmitz, A., et al., Sedation for magnetic resonance imaging using propofol with or without ketamine at induction in pediatrics-A prospective randomized double-blinded study. Paediatr Anaesth, 2018. 28(3): p. 264-274.
Zhang, Z., et al., Blockade of the NLRP3/caspase-1 axis attenuates ketamine-induced hippocampus pyroptosis and cognitive impairment in neonatal rats. J Neuroinflammation, 2021. 18(1): p. 239.
Andropoulos, D.B. and M.F. Greene, Anesthesia and Developing Brains - Implications of the FDA Warning. N Engl J Med, 2017. 376(10): p. 905-907.
Bayer, S.A., et al., Timetables of neurogenesis in the human brain based on experimentally determined patterns in the rat. Neurotoxicology, 1993. 14(1): p. 83-144.
Huang, J., et al., Propofol Administration During Early Postnatal Life Suppresses Hippocampal Neurogenesis. Mol Neurobiol, 2016. 53(2): p. 1031-1044.
Stratmann, G., et al., Isoflurane differentially affects neurogenesis and long-term neurocognitive function in 60-day-old and 7-day-old rats. Anesthesiology, 2009. 110(4): p. 834-48.
Fang, F., Z. Xue, and J. Cang, Sevoflurane exposure in 7-day-old rats affects neurogenesis, neurodegeneration and neurocognitive function. Neurosci Bull, 2012. 28(5): p. 499-508.
Tresse, E., et al., IFN-β rescues neurodegeneration by regulating mitochondrial fission via STAT5, PGAM5, and Drp1. Embo j, 2021. 40(11): p. e106868.
Dong, L., et al., Promotion of mitochondrial fusion protects against developmental PBDE-47 neurotoxicity by restoring mitochondrial homeostasis and suppressing excessive apoptosis. Theranostics, 2020. 10(3): p. 1245-1261.
Gebara, E., et al., Mitofusin-2 in the Nucleus Accumbens Regulates Anxiety and Depression-like Behaviors Through Mitochondrial and Neuronal Actions. Biol Psychiatry, 2021. 89(11): p. 1033-1044.
Coelho, P., et al., Mitochondrial function and dynamics in neural stem cells and neurogenesis: Implications for neurodegenerative diseases. Ageing Res Rev, 2022. 80: p. 101667.
Calkins, M.J., et al., Impaired mitochondrial biogenesis, defective axonal transport of mitochondria, abnormal mitochondrial dynamics and synaptic degeneration in a mouse model of Alzheimer's disease. Hum Mol Genet, 2011. 20(23): p. 4515-29.
Boscolo, A., et al., Early exposure to general anesthesia disturbs mitochondrial fission and fusion in the developing rat brain. Anesthesiology, 2013. 118(5): p. 1086-97.
Amrock, L.G., et al., Long-term effects of single or multiple neonatal sevoflurane exposures on rat hippocampal ultrastructure. Anesthesiology, 2015. 122(1): p. 87-95.
Liu, J., et al., Sevoflurane induced neurotoxicity in neonatal mice links to a GSK3beta/Drp1-dependent mitochondrial fission and apoptosis. Free Radic Biol Med, 2022. 181: p. 72-81.
Ozsoy, S., et al., Cannibalized erythroblasts accelerate developmental neurogenesis by regulating mitochondrial dynamics. Cell Rep, 2021. 35(1): p. 108942.
Channakkar, A.S., et al., MiRNA-137-mediated modulation of mitochondrial dynamics regulates human neural stem cell fate. Stem Cells, 2020. 38(5): p. 683-697.
Iwata, R. and Vanderhaeghen, P, Regulatory roles of mitochondria and metabolism in neurogenesis. Curr Opin Neurobiol, 2021. 69: p. 231-40.
Altman, J. and G.D. Das, Autoradiographic and histological evidence of postnatal hippocampal neurogenesis in rats. J Comp Neurol, 1965. 124(3): p. 319-35.
Kozareva, D.A., J.F. Cryan, and Y.M. Nolan, Born this way: Hippocampal neurogenesis across the lifespan. Aging Cell, 2019. 18(5): p. e13007.
van Praag, H., et al., Functional neurogenesis in the adult hippocampus. Nature, 2002. 415(6875): p. 1030-4.
Ciric, T., S.P. Cahill, and J.S. Snyder, Dentate gyrus neurons that are born at the peak of development, but not before or after, die in adulthood. Brain Behav, 2019. 9(10): p. e01435.
Olariu, A., et al., A natural form of learning can increase and decrease the survival of new neurons in the dentate gyrus. Hippocampus, 2005. 15(6): p. 750-62.
Dupret, D., et al., Spatial learning depends on both the addition and removal of new hippocampal neurons. PLoS Biol, 2007. 5(8): p. e214.
Gao, Q., et al., PINK1-mediated Drp1(S616) phosphorylation modulates synaptic development and plasticity via promoting mitochondrial fission. Signal Transduct Target Ther, 2022. 7(1): p. 103.

Table 1

mRNA	Sequences (5’-3’)	Product length (bp)
GAPDH	Forward: GACAACTTTGGCATCGTGGA	133
GAPDH	Reverse: ATGCAGGGATGATGTTCTGG	133
Mfn 2	Forward: GCATTTCCCAGTCTGCAGTAAA	132
Mfn 2	Reverse: CAAGACAATAAACCCGCTGCTC	132

SupplementaryMaterial.docx

Download PDF

Journal Publication

published 10 Jan, 2024

Read the published version in Molecular Neurobiology →

Reviewers agreed at journal
26 Jul, 2023
Reviewers invited by journal
26 Jul, 2023
Editor invited by journal
21 Jul, 2023
Editor assigned by journal
10 Jul, 2023
First submitted to journal
30 Jun, 2023

You are reading this latest preprint version

Repeated ketamine anesthesia during the neonatal period impairs hippocampal neurogenesis and long-term neurocognitive function by inhibiting Mfn2-mediated mitochondrial fusion in neural stem cells

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Meterials and Methods

2.1. Animal care

2.2. Ketamine anesthesia model

2.3. Primary NSC separation, culture and treatment

2.4. Analysis of mitochondrial ultrastructure in hippocampal NSCs

2.4.1. Immune Electron Microscopy

2.4.2. Transmission Electron Microscopy (TEM)

2.5. Mitochondrial function.

2.5.1. Detection of mitochondrial membrane potential in hippocampal NSCs

2.5.2. Analysis of ATP concentration in hippocampal NSCs

2.5.3. Measurement of reactive oxygen species (ROS) in hippocampal NSCs

2.6. Viral stereotaxic microinjection

2.7. NSC proliferation and differentiation assay

2.8. Golgi-Cox staining

2.9. Analysis of synapse ultrastructure

2.10. Multichannel field potential recording

2.11. Other methods

2.12. Data analysis

3. Results

4. Discussion

Declarations

References

Table

Supplementary Files

Status:

Journal Publication

Version 1