Atorvastatin improves intestinal mucositis induced by 5-fluorouracil in mice by modulating the and epithelial barrier and inflammatory signaling pathways

doi:10.21203/rs.3.rs-3121696/v1

Download PDF

Research Article

Atorvastatin improves intestinal mucositis induced by 5-fluorouracil in mice by modulating the and epithelial barrier and inflammatory signaling pathways

https://doi.org/10.21203/rs.3.rs-3121696/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Chemotherapy-induced intestinal mucositis is a major side effect of cancer treatment. Statins are 3-hydroxy-3-methyl glutaryl coenzyme reductase inhibitors used to treat hypercholesterolemia and atherosclerotic diseases. Recent studies have demonstrated that atorvastatin (ATV) has antioxidant, anti-inflammatory, and resulting from the regulation of different molecular pathways. In the present study, we investigated the effects of ATV on intestinal homeostasis in 5-fluorouracil (5-FU)-induced mucositis. Our results showed that ATV protected the intestinal mucosa from epithelial damage caused by 5-FU mainly due to inflammatory infiltrate and intestinal permeability reduction, downregulation of inflammatory markers, such as Tlr4, MyD88, NF-κB, Tnf-a, Il1β, and Il6 dose-dependent. ATV also improved epithelial barrier function by upregulating the mRNA transcript levels of mucin 2 (MUC2), and ZO-1 and occludin tight junction proteins. The results suggest that the ATV anti-inflammatory and protective effects on 5-FU-induced mice mucositis involve the inhibition of the TLR4/MYD88/NPRL3/NF-κB, iNos, and caspase 3 signaling pathways.

Chemotherapy

Mucositis

Intestinal damage

Atorvastatin

Drug Repositioning

Mevalonate pathway

Intestinal barrier

Modern anticancer therapies include a broad spectrum of antineoplastic agents and radiotherapy, which promote numerous biological effects in patients (1). Gastrointestinal mucositis is one of the most debilitating side effects of anticancer therapies (2). This condition causes inflammation and the loss of cells in the epithelial barrier, resulting in severe ulceration of the oral cavity and gastrointestinal tract (3).

Mucositis is an important source of morbidity, causing discomfort to the patient and requiring treatment interruptions, which can negatively influence prognosis and increase mortality (4, 5). Although mucositis has presented as an underreported condition, data available in the literature reveal that it occurs in 20–40% of patients receiving chemotherapy for solid tumors, 60–80% of those patients submitted to hematopoietic stem cell transplantation, and approximately 100% of patients who receive radiotherapy and chemotherapy for head and neck cancers (6, 7).

The treatment and management of mucositis are challenging, including pain control, nutritional support, prophylaxis, treatment of secondary infections, and pharmacological agents to reduce inflammation and diarrhea. Despite being important in controlling mucositis, these treatments vary widely according to the patient's clinical context and oncological treatment protocols (8, 9). In many cases, numerous differences in the proposed treatments generate conflicting results (10, 11).

Pharmacological repositioning is an alternative to accelerating drug approval while minimizing the costs and risks associated with new drug development programs (12). A significant advantage of this strategy is that several characteristics of these drugs, such as their pharmacokinetics, pharmacodynamics, and toxicity, are already well-known in animals and humans, bringing agility to clinical tests as new candidates can be ready for testing more quickly, and if approved by regulatory authorities, their integration into medical practice can be more agile (13, 14).

Statins are 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors and represent the most important drug class for patients with hypercholesterolemia. Several studies have reported significant cardiovascular morbidity and mortality reductions following long-term statin therapy (15). Although statins are suitable for lipid-lowering many non-lipid mechanisms, the pleiotropic properties [16] include anti-inflammatory, immunomodulatory, antioxidant, and direct anti-atherosclerotic actions, which can contribute to the health of consumers of this drug (16).

Numerous studies have demonstrated statins' efficacy in treating inflammatory bowel disease (IBD) (17–21). However, to our knowledge, no studies have investigated the atorvastatin (ATV) anti-inflammatory and protective role on intestinal epithelium in an experimental mucositis model. Thus, the present study aimed to evaluate an alternative therapy involving the pharmacological repositioning of ATV for the injury caused by 5-FU in the mouse intestinal epithelium.

2.1 Animals and Ethics Statement

Male 6 weeks-old BALB/c mice (weight 20–24 g) were obtained from the Federal University of Minas Gerais (UFMG, Belo Horizonte, Brazil). Mice were kept in cages under temperature (25 ± 2°C) and light/dark cycle (12h)-controlled room, with ad libitum access to water and standard chow (Nuvilab, Nuvital, Curitiba, PR). All animal procedures were carried out according to the standards of the Brazilian Society of Laboratory Animal Science/Brazilian College for Animal Experimentation (available at http://www.mctic.gov.br/concea). All procedures were approved by the Local Animal Experimentation Ethics Committee (CEUA-UFMG, Protocol number 266/2019).

2.2 Experimental design

Mice were randomized into six experimental groups (n = 6 animals per group): control (CT), Atorvastatin (ATV 10 mg/kg), Mucositis (MUC), mucositis and treated with atorvastatin (MUC + ATV 5, 10 and 30 mg/kg). The mucositis was induced by intraperitoneal (i.p.) administration of 5-FU (Fauldfluor® Libbs, São Paulo, Brazil) at a dose of 30 mg/kg/day for 5 days. 0.9% sterile saline solution was used as a control through the same route (31). Atorvastatin (MERCK and CO., Inc., Rahway, NJ, USA) was dissolved in a saline solution (NaCl 0.9%) and administrated by gavage at doses of 5, 10, and 30 mg/kg/day for 7 days. On the last day of the protocol, all animals were anesthetized with ketamine (80 mg/kg) and xylazine (16 mg/kg) solution (Agener União, Embu-Guaçu, Brazil). The small intestine was removed and measured, and ileum sections were collected for analysis.

2.3 Weight loss evaluation and diarrhea assessment

The food/liquid intake, body weight, and diarrhea score for each mouse were analyzed per day. The diarrhea severity was monitored and scored during the experimental period, as described by (32), as follows: 0 - normal (normal stool); 1 - mild (slightly wet and soft stool); 2 - moderate (wet and unformed stool with moderate perianal staining of the coat); and 3 - severe (watery stool with severe perianal staining of the coat).

2.4 Histopathologic and morphometric analysis

Tissue sections from the ileum were fixed in buffered 4% formaldehyde and processed for paraffin embedding. For each sample, at least two histological sections (4–5 µm) were stained with hematoxylin–eosin (HE) and periodic acid-Schiff (PAS), coded, and analyzed by a single pathologist who was unaware of the experimental conditions of each group. For morphometric analysis of the ileum, photographs were performed under a conventional light microscope at 20x magnification (Olympus–BX41 - Tokyo, Japan), and mucosal inflammation was assessed using histopathological scores (33). Villus length was measured from its base to its apex, and the data were expressed in micrometers using the ImageJ program (version 1.47f, Wayne Rasband/National Institutes of Health, USA - available online at http://rsbweb.nih.gov/ij/download.html). Goblet cells were counted in ten fields/slides. These analyses were also performed using ImageJ.

2.5 Intestinal permeability

On the last day of the protocol, all animals received 0.1 mL of diethylenetriaminepentaacetic acid labeled with technetium-99m (99mTc-DTPA, 13 MBq) by oral administration 4 h before the euthanasia. The blood was collected, weighed, and placed in appropriate tubes for radioactivity determination. Blood radioactivity levels were determined using an automatic gamma counter (Wizard 1480; PerkinElmer/Wallac, Turku/Finland). The data are expressed as % dose, using the following equation: % dose/g = cpm in g of blood/cpm of standard) × 100, where cpm represents the counts of radioactivity per minute (34).

2.6 Myeloperoxidase activity

The presence of neutrophils in tissues was assessed indirectly by determining myeloperoxidase (MPO) activity (35). Briefly, 100 mg of ileum tissue was homogenized in 1.9 mL of PBS and centrifuged at 12,000 g for 10 minutes. Then, the supernatants were discarded, and the samples were taken to the lysis process. Afterward, the samples were centrifuged, the supernatants discarded, and the pellet resuspended in in buffer. Subsequently, three cycles of freezing and thawing in liquid nitrogen were carried out. Finally, the samples were centrifuged, and the supernatants were collected for the enzyme assay. For this purpose, the substrate o-phenylenediamine (OPD) and H₂O₂ in Tris-HCl were used, and the reaction was stopped with H₂SO₄. The absorbance was read at 450 nm on a microplate spectrophotometer (Epoch, BioTek Instruments, Inc., Winooski, VT, USA), and the results were expressed as relative units.

2.7 Eosinophil peroxidase activity

The accumulation of eosinophils in the ileum was quantified by determining the eosinophil peroxidase (EPO) activity (36). Thus, 100 mg of tissue was homogenized in 1.9 mL of PBS and centrifuged at 10,000 g for 10 minutes. Then, the supernatant was removed, and the pellet was resuspended in 1.9 mL of 0.5% HTAB in PBS. Soon after, the samples were frozen in nitrogen liquid, thawed three times, and centrifuged at 4°C and 10,000 g for 10 minutes. Subsequently, 75 µL of supernatant was added to 75 µL of OPD diluted in Tris-HCl and H₂O₂ and incubated at 20°C for 30 minutes. The reaction was stopped by adding 50 µL H₂SO₄ at 1 M before being read in a spectrophotometer (Epoch) at 492 nm in a microplate. The results were expressed as relative units.

2.8 Intestinal secretory IgA (sIgA)

The ELISA method determined sIgA level in intestinal fluid (35). After animal euthanasia, the small intestine was removed by cutting at the gastroduodenal and ileocecal junctions. The contents were removed, weighed, and washed with PBS, pH 7.2, supplemented with protease inhibitors (1 µM aprotinin, 25 µM leupeptin, 1 µM pepstatin, and 1 mM PMSF) at a ratio of 2.0 mL of PBS for every 500 mg of content. After centrifuging at 5,000 g for 30 minutes at 4°C, the supernatant was collected and frozen at -80°C for further analysis. For sIgA determination, microplates coated with goat mouse anti-IgA antibodies were used (M-8769, Sigma, Saint Louis, MO, USA) for the detection of sIgA mouse anti-IgA peroxidase-conjugated antibody was used (A-4789, Sigma). Total sIgA concentration was determined using a purified IgA standard (0106-01, Southern Biotechnology Associates, Birmingham, AL, USA). Readings were taken at 492 nm in a microplate reader (Epoch), and the sIgA concentration was determined in µg/g of intestinal fluid.

2.9 Oxidative stress

Samples of the small intestine was removed, washed with PBS to remove the intestinal contents, and homogenized in ice-cold PBS (1mL for each 1g tissue). Tissue fragments were centrifuged at 12,000 g for 10 min at room temperature. The supernatant was collected and analyzed for lipid peroxidation by thiobarbituric acid reactive substances (TBARS), hydrogen peroxide concentration and SOD activity assays. All results were normalized using tissue protein concentration. Protein concentration was evaluated using the Lowry et al. method [34].

For evaluation of TBARS, were using the method as described by De Leon and Borges (33). Briefly, the assay involves the reaction of lipid peroxidation products; primarily malondialdehyde (MDA) with thiobarbituric acid (TBA) leads to the formation of TBARS, wich was measured spectrophotometrically at 530 nm. The hydroperoxide concentrations were measured by orange xylenol oxidation as previously described by Ewing et al. (34). The basic principle of this method is oxidation of ferrous ions by the sample oxidizing agents to ferric ions, which bind with xylenol orange to give a complex which was measured spectrophotometrically at 560 nm. Lastly, superoxide dismutase (SOD) activity was evaluated similar as described by Quintanilha et al. (35). Thus, for the activity calculation, it was considered that 1 unit (U) of SOD could prevent the auto-oxidation of 50% of pyrogallol of the standard, which was measured spectrophotometrically at 570 nm. After normalization by protein concentration in the small intestine, the result was expressed in units of SOD per milligram of protein.

2.10 Gene expression in mice ileum

Total RNA was extracted from 30 mg of ileum tissue, previously stored in 500 µL of RNA later solution (Invitrogen, Carlsbad, CA, USA) to preserve the samples, using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) in compliance with the manufacturer's guidelines. The RNA concentrations were determined spectrophotometrically using a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), considering absorbance ratios of 280/260 and 260/230 nm. The quality of RNA samples was evaluated in agarose electrophoresis gel (1.5%). The extracted RNA was treated for 15 min at room temperature with DNAse I (Invitrogen, Carlsbad, CA, USA). After that, the enzyme was deactivated (10 min 65°C with 25 mM EDTA). One microgram of total RNA was reverse transcribed using High-Capacity cDNA Reverse Transcription kit (Applied Biosystems™, ThermoFisher, Waltham, MA, USA) in compliance with its guidelines, forming complementary deoxyribonucleic acid (cDNA) using the following parameters: 25°C for 10 min, 37°C for 120 min, 85°C for 5 min.

Quantitative reverse transcription PCR (RT-qPCR) was performed using Applied Biosystems Power SYBR Green PCR master mix (Thermo Fisher, Waltham, MA, USA) and gene-specific primers for Toll-like receptor 4 (Tlr4), Myeloid differentiation primary response 88 (Myd88), nuclear factor-kappa B p105 subunit (Nf), nitric oxide synthase (iNos), NOD-like receptor family, pyrin domain containing 3 (Nlpr3), transforming growth factor beta-1 (Tgfb1) tumor necrosis factor (Tnf), interleukins b (Il1b), 6 (Il6), 10 (Il10), mucin 2 (Muc2), zonulin (Hp), and occludin (Ocln). Transcripts were all normalized using actin beta (Actb) and glyceraldehyde-3-phosphate dehydrogenase (Gapdh) (37) housekeeping genes (Table 1). The experimental approach was optimized by adjusting the primers' concentrations (5, 10, and 15 pmol) to test for optimal specificity and efficiency. The purity of PCR products was verified by melting curves and gel electrophoresis. The PCR cycle parameters were as follows: initial denaturation at 95°C for 10 min, 95°C for 15 s, annealing/extension at 60°C for 1 min, 40 cycles, and a dissociation stage for recording the melting curve. Results were shown graphically as fold changes in gene expression, using the means and standard deviations of target gene expression. Data were analyzed according to the relative expression using the 2–ΔΔCT method. Data are representative of two independent experiments.

Table 1

Quantitative Polymerase Chain Reaction (qPCR) primers used in this study
Gene	Primer Foward	Primer Reverse	Reference
Gapdh	TCACCACCATGGAGAAGGC	GCTAAGCAGTTGGTGGTGCA	Giulietti et al. (2001)
Tlr4	ATGGCATGGCTTACACCACC	GAGGCCATTTTTGTCTCCACA	Chang et al. (2020)
Myd88	ATCGCTGTTCTTGAACCCTCG	CTCACGGTCTAACAAGGCCAG	Chang et al. (2020)
Nfkb1 (p105)	GTGGAGGCATGTTCGGTAGTG	TCTTGGCACAATCTTTAGGGC	Zheng et al. (2017)
Il6	GAGGATACCACTCCCAACAGACC	AAGTGCATCATCGTTGTTCATACA	Giulietti et al. (2001)
Il10	GGTTGCCAAGCCTTATCGGA	ACCTGCTCCACTGCCTTGCT	Giulietti et al. (2001)
Tnf	ACGTGGAACTGGCAGAAGAG	CTCCTCCACTTGGTGGTTTG	Song et al. (2013)
Il1b	CTCCATGAGCTTTGTACAAGG	TGCTGATGTACCAGTTGGGG	Song et al. (2013)
Muc2	GATGGCACCTACCTCGTTGT	GTCCTGGCACTTGTTGGAAT	Volynets et al. (2016)
Occludin	ACTCCTCCAATGGACAAGTG	CCCCACCTGTCGTGTAGTCT	Volynets et al. (2016)
Zonulin	CCACCTCTGTCCAGCTCTTC	CACCGGAGTGATGGTTTTCT	Volynets et al. (2016)
iNos2	CAGCTGGGCTGTACAAACCTT	CATTGGAAGTGAAGCGTTTCG	Giulietti et al. (2001)
Caspase 3	CGTGGTTCATCCAGTCCCTTT	ATTCCGTTGCCACCTTCCTC	Benli et al., 2021

2.11 Statistical analysis

Statistical analyses were performed using GraphPad Prism 8.0 software (GraphPad, Inc., La Jolla, CA, USA). The data were assessed for normality of distribution by using the Shapiro-Wilk test. Data that assumed normal distribution were tested by analysis of ANOVA followed by a Newman-Keuls multiple comparison test. Nonparametric data were analyzed by the Kruskal-Wallis test, followed by Dunn's multiple comparisons. A Mann-Whitney test compared food and liquid intake before and after 5-FU-inflammation induction. The results were expressed as means, standard errors, medians, and interquartile ranges. A significant difference was defined as P < 0.05.

3.1 Atorvastatin reduces diarrhea but does not prevent weight loss

Daily administration of 5-FU caused a significant decrease in food (Fig. 1c) and water consumption (Fig. 1d), loss of body weight, and small intestine length reduction in all groups compared to both the control (CT) and ATV groups. An exception was observed with ATV 30 mg/kg, prevented the shortening of the intestine (p < 0.05; Fig. 1b).

The diarrhea scores of the mice were recorded daily, and the results of all groups were compared (Fig. 1e). No diarrhea was observed in either the CT or ATV groups. However, repeated administration of 5-FU to the animals caused the onset of diarrhea on day four of the experiment. The lowest diarrhea score was obtained in the group ATV, and 10 mg/kg delayed the onset of diarrhea and generated lower scores (p < 0.05).

3.2 Atorvastatin reduces myeloperoxidase and eosinophil peroxidase enzyme activity

The recruitment of inflammatory cells to the intestinal mucosa is a common characteristic of 5-FU-inflammation induction. This study assessed the presence of ileal neutrophil and eosinophil infiltrates by detecting myeloperoxidase (MPO) and eosinophil peroxidase (EPO) enzyme activities, respectively. The 5-FU group showed a high level of MPO (0.424 ± 0.183 AU/mg; Fig. 2a) and EPO (0.078 ± 0.030 AU/mg; Fig. 2b) activity when compared to CT group (0.090 ± 0.046; 0.078 ± 0.0309 AU/mg; p < 0.0001). However, there was a significant reduction in neutrophil (MPO) and eosinophil (EPO) enzyme activity after ATV administration, where the ATV 30 mg/kg group showed physiological levels of MPO (0.109 ± 0.036 AU/mg) similar to those of the CT group (p > 0.05; Fig. 2a).

Figure 2c shows that 5-FU treatment induced a significant reduction (p < 0.01) in the sIgA levels present in the small intestinal fluid (MUC) compared with the CT group. The results also showed that several treatment modalities (5, 10, and 30 mg/kg) did not recover the sIgA physiological levels (p > 0.05).

3.3 Histopathological analysis

Histopathological analysis showed that the MUC group had significant alterations in mucosal integrity, such as villus shortening, crypt necrosis, and intense inflammatory cell infiltration in the lamina propria, compared to the CT group (Fig. 3a). Treatment with ATV improved the damage to the intestinal mucosa induced by 5-FU, with the significant restoration of the mucosal architecture. Villus height (Fig. 3b), crypt depth preservation (Fig. 3c), and villus height-to-crypt depth ratio increased (Fig. 3d). Figure 3e shows that the animals in the mucositis group presented higher scores, whereas the ATV treatments improved the scores (p > 0.05).

3.4 Atorvastatin prevents 5-FU-induced intestinal permeability and increases and upregulates tight junction protein gene expression but does not reduce the oxidative stress in the small intestine

Intestinal permeability was evaluated after oral administration (13 MBq) of 99mTc-DTPA, and 4 h after gavage, blood was collected for radioactivity determination (Fig. 4a). As expected, the intestinal permeability of the MUC group increased (0.404 ± 0.066%) when compared to that of the CT group (0.031 ± 0.021%; p < 0.001). In contrast, all animals that received ATV treatment (5, 10, and 10 mg/kg) showed reduced intestinal permeability.

Since paracellular permeability is linked to tight junction (TJ) protein interactions, ZO-1 and occludin gene expression were also investigated. The ZO-1 and occludin outcomes showed that inflammation caused by 5-FU administration promoted increased mRNA expression of both. It was also observed that ATV at 5 and 30 mg/kg exhibited higher ZO-1 levels (Fig. 4b). In contrast, all ATV treatments significantly increased occludin expression (Fig. 4c). Therefore, these results suggest that the upregulation of these proteins under intestinal epithelial inflammation may have a protective effect, mainly after ATV administration.

Regarding lipid peroxidation, the concentration of hydroperoxides (Fig. 5a), TBARS (Fig. 5b), and antioxidant enzymes superoxide dismutase (SOD; Fig. 5c) and glutathione peroxidase (Fig. 5d) in the small intestine and ileum of all groups were similar (p > 0.05).

3.5 Inflammatory markers gene expression

Mice in the group MUC exhibited a significant increase in the mRNA gene expression of all proinflammatory cytokines (Il6, Il1b and Tnf) investigated compared to the CT group (Fig. 6a, 6b, and 6c, p < 0.05). In contrast, animals that received ATV treatment showed downregulation of these cytokines, reaching physiological levels (p < 0.05). The outcomes did not show statistically significant differences among the MUC groups with or without ATV treatment (Fig. 6d, p > 0.05). Regarding TGβ mRNA expression, the results showed a significant increase for all investigated groups 5-FU treated, except for CTL and ATV groups (Fig. 6e, p < 0.05).

3.6 Atorvastatin modulates gene expression of TLR4/MYD88/iNos/NPRL3/NF-κB and the caspase signaling pathway

Mice in the MUC group showed significantly increased mRNA gene expression of Tlr4, Myd88, iNos, NPRL3, and Nfkb1 (Fig. 7a, 7b, 7c, 7d, and 7e, p < 0,05) when compared to both the CT and ATV groups. The results also showed that 30 mg ATV reduced the expression of all these genes (p < 0.05). Regarding caspase 3 mRNA expression, the results showed a significant increase in the MUC group (Fig. 7f, p < 0.05) compared to the CT and ATV groups. All doses of treatment reduced caspase 3 mRNA expression (Fig. 7f) in the CT and ATV groups (p < 0.05).

3.7 Atorvastatin reduces 5-FU-induced goblet cell injury

A significant reduction in goblet cell number was also observed in the 5-FU-treated ileum-inflamed mice (9.44 ± 4.90 cell/field) compared to that in the CT group (85.56 ± 9.180 cell/field; p < 0.05). All doses of ATV treatment reduced the loss of goblet cells (p < 0.05; Fig. 8c). Furthermore, Muc2 gene expression was significantly increased in the 5-FU group; however, the groups treated with ATV showed no differences in Muc2 gene expression compared to that of the MUC group (p > 0.05; Fig. 8b.

Mucositis is a gastrointestinal inflammation affecting patients' quality of life undergoing malignancies treatment (3). Currently, the standard therapies available for preventing and treating the disease are not very effective; therefore, new options have been suggested. Drug repositioning/repurposing is a concept that uses existing FDA drugs to treat different disorders; this saves time and money and allows direct entry into clinical trials, as they have already undergone toxicity and safety profiling (38).

ATV is a third-generation synthetic HMG-CoA reductase inhibitor (39). By inhibiting HMG-CoA reductase, mevalonate synthesis is reduced, and consequently, several other isoprenoid pathways, critical post-translational modifiers, are affected. With mechanisms independent of their cholesterol-lowering effects, they are called pleiotropic effects, defined as multiple side effects of a compound. ATV's most important pleiotropic effects are its anti-inflammatory, antioxidant, and immunomodulatory activities (16, 40, 41).

The inflammation and loss of the epithelial barrier of the digestive tract characterize mucositis; this leads to mucosal lesions and ulcerations throughout the gastrointestinal tract (42). Body weight loss may be related to malabsorption due to intestinal lesions, resulting in loss of the intestinal absorptive surface (43). In our study, the inflamed mice exhibited extensive weight loss, directly correlated with the water and feed intake reduction observed during the experimental protocol. Intestinal shortening was also observed. However, the ATV treatment did not significantly improve these outcomes. Similarly, Medeiros and co-workers (44) did not observe a reduction in body mass loss following simvastatin treatment in a 5-FU-induced mucositis model.

Diarrhea assessment through a score application for the clinical profiles of the animals showed that the onset of diarrhea occurred within 72 h of 5-FU administration, with the most severe episodes of diarrhea occurring on days six and seven of the experimental protocol. Consistent with these findings, Huang et al. (31), who used the same experimental protocol, also observed a peak of diarrhea after day five (45). Treatment with 10 mg/kg ATV in this study reduced the scores and delayed the onset of diarrhea. Similarly, other studies using rosuvastatin, simvastatin, and ATV in colitis models have demonstrated a reduction in the disease activity index (22, 46, 47).

Histological analysis of the ileum showed that animals with 5-FU-induced mucositis had tissue damage, shortening of the villi, reduction of crypts, and inflammatory infiltrates in the lamina propria, submucosal, and muscle layers. ATV treatment improved the structural integrity of ileal mucosa, indicating its beneficial role in inflammation. Similar results were found in other studies that assessed the activity of statins in mucositis and colitis, demonstrating an enteroprotective role for the gastrointestinal mucosa (25, 44, 48, 49).

Intestinal permeability increases after chemotherapy and is one of the hallmarks of the third and fourth stages of mucositis (3), and it is considered to increase when the permeation of molecules is larger than 150 Da (50). In this study, intestinal permeability was assessed by monitoring the radioactivity of the blood after oral administration of 99mTc-DTPA. This compound is a disodium complex with a molecular weight of 549 Da and a half-life of 6 h, presenting ideal intestinal permeability monitoring characteristics. Other studies conducted by our research group showed increased intestinal permeability after administering 5-FU (51–53). Our results showed that ATV treatment significantly reduced intestinal permeability in inflamed animals, and we believe that these results are directly correlated with the positive regulation of TJs and the anti-inflammatory action of ATV.

Studies have shown decreased crucial TJ proteins, such as ZO-1, in mucositis (54, 55). Additionally, its depletion corresponds to an increase in intestinal permeability and a decrease in transepithelial resistance. In our results, the expression of TJ proteins increased in the MUC group, as observed by Chang et al. (56). The effects of chemotherapy drugs, such as 5-FU, on the intestinal epithelial barrier through the expression of TJ proteins are inconsistently reported; this can be attributed to differences in the regimens, experimental protocols, or animal models used (57, 58). Furthermore, intestinal mucosa renewal occurs every 3–4 days, and new intestinal cells are formed after injecting 5-FU-overexpressed ZO-1 to compensate for intestinal barrier disruption (59). We believe that the fractional mucositis induction model can also pressure the cell renewal process by stimulating the overexpression of ZO-1, a cytoplasmic scaffold protein that can be degraded or redistributed under inflammatory conditions (60). Ferreira et al. (59) also found data similar to ours, showing increased ZO-1 expression in inflamed animals. ZO-1 is a TJ protein that interacts with occludin, ZO-2, ZO-3, and actin, reducing intestinal permeability and inducing cell differentiation. The increased expression of these proteins indicates greater tissue repair after the damage induced by 5-FU. Our results showed that the inflamed animals treated with ATV overexpressed ZO-1 and occludin. Other studies on models of inflammatory bowel disease (22, 61) demonstrated that treatment with ATV and pravastatin reduced permeability and increased TJ expression. The literature indicates that ATV has activity on Rho kinase (ROCK), a serine-threonine kinase that plays an essential role in regulating epithelial barrier function; ROCK mediates actomyosin contraction, resulting in TJ reorganization (62, 63). Statins have an inhibitory effect on the ROCK pathway because the inhibition of cholesterol biosynthesis blocks the formation of isoprenoid intermediates, which are essential for the isoprenylation of Rho GTPases such as Rho and Rac (64, 65). Isoprenylation is a critical step in the intracellular trafficking and activation of Rho GTPases (66). The altered RhoA function suppresses ROCK signaling and reduces permeability (67).

MPO and EPO enzymes were evaluated in the ileum to determine neutrophil and eosinophil influx [66] indirectly. We observed that animals that received 5-FU showed a significant increase in the activity of these enzymes, which is consistent with the results of other studies (34, 51, 52). ATV treatment strongly modulated the activities of MPO and EPO in inflamed animals. Studies have shown that statins strongly suppress MPO gene expression, reducing MPO mRNA levels by 20-200-fold in monocyte macrophages and bone marrow precursors (68). This suppressive effect has been observed with natural and synthetic statins, including simvastatin, ATV, pravastatin, and lovastatin, and is related to the inhibition of the mevalonate-dependent isoprenylation of small GTP-binding proteins (69, 70). Regarding the activity of statins on EPO, studies have shown that statins reduce eosinophil migration into inflamed tissue, which also explains the reduction in EPO in our results (71).

IgA is the primary antibody found in mucosal secretions and acts as the first line of defense, protecting against microorganisms, neutralizing pathogenic bacteria, and controlling commensals in the small intestine (72, 73). Gut-associated lymphoid tissue (GALT) is considered the center of mucosal immunity because of its mass and function, and large amounts of sIgA are produced (74). In mucositis, sIgA plays a central role, as this immunoglobulin is an essential contributor to homeostasis, promoting anti-inflammatory responses on mucosal surfaces (75). We investigated the role of sIgA in regulating inflammatory conditions in mice with mucositis and treated them with ATV. Our results showed that there was suppression of this immunoglobulin in animals that received 5-FU, and none of the ATV concentrations used in this study altered the production of IgA.

Contrary to our results, many reports from our research group indicate an increase in sIgA levels in the small intestine of inflamed groups (51, 76). This event is related to the body's physiological response to maintain intestinal homeostasis following the loss of mucosal integrity caused by inflammation (77); this may be associated with the extensive destruction by 5-FU lymphocytes responsible for the production of IgA in GALT. Literature indicates that a small dose of 5-FU (10 mg/kg) can substantially reduce the number of effector lymphocytes in GALT, promoting a reduction in intestinal and respiratory IgA levels (78).

In the present study, the inflamed animals in the MUC group had overexpression of TLR4/MYD8 and NF-κB. TLR4 activation inducedYD88 dependent and independent pathways as a key adapter molecule essential for intracellular signaling that triggers the NF-κB activation cascade (79). Our results indicated a substantially reduced TLR4/MYD88 and NF-κB expression in the ATV groups at all doses. These results corroborate those of other studies demonstrating the negative regulation of these genes by ATV (80, 81). The role of ATV in TLR4 suppression is through mevalonate inhibition blocking lipid rafts, essential for TLR4 signaling resulting in inhibition of MYD88 and NF-κB (82–84). Our results also demonstrate a dose-dependent inhibitory effect of ATV on NLRP3 inflammasomes in inflamed animals. Studies indicate that NLRP3 suppression can also be mediated by suppression of the TLR4/MyD88/NF-κB pathway (85).

The expression of proinflammatory cytokines, such as IL6, IL1β, and TNF-α, in the small intestine of rodents after chemotherapy significantly increases; this cytokine plays a critical role in the genesis and development of intestinal mucositis after 5-FU administration. After dosage, the MUC animals showed a significant increase in proinflammatory cytokines TNF-α, IL6, and IL1β. In contrast, ATV-treated groups showed downregulation of IL6, IL1β, and TNF-α expression. These results are in line with reports by Medeiros et al. (2011), Aktunc et al. (2011), and Rashidian et al. (2016), in which ATV decreased IL6, ILβ, and TNF-α levels in animal models of oral mucositis and colitis. Activation of NF-κB promotes the secretion of inflammatory cytokines, and the inhibitory effect on cytokine production may be related to the suppression of NF-kb (19, 20, 86, 87).

TGFβ1 and IL10 were analyzed as anti-inflammatory cytokines. In contrast, ATV did not increase the expression of the anti-inflammatory cytokine IL10. Our findings corroborate the results of Perucha et al. (2019), who demonstrated that the disturbance of the cholesterol biosynthesis pathway induces specific inhibition of IL10 expression (88). In evaluating the TGFβ1 cytokine, our results show that the transcript levels were upregulated after 5-FU administration and, curiously, were maintained even with the administration of ATV. TGFβ1 is an abundant cytokine in the intestinal mucosa with pleiotropic effects and anti-inflammatory or proinflammatory properties depending on the environmental context of the mucosa. In mucositis, TGFβ1 increases, affecting several biological processes, including fibrosis, wound healing, and immune responses (89). Our results do not correlate with what is typically found in the literature, which points to the negative regulation of TGFβ1 by statins through RhoA/ROCK inhibition, which activates the Smad pathway (90, 91). Among the possible hypotheses for this scenario, the literature indicates that the negative regulation of TGF-β1 is correlated with the reduction of the cytokine IL10, in which TGFβ1 levels remain increased as a compensatory anti-inflammatory mechanism to control tissue damage and restore intestinal homeostasis disrupted by chemotherapy with 5-FU (55, 92).

iNOS expression and nitric oxide (NO) production are associated with intestinal inflammation. The results demonstrated that 5-FU stimulated iNOS gene expression and ATV dose-dependently reduced iNOS expression in inflamed animals. Our data correlate with previous studies that indicated the inhibition of iNOS expression by fluvastatin in colitis models (93). The literature indicates that inhibiting Rho isoprenylation by statins can modulate NO levels by negatively regulating iNOS expression (94, 95).

Chemotherapy with 5-FU activates intestinal cell apoptotic mechanisms, with caspase 3 being the main effector of apoptotic pathways. We observed increased caspase 3 expressions in animals treated with 5-FU, and all ATV doses reduced caspase 3 expressions. The literature also supports these results with a model of colitis induced by DSS and oxazolone presented by Shin et al. (2017) and El-Mahdy et al. (2020), who observed a reduction in caspase 3, highlighting the essential anti-apoptotic activity of statins (96, 97).

The overproduction of reactive oxygen species is one of the primary mediators of chemotherapy-induced tissue damage (98, 99). Studies have reported that statins can reduce oxidative stress through some pathways, including the direct elimination of radicals, effects on inflammatory cells, the activity of iNOS, the activity of endogenous antioxidants, inhibition of hepatic cytochrome P450, and reduced oxLDL uptake by scavenger receptors (41). To assess the antioxidant role of ATV in the mucositis model, we measured MDA, hydroperoxide, SOD, and glutathione peroxidase in the ileum. Surprisingly, our results showed no differences between the inflamed and ATV-treated animals Gadino et al. and Leocadio et al. (100, 101), who also evaluated oxidative stress in the ileum in a 5-FU-induced mucositis model, obtained similar results, highlighting that an increase in lipid peroxidation occurred between 24 h and 48 h after mucositis induction, and there were no differences after 72 h of mucositis (102). In our study, the animals were euthanized 120 h after the first dose of 5-FU and 24 h after the last dose, which may explain these results.

Goblet cells synthesize and secrete mucins, constituting the protective mucous layer lining the epithelial surface. Previous studies reported that chemotherapy could damage goblet cells, resulting in decreased mucin production and exposing the epithelium to damage from bacterial degradation and harmful agents in the lumen (103). We observed a decrease in the number of goblet cells in the intestinal mucosal epithelium of 5-FU-treated mice and a reduction in the size and color intensity of these cells. ATV treatment increases the number of goblet cells. Our data corroborate those of Soliman et al., who observed the restoration of the intestinal epithelium and regeneration of intestinal crypts after treating colitis with simvastatin (104). Mucins are high-molecular-weight acidic glycoproteins secreted by goblet cells, and MUC2 is part of the structural secretory gel-forming subfamilies and is the main product of goblet cells in the colon and small intestine. Mucin loss occurs during mucositis and can increase mucosal damage by decreasing mucosal barrier protection (105). Gene expression corresponding to MUC2 was notably increased in animals with mucositis and groups treated with ATV. These data diverge from those reported in the literature, in which MUC2 expression was reduced in mucositis (106). Torpe et al. evaluated MUC2 expression in a model of irinotecan-induced mucositis and did not observe increased gene expression of such proteins within 120 h. The authors suggested that rapid exocytosis of mucins by goblet cells may contribute to a decrease in MUC2 levels. Based on this hypothesis, we believe that the increase in MUC2 expression in our model was due to the depletion of mucin stores that pressured the induction of MUC2 expression to maintain clinically viable mucin levels (107), as well as the influence of proinflammatory cytokines on the upregulation of transcription and translation of MUC2 genes (108). The RhoA/p35 pathway highly regulates MUC2nd and is isoprenylated by statins (109).

In summary, our results demonstrate that ATV is effective against intestinal mucositis induced by 5-FU in mice. The potential mechanisms to attenuate the inflammatory response include protecting the intestinal mucosal barrier and reducing inflammation in a dose dependent. ATV increases the expression of ZO-1 and occludin and suppresses EPO, MPO, and intestinal permeability. ATV inhibited the expression of proinflammatory mediators mediated by blocking the activation of TLR4/MyD88/NF-κB, NLRP3, iNOS, IL6, IL1β, and TNF-α. It was also observed that ATV improved the architecture of the small intestinal mucosa, delayed diarrhea and anti-apoptotic activity, and increased MUC expression and goblet cell number.

Conceptualization: Kátia Duarte Vital, Flaviano Santos Martins; Valbert Nascimento Cardoso; Simone Odília Antunes Fernandes; Methodology: Luiz Octavio Pires,Bruno Gallotti; Janayne Luihan Silva; Luís Cláudio Lima de Jesus; Ênio Ferreira; Formal analysis and investigation: Kátia Duarte Vital, Luís Cláudio Lima de Jesus, Bruno Gallotti; Janayne Luihan Silva; Jacqueline Alvarez-Leite Writing-original draft preparation: Kátia Duarte Vital; Writing-review and editing: Simone Odília Antunes Fernandes, Valbert Nascimento Cardoso, Enio Ferreira, Flaviano Santos Martins, Jacqueline Alvarez-Leite and Vasco Azevedo; Supervision: Simone Odília Antunes Fernandes; Funding acquisition: Simone Odília Antunes Fernandes, Valbert Nascimento Cardoso, Flaviano Santos Martins, and Vasco Azevedo.

All authors read and approved the final manuscript.

Funding: The authors would like to acknowledge the Pró-Reitoria de Pesquisa - Universidade Federal de Minas Gerais, Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq); Simone Odília Antunes Fernandes is supported by a grant from Fundação de Amparo à Pesquisa do Estado de Minas Gerais - FAPEMIG (Minas Gerais Network for Translational Research in Immunobiologicals and Biopharmaceuticals in Cancer - REMITRIBIC, RED-00031-21, APQ-00056-18, and APQ-00593-14). Kátia Duarte Vital is grateful to Coordenação de Aperfeiçoamento de Pessoal do Nível Superior (CAPES) for a Ph.D. fellowship.

Conflicts of Interest: The authors declare no conflict of interest.

Consent for Publication: All authors consent to the publication of this article.

Data Availability: The current study's data are available from the corresponding author upon reasonable request.

Ethics Approval: The study was conducted according to the guidelines of the Brazilian College of Animal Experimentation (COBEA) and approved by the Local Animal Experimental Ethics Committee (CEUA-UFMG) (Protocol n º 266/2019).

Al-Ansari S, Zecha JAEM, Barasch A, de Lange J, Rozema FR, Raber-Durlacher JE. Oral Mucositis Induced By Anticancer Therapies. Curr Oral Health Rep. 2015 Dec 19;2(4):202–11.
Villa A, Sonis ST. Mucositis: pathobiology and management. Curr Opin Oncol. 2015;27(3):159–64.
Sonis ST. Pathobiology of mucositis. Semin Oncol Nurs. 2004;20(1):11–5.
Cinausero M, Aprile G, Ermacora P, Basile D, Vitale MG, Fanotto V, et al. New frontiers in the pathobiology and treatment of cancer regimen-related mucosal injury. Front Pharmacol. 2017;8(JUN):1–16.
Raber-Durlacher JE, Elad S, Barasch A. Oral mucositis. Oral Oncol. 2010 Jun 1;46(6):452–456.
Mortensen HR, Overgaard J, Specht L, Overgaard M, Johansen J, Evensen JF, et al. Prevalence and peak incidence of acute and late normal tissue morbidity in the DAHANCA 6&7 randomised trial with accelerated radiotherapy for head and neck cancer. Radiotherapy and Oncology. 2012;103(1):69–75.
Çakmak S, Nural N. Incidence of and risk factors for development of oral mucositis in outpatients undergoing cancer chemotherapy. Int J Nurs Pract. 2019 Feb 1;25(1).
Van Sebille YZA, Stansborough R, Wardill HR, Bateman E, Gibson RJ, Keefe DM. Management of Mucositis During Chemotherapy: From Pathophysiology to Pragmatic Therapeutics. Vol. 17, Current Oncology Reports. Current Medicine Group LLC 1; 2015. p. 1–8.
Shankar A, Roy S, Bhandari M, Rath GK, Biswas AS, Kanodia R, et al. Current trends in management of oral mucositis in cancer treatment. Vol. 18, Asian Pacific Journal of Cancer Prevention. Asian Pacific Organization for Cancer Prevention; 2017. p. 2019–26.
Sonis ST. Treatment for Oral Mucositis—Current Options and an Update of Small Molecules Under Development. Current Treatment Options in Oncology 2021 22:3. 2021 Feb 17;22(3):1–14.
Villa A, Sonis ST. An update on pharmacotherapies in active development for the management of cancer regimen-associated oral mucositis. Vol. 21, Expert Opinion on Pharmacotherapy. Taylor and Francis Ltd; 2020. p. 541–8.
Ashburn TT, Thor KB. Drug repositioning: Identifying and developing new uses for existing drugs. Vol. 3, Nature Reviews Drug Discovery. Nature Publishing Group; 2004. p. 673–83.
Bertolini F, Sukhatme VP, Bouche G. Drug repurposing in oncology—patient and health systems opportunities. Nature Reviews Clinical Oncology 2015 12:12. 2015 Oct 20;12(12):732–42.
Armando RG, Gómez DLM, Gomez DE. New drugs are not enough-drug repositioning in oncology: An update. Int J Oncol. 2020 Mar 1;56(3):651–84.
Zhang Q, Dong J, Yu Z. Pleiotropic use of Statins as non-lipid-lowering drugs. Int J Biol Sci. 2020;16(14):2704.
Kavalipati N, Shah J, Ramakrishan A, Vasnawala H. Pleiotropic effects of statins. Indian J Endocrinol Metab. 2015 Sep 1;19(5):554–62.
Vital KD, Cardoso BG, Lima IP, Campos AB, Teixeira BF, Pires LO, et al. Therapeutic effects and the impact of statins in the prevention of ulcerative colitis in preclinical models: A systematic review. Fundam Clin Pharmacol. 2023 Jun 22;37(3):493–507.
Medeiros A da C, Azevedo ÍM, Lima ML, Araújo Filho I, Moreira MD. Efeitos da sinvastatina na mucosite gastrointestinal induzida por 5-fluorouracil em ratos. Rev Col Bras Cir. 2018 Oct 18;45(5).
Medeiros CACX, Leitão RFC, Macedo RN, Barboza DRMM, Gomes AS, Nogueira NAP, et al. Effect of atorvastatin on 5-fluorouracil-induced experimental oral mucositis. Cancer Chemother Pharmacol. 2011 May 27;67(5):1085–100.
Rashidian A, Muhammadnejad A, Dehpour AR, Mehr SE, Akhavan MM, Shirkoohi R, et al. Atorvastatin attenuates TNBS-induced rat colitis: the involvement of the TLR4/NF-kB signaling pathway. Inflammopharmacology. 2016 Jun 2;24(2–3):109–18.
Ungaro R, Chang HL, Cote-Daigneaut J, Mehandru S, Atreja A, Colombel JF. Statins Associated With Decreased Risk of New Onset Inflammatory Bowel Disease. American Journal of Gastroenterology. 2016 Oct;111(10):1416–23.
El-Mahdy NA, El‐Sayad ME, El‐Kadem AH, Abu‐Risha SE. Targeting IL‐10, ZO‐1 gene expression and IL‐6/STAT‐3 trans‐signaling by a combination of atorvastatin and mesalazine to enhance anti‐inflammatory effects and attenuates progression of oxazolone‐induced colitis. Fundam Clin Pharmacol. 2020 Jun 24;fcp.12563.
Wang S, Xie X, Lei T, Zhang K, Lai B, Zhang Z, et al. Statins Attenuate Activation of the NLRP3 Inflammasome by Oxidized LDL or TNFa in Vascular Endothelial Cells through a PXR-Dependent Mechanism s. Mol Pharmacol. 2017 Sep 1;92(3):256–64.
Soliman NA, Keshk WA, Rizk FH, Ibrahim MA. The possible ameliorative effect of simvastatin versus sulfasalazine on acetic acid induced ulcerative colitis in adult rats. Chem Biol Interact. 2019 Jan 25;298:57–65.
Rashidian A, Muhammadnejad A, Dehpour AR, Mehr SE, Akhavan MM, Shirkoohi R, et al. Atorvastatin attenuates TNBS-induced rat colitis: the involvement of the TLR4/NF-kB signaling pathway. Inflammopharmacology. 2016 Jun 1;24(2–3):109–18.
Lochhead P, Khalili H, Sachs MC, Chan AT, Olén O, Ludvigsson JF. Association between statin use and inflammatory bowel diseases: Results from a Swedish, nationwide, population-based case-control study. J Crohns Colitis. 2020;
Ungaro R, Chang HL, Cote-Daigneaut J, Mehandru S, Atreja A, Colombel JF. Statins Associated With Decreased Risk of New Onset Inflammatory Bowel Disease. American Journal of Gastroenterology. 2016 Oct 1;111(10):1416–23.
Azevedo ÍM, Kumakura HS, Alloufa SL, Mourão TS, Souza PM, Carvalho MDF, et al. Effect of simvastatin in attenuation of mucositis induced by methotrexate in rats. journal of surgical and clinical research,. 2010;1(1):22–32.
Medeiros CACX, Leitão · R F C, Macedo · R N, Barboza · D R M M, Gomes · A S, Nogueira NAP, et al. EVect of atorvastatin on 5-Xuorouracil-induced experimental oral mucositis. Cancer Chemother Pharmacol. 2011;67:1085–100.
Huang TY, Chu HC, Lin YL, Ho WH, Hou HS, Chao YC, et al. Minocycline attenuates 5-fluorouracil-induced small intestinal mucositis in mouse model. Biochem Biophys Res Commun. 2009 Nov 27;389(4):634–9.
Kurita A, Kado S, Kaneda N, Onoue M, Hashimoto S, Yokokura T. Modified irinotecan hydrochloride (CPT-11) administration schedule improves induction of delayed-onset diarrhea in rats. Cancer Chemother Pharmacol. 2000;46(3):211–20.
Soares PMG, Mota JMSC, Gomes AS, Oliveira RB, Assreuy AMS, Brito GAC, et al. Gastrointestinal dysmotility in 5-fluorouracil-induced intestinal mucositis outlasts inflammatory process resolution. Cancer Chemother Pharmacol. 2008 Dec;63(1):91–8.
de Barros PAV, Rabelo Andrade ME, de Vasconcelos Generoso S, Mendes Miranda SE, dos Reis DC, Lacerda Leocádio PC, et al. Conjugated linoleic acid prevents damage caused by intestinal mucositis induced by 5-fluorouracil in an experimental model. Biomedicine and Pharmacotherapy. 2018 Jul 1;103:1567–76.
Coutinho JOPA, Quintanilha MF, Campos MRA, Ferreira E, de Menezes GCA, Rosa LH, et al. Antarctic Strain of Rhodotorula mucilaginosa UFMGCB 18,377 Attenuates Mucositis Induced by 5-Fluorouracil in Mice. Probiotics and Antimicrobial Proteins 2021. 2021 Jul 13;1:1–15.
Strath M, Warren DJ, Sanderson CJ. Detection of eosinophils using an eosinophil peroxidase assay. Its use as an assay for eosinophil differentiation factors. J Immunol Methods. 1985 Nov;83(2):209–15.
Giulietti A, Overbergh L, Valckx D, Decallonne B, Bouillon R, Mathieu C. An Overview of Real-Time Quantitative PCR: Applications to Quantify Cytokine Gene Expression. Methods. 2001 Dec 1;25(4):386–401.
Kirtonia A, Gala K, Fernandes SG, Pandya G, Pandey AK, Sethi G, et al. Repurposing of drugs: An attractive pharmacological strategy for cancer therapeutics. Semin Cancer Biol. 2021 Jan 1;68:258–78.
Plosker GL, Lyseng-Williamson KA. Atorvastatin. Pharmacoeconomics. 2007;25(12):1031–53.
Liao JK, Laufs U. PLEIOTROPIC EFFECTS OF STATINS. Annu Rev Pharmacol Toxicol. 2005 Sep 22;45(1):89–118.
Bełtowski J. Statins and modulation of oxidative stress. Vol. 15, Toxicology Mechanisms and Methods. Taylor & Francis; 2005. p. 61–92.
Sougiannis AT, VanderVeen BN, Davis JM, Fan D, Murphy EA. Understanding chemotherapy-induced intestinal mucositis and strategies to improve gut resilience. Am J Physiol Gastrointest Liver Physiol. 2021;320(5):G712–9.
Oliveira MMB, de Araújo AA, Ribeiro SB, de Sales Mota PCM, Marques VB, da Silva Martins Rebouças C, et al. Losartan improves intestinal mucositis induced by 5-fluorouracil in mice. Scientific Reports 2021 11:1. 2021 Dec 1;11(1):1–12.
Medeiros A da C, Azevedo ÍM, Lima ML, Filho IA, Moreira MD. Effects of simvastatin on 5-fluorouracil-induced gastrointestinal mucositis in rats. Rev Col Bras Cir. 2018;45(5).
Lee CS, Ryan EJ, Doherty GA. Gastro-intestinal toxicity of chemotherapeutics in colorectal cancer: The role of inflammation. World J Gastroenterol. 2014;20(14):3751–61.
Zhang X, Deng QH, Deng JH, Wang SJ, Chen Q. Lovastatin derivative dehydrolovastatin ameliorates ulcerative colitis in mice by suppressing NF-κB and inflammatory cytokine expression. Korean Journal of Physiology and Pharmacology. 2020 Mar 1;24(2):137–47.
Manna MJ, Al-Karagoli ES, Shakir Fadhil Z. Effect of acute Atorvastatin treatment in an experimental model of colitis Production and Hosted by. International Journal of Research in Pharmaceutical Sciences. 2018;10(2):1527–34.
Aktunc E, Kayhan B, Arasli M, Gun BD, Barut F. The effect of atorvastatin and its role on systemic cytokine network in treatment of acute experimental colitis. Immunopharmacol Immunotoxicol. 2011 Dec;33(4):667–75.
Park HJ, Tae •, Kim W, Jae •, Seo N. Effect of Atorvastatin, a HMG-CoA Reductase Inhibitor, in Experimental Colitis in Mice. Vol. 38, The Korean Journal of Pathology. The Korean Society of Pathologists and the Korean Society for Cytopathology; 2004.
Viele CS. Overview of Chemotherapy-Induced Diarrhea. Semin Oncol Nurs. 2003 Nov 1;19(SUPPL. 3):2–5.
Barroso FAL, Jesus LCL de, Castro CP de, Batista VL, Ferreira Ê, Fernandes RS, et al. Intake of Lactobacillus delbrueckii (pExu:hsp65) Prevents the Inflammation and the Disorganization of the Intestinal Mucosa in a Mouse Model of Mucositis. Microorganisms 2021, Vol 9, Page 107. 2021 Jan 5;9(1):107.
De Jesus LCL, Drumond MM, de Carvalho A, Santos SS, Martins FS, Ferreira Ê, et al. Protective effect of Lactobacillus delbrueckii subsp. Lactis CIDCA 133 in a model of 5 Fluorouracil-Induced intestinal mucositis. J Funct Foods. 2019 Feb 1;53:197–207.
Galdino FMP, Andrade MER, Barros PAV de, Generoso S de V, Alvarez-Leite JI, Almeida-Leite CM de, et al. Pretreatment and treatment with fructo-oligosaccharides attenuate intestinal mucositis induced by 5-FU in mice. J Funct Foods. 2018 Oct;49:485–92.
Andrade MER, Trindade LM, Leocádio PCL, Leite JIA, dos Reis DC, Cassali GD, et al. Association of Fructo-oligosaccharides and Arginine Improves Severity of Mucositis and Modulate the Intestinal Microbiota. Probiotics Antimicrob Proteins. 2023 Apr 12;15(2):424–40.
Batista VL, De Jesus LCL, Tavares LM, Barroso FLA, Fernandes LJ da S, Freitas A dos S, et al. Paraprobiotics and Postbiotics of Lactobacillus delbrueckii CIDCA 133 Mitigate 5-FU-Induced Intestinal Inflammation. Microorganisms. 2022 Jul 14;10(7):1418.
Chang CW, Lee HC, Li LH, Chiau JSC, Wang TE, Chuang WH, et al. Fecal Microbiota Transplantation Prevents Intestinal Injury, Upregulation of Toll-Like Receptors, and 5-Fluorouracil/Oxaliplatin-Induced Toxicity in Colorectal Cancer. International Journal of Molecular Sciences 2020, Vol 21, Page 386. 2020 Jan 8;21(2):386.
Wardill HR, Bowen JM. Chemotherapy-induced mucosal barrier dysfunction: An updated review on the role of intestinal tight junctions. Curr Opin Support Palliat Care. 2013 Jun;7(2):155–61.
Capaldo CT, Powell DN, Kalman D. Layered defense: how mucus and tight junctions seal the intestinal barrier. J Mol Med. 2017 Sep 1;95(9):927–34.
Ferreira TM, Leonel AJ, Melo MA, Santos RRG, Car DC, Cardoso VN, et al. Oral Supplementation of Butyrate Reduces Mucositis and Intestinal Permeability Associated with 5-Fluorouracil Administration. Lipids. 2012 Jul 1;47(7):669–78.
Li HL, Lu L, Wang XS, Qin LY, Wang P, Qiu SP, et al. Alteration of gut microbiota and inflammatory cytokine/chemokine profiles in 5-fluorouracil induced intestinal mucositis. Front Cell Infect Microbiol. 2017 Oct 26;7(OCT):455.
Sasaki M, Bharwani S, Jordan P, Joh T, Manas K, Warren A, et al. The 3-hydroxy-3-methylglutaryl-CoA reductase inhibitor pravastatin reduces disease activity and inflammation in dextran-sulfate induced colitis. Journal of Pharmacology and Experimental Therapeutics. 2003 Apr 1;305(1):78–85.
Wang CY, Liu PY, Liao JK. Pleiotropic effects of statin therapy: molecular mechanisms and clinical results. Vol. 14, Trends in Molecular Medicine. Elsevier Current Trends; 2008. p. 37–44.
Leung T, Chen XQ, Manser E, Lim L. The p160 RhoA-binding kinase ROK alpha is a member of a kinase family and is involved in the reorganization of the cytoskeleton. Mol Cell Biol. 1996 Oct 1;16(10):5313–27.
Zhou T, Zhou S hua, Qi S shan, Shen X qian, Zeng G feng, Zhou H nian. The effect of atorvastatin on serum myeloperoxidase and CRP levels in patients with acute coronary syndrome. Clinica Chimica Acta. 2006 Jun;368(1–2):168–72.
Liang GH, Weber CR. Molecular aspects of tight junction barrier function. Curr Opin Pharmacol. 2014 Dec;19:84–9.
Zhou Q, Liao JK. Statins and Cardiovascular Diseases: From Cholesterol Lowering to Pleiotropy. Curr Pharm Des. 2009 Jan 30;15(5):467–78.
Sarkar K, Sinha AK, Mehta JL. The role of statins in endothelial dysfunction in hypertension. Curr Opin Cardiol. 2006 Jul;21(4):316–21.
Kumar AP, Reynolds WF. Statins downregulate myeloperoxidase gene expression in macrophages. Biochem Biophys Res Commun. 2005 Jun 3;331(2):442–51.
Andreou I, Tousoulis D, Miliou A, Tentolouris C, Zisimos K, Gounari P, et al. Effects of rosuvastatin on myeloperoxidase levels in patients with chronic heart failure: A randomized placebo-controlled study. Atherosclerosis. 2010 May 1;210(1):194–8.
Zhou T, Zhou S hua, Qi S shan, Shen X qian, Zeng G feng, Zhou H nian. The effect of atorvastatin on serum myeloperoxidase and CRP levels in patients with acute coronary syndrome. Clinica Chimica Acta. 2006 Jun 1;368(1–2):168–72.
Liou CJ, Cheng PY, Huang WC, Chan CC, Chen MC, Kuo ML, et al. Oral Lovastatin Attenuates Airway Inflammation and Mucus Secretion in Ovalbumin-Induced Murine Model of Asthma. Allergy Asthma Immunol Res. 2014 Aug 19;6(6):548–57.
Corthésy B. Role of secretory IgA in infection and maintenance of homeostasis. Vol. 12, Autoimmunity Reviews. Elsevier; 2013. p. 661–5.
Wells JM, Brummer RJ, Derrien M, MacDonald TT, Troost F, Cani PD, et al. Homeostasis of the gut barrier and potential biomarkers. Vol. 312, American Journal of Physiology - Gastrointestinal and Liver Physiology. American Physiological Society; 2017. p. G171–93.
Nagayoshi H, Fukatsu K, Ueno C, Hara E, Maeshima Y, Omata J, et al. 5-Fluorouracil infusion reduces gut-associated lymphoid tissue cell number and mucosal immunoglobulin a levels. Journal of Parenteral and Enteral Nutrition. 2005 Nov;29(6):395–400.
Ren W, Wang K, Yin J, Chen S, Liu G, Tan B, et al. Glutamine-Induced Secretion of Intestinal Secretory Immunoglobulin A: A Mechanistic Perspective. Front Immunol. 2016 Nov 24;7(NOV):503.
Carvalho PLA, Andrade MER, Trindade LM, Leocádio PCL, Alvarez-Leite JI, dos Reis DC, et al. Prophylactic and therapeutic supplementation using fructo-oligosaccharide improves the intestinal homeostasis after mucositis induced by 5- fluorouracil. Biomedicine & Pharmacotherapy. 2021 Jan 1;133:111012.
Schmucker DL, Owen RL, Outenreath R, Thoreux K. Basis for the Age-related Decline in Intestinal Mucosal Immunity. Clin Dev Immunol. 2003 Jun;10(2–4):167–72.
Nagayoshi H, Fukatsu K, Ueno C, Hara E, Maeshima Y, Omata J, et al. 5-Fluorouracil Infusion Reduces Gut-Associated Lymphoid Tissue Cell Number and Mucosal Immunoglobulin A Levels. Journal of Parenteral and Enteral Nutrition. 2005 Nov 5;29(6):395–400.
Wong DVT, Lima-Júnior RCP, Carvalho CBM, Borges VF, Wanderley CWS, Bem AXC, et al. The Adaptor Protein Myd88 Is a Key Signaling Molecule in the Pathogenesis of Irinotecan-Induced Intestinal Mucositis. PLoS One. 2015 Oct 6;10(10):e0139985.
Rashidian A, Muhammadnejad A, Dehpour AR, Mehr SE, Akhavan MM, Shirkoohi R, et al. Atorvastatin attenuates TNBS-induced rat colitis: the involvement of the TLR4/NF-kB signaling pathway. Inflammopharmacology. 2016 Jun 2;24(2–3):109–18.
Yue R, Zuo C, Zeng J, Su B, Tao Y, Huang S, et al. Atorvastatin attenuates experimental contrast-induced acute kidney injury: a role for TLR4/MyD88 signaling pathway. Ren Fail. 2017 Jan 1;39(1):643–51.
Parsamanesh N, Moossavi M, Bahrami A, Fereidouni M, Barreto G, Sahebkar A. NLRP3 inflammasome as a treatment target in atherosclerosis: A focus on statin therapy. Int Immunopharmacol. 2019 Aug;73:146–55.
Parsamanesh N, Moossavi M, Bahrami A, Fereidouni M, Barreto G, Sahebkar A. NLRP3 inflammasome as a treatment target in atherosclerosis: A focus on statin therapy. Int Immunopharmacol. 2019 Aug;73:146–55.
Fessler MB, Parks JS. Intracellular Lipid Flux and Membrane Microdomains as Organizing Principles in Inflammatory Cell Signaling. The Journal of Immunology. 2011 Aug 15;187(4):1529–35.
Kong F, Ye B, Lin L, Cai X, Huang W, Huang Z. Atorvastatin suppresses NLRP3 inflammasome activation via TLR4/MyD88/NF-κB signaling in PMA-stimulated THP-1 monocytes. Biomedicine & Pharmacotherapy. 2016 Aug;82:167–72.
Aktunc E, Kayhan B, Arasli M, Gun BD, Barut F. The effect of atorvastatin and its role on systemic cytokine network in treatment of acute experimental colitis. Immunopharmacol Immunotoxicol. 2011 Dec;33(4):667–75.
El-Mahdy NA, El‐Sayad ME, El‐Kadem AH, Abu‐Risha SE. Targeting IL‐10, ZO‐1 gene expression and IL‐6/STAT‐3 trans‐signaling by a combination of atorvastatin and mesalazine to enhance anti‐inflammatory effects and attenuates progression of oxazolone‐induced colitis. Fundam Clin Pharmacol. 2021 Feb 24;35(1):143–55.
Perucha E, Melchiotti R, Bibby JA, Wu W, Frederiksen KS, Roberts CA, et al. The cholesterol biosynthesis pathway regulates IL-10 expression in human Th1 cells. Nat Commun. 2019 Jan 30;10(1):498.
Li MO, Wan YY, Sanjabi S, Robertson AKL, Flavell RA. TRANSFORMING GROWTH FACTOR-β REGULATION OF IMMUNE RESPONSES. Annu Rev Immunol. 2006 Apr 1;24(1):99–146.
Abe Y, Murano M, Murano N, Morita E, Inoue T, Kawakami K, et al. Simvastatin Attenuates Intestinal Fibrosis Independent of the Anti-Inflammatory Effect by Promoting Fibroblast/Myofibroblast Apoptosis in the Regeneration/Healing Process from TNBS-Induced Colitis. Dig Dis Sci. 2012 Feb 11;57(2):335–44.
Wei YH, Liao SL, Wang SH, Wang CC, Yang CH. Simvastatin and ROCK Inhibitor Y-27632 Inhibit Myofibroblast Differentiation of Graves’ Ophthalmopathy-Derived Orbital Fibroblasts via RhoA-Mediated ERK and p38 Signaling Pathways. Front Endocrinol (Lausanne). 2021 Feb 1;11.
Gomes-Santos AC, Oliveira RP de, Moreira TG, Castro-Junior AB, Horta BC, Lemos L, et al. Hsp65-Producing Lactococcus lactis Prevents Inflammatory Intestinal Disease in Mice by IL-10- and TLR2-Dependent Pathways. Front Immunol. 2017 Jan 30;8.
Oishi M, Tokuhara K, Miki H, Tanaka Y, Yamaki S, Kaibori M, et al. Temporal and Spatial Dependence of Inflammatory Biomarkers and Suppression by Fluvastatin in Dextran Sodium Sulfate-Induced Rat Colitis Model. Dig Dis Sci. 2014 Sep 30;59(9):2126–35.
Kotamraju S, Willams CL, Kalyanaraman B. Statin-Induced Breast Cancer Cell Death: Role of Inducible Nitric Oxide and Arginase-Dependent Pathways. Cancer Res. 2007 Aug 1;67(15):7386–94.
Wei CY, Huang KC, Chou YH, Hsieh PF, Lin KH, Lin WW. The Role of Rho-Associated Kinase in Differential Regulation by Statins of Interleukin-1β- and Lipopolysaccharide-Mediated Nuclear Factor κB Activation and Inducible Nitric-Oxide Synthase Gene Expression in Vascular Smooth Muscle Cells. Mol Pharmacol. 2006 Mar;69(3):960–7.
El-Mahdy NA, El‐Sayad ME, El‐Kadem AH, Abu‐Risha SE. Targeting IL‐10, ZO‐1 gene expression and IL‐6/STAT‐3 trans‐signaling by a combination of atorvastatin and mesalazine to enhance anti‐inflammatory effects and attenuates progression of oxazolone‐induced colitis. Fundam Clin Pharmacol. 2021 Feb 24;35(1):143–55.
Shin SK, Cho JH, Kim EJ, Kim EK, Park DK, Kwon KA, et al. Anti-inflammatory and anti-apoptotic effects of rosuvastatin by regulation of oxidative stress in a dextran sulfate sodium-induced colitis model. World J Gastroenterol. 2017;23(25):4559.
Logan RM, Stringer AM, Bowen JM, Gibson RJ, Sonis ST, Keefe DMK. Is the pathobiology of chemotherapy-induced alimentary tract mucositis influenced by the type of mucotoxic drug administered? Cancer Chemotherapy and Pharmacology 2008 63:2. 2008 Mar 20;63(2):239–51.
Yan X xia, Li H long, Zhang Y ting, Wu S yan, Lu H lei, Yu X lu, et al. A new recombinant MS-superoxide dismutase alleviates 5-fluorouracil-induced intestinal mucositis in mice. Acta Pharmacologica Sinica 2019 41:3. 2019 Sep 10;41(3):348–57.
Galdino FMP, Andrade MER, Barros PAV de, Generoso S de V, Alvarez-Leite JI, Almeida-Leite CM de, et al. Pretreatment and treatment with fructo-oligosaccharides attenuate intestinal mucositis induced by 5-FU in mice. J Funct Foods. 2018 Oct 1;49:485–92.
Leocádio PCL, Antunes MM, Teixeira LG, Leonel AJ, Alvarez-Leite JI, Machado DCC, et al. L-arginine pretreatment reduces intestinal mucositis as induced by 5-FU in mice. Nutr Cancer. 2015 Apr 3;67(3):486–93.
Maeda T, Miyazono Y, Ito K, Hamada K, Sekine S, Horie T. Oxidative stress and enhanced paracellular permeability in the small intestine of methotrexate-treated rats. Cancer Chemotherapy and Pharmacology 2009 65:6. 2009 Sep 16;65(6):1117–23.
Stringer AM, Gibson RJ, Logan RM, Bowen JM, Yeoh ASJ, Hamilton J, et al. Gastrointestinal Microflora and Mucins May Play a Critical Role in the Development of 5-Fluorouracil-Induced Gastrointestinal Mucositis. Exp Biol Med. 2009 Apr 1;234(4):430–41.
Soliman N, Keshk WA, Rizk FH, Ibrahim MA. The possible ameliorative effect of simvastatin versus sulfasalazine on acetic acid induced ulcerative colitis in adult rats. Chem Biol Interact. 2019 Jan;298:57–65.
Thorpe D. The role of mucins in mucositis. Curr Opin Support Palliat Care. 2019 Jun;13(2):114–8.
De Jesus LCL, Drumond MM, de Carvalho A, Santos SS, Martins FS, Ferreira Ê, et al. Protective effect of Lactobacillus delbrueckii subsp. Lactis CIDCA 133 in a model of 5 Fluorouracil-Induced intestinal mucositis. J Funct Foods. 2019 Feb;53:197–207.
Thorpe D, Sultani M, Stringer A. Irinotecan induces enterocyte cell death and changes to muc2 and muc4 composition during mucositis in a tumour-bearing DA rat model. Cancer Chemother Pharmacol. 2019 May 27;83(5):893–904.
Bradbury P, Traini D, Ammit AJ, Young PM, Ong HX. Repurposing of statins via inhalation to treat lung inflammatory conditions. Adv Drug Deliv Rev. 2018 Aug;133:93–106.
Lora JM, Zhang DM, Liao SM, Burwell T, King AM, Barker PA, et al. Tumor Necrosis Factor-α Triggers Mucus Production in Airway Epithelium through an IκB Kinase β-dependent Mechanism. Journal of Biological Chemistry. 2005 Oct;280(43):36510–7.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Atorvastatin improves intestinal mucositis induced by 5-fluorouracil in mice by modulating the and epithelial barrier and inflammatory signaling pathways

Status:

Version 1

Abstract

Figures

1 Introduction

2 Materials and Methods

2.1 Animals and Ethics Statement

2.2 Experimental design

2.3 Weight loss evaluation and diarrhea assessment

2.4 Histopathologic and morphometric analysis

2.5 Intestinal permeability

2.6 Myeloperoxidase activity

2.7 Eosinophil peroxidase activity

2.8 Intestinal secretory IgA (sIgA)

2.9 Oxidative stress

2.10 Gene expression in mice ileum

2.11 Statistical analysis

3 Results

3.1 Atorvastatin reduces diarrhea but does not prevent weight loss

3.2 Atorvastatin reduces myeloperoxidase and eosinophil peroxidase enzyme activity

3.3 Histopathological analysis

3.4 Atorvastatin prevents 5-FU-induced intestinal permeability and increases and upregulates tight junction protein gene expression but does not reduce the oxidative stress in the small intestine

3.5 Inflammatory markers gene expression

3.6 Atorvastatin modulates gene expression of TLR4/MYD88/iNos/NPRL3/NF-κB and the caspase signaling pathway

3.7 Atorvastatin reduces 5-FU-induced goblet cell injury

4 Discussion

5 Conclusion

Declarations

References

Additional Declarations

Status:

Version 1