STMN2/NF-κB axis drives tumor growth in thyroid carcinoma

doi:10.21203/rs.3.rs-3124413/v1

Download PDF

Research Article

STMN2/NF-κB axis drives tumor growth in thyroid carcinoma

https://doi.org/10.21203/rs.3.rs-3124413/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Backgrounds: Stathmin 2 (STMN2) is involved in microtubule dynamics and signal transduction. Highly expressed STMN2 has been reported in various tumors. And yet its role in Thyroid carcinoma (THCA) remained unexplored.

Methods: The expressed status of STMN2 in pan-cancer including THCA was evaluated using the TCGA and GETx dataset. Furthermore, the association of STMN2 with the clinical phenotypes was visualized based on TCGA-THCA clinical samples. Gene set enrichment analysis (GESA) was used to enrich STMN2-related signaling pathways. The THCA cell proliferation were examined when STMN2 overexpression or knockout. In vivo assays were undertaken to verify the impact of STMN2 knockout on THCA tumor growth. Luciferase reporter assays were conducted to determine whether STMN2 exerted its role through NF-κB signaling pathway.

Results: STMN2 expression levels were differentiated in different cancers. We found that STMN2 was richly expressed in THCA patient-derived specimens based on bioinformatics anlaysis. Functionally, STMN2 enforced expression hastened the THCA cell proliferation, while CRISPR-cas9 depletion of STMN2 retarded tumorigenesis in vitro and in vivo. Mechanically, highly expressed STMN2 increased NF-κB transcriptional activity as well as accumulated IκBa expression in THCA cells, while STMN2 knockout presented an opposite phenomenon. However, PDTC exposure almost abrogated the increased IκBa expression in STMN2-overexpressing THCA cells.

Conclusion: we found STMN2 is an oncogenic driver of THCA by activating NF-κB signaling pathway, potentially paving an alternative avenue for THCA management.

thyroid cancer

NF-κB

proliferation

STMN2

Thyroid carcinoma (THCA) is a lethal neoplasm of the endocrine system, originating from thyroid follicular epithelial cells^{1, 2}. Its global incidences rank the ninth in 2021, accounting for about 590,000 cases^{3, 4}. The individuals suffering from THCA experience painless progressive mass enlargement⁵. Tremendous advancements in modalities, such as the sensitive application of ultrasonography, enable THCA patients to have favorable clinical outcome⁶. The 5-year survival rate of THCA patients overall is about 98.1%⁷. However, in the last three years, the THCA epidemic continues to increase⁸. Furthermore, THCA patients at the advanced stage display an unsatisfactory prognosis, the 5-year survival rate is not more than 56%⁹. Therefore, this cryptic clinical presentation results in overdiagnosis and subsequent unfavorable prognosis¹⁰. There is amplified urgency and need to better understand its aetiopathological mechanism for THCA intervention.

Stathmin 2 (STMN2) is a member of the stathmin family of phosphoproteins, which plays a regulatory role in microtubule dynamics and signal transduction^11–13. STMN2 was initially discovered as a microtubule regulator actively participating trafficking of neurotransmitter receptors, its aberrance causes neurodegeneration and Alzheime's disorder^{11, 14, 15}. Already in 2006, Lee et al unearthed that STMN2 is frequently amplified and highly expressed in hematoma cancer with Wnt-dependent expression pattern¹⁶. Furthermore, the oncogenic TGFβ signaling driven by STMN2 also confers a mesenchymal phenotype in hepatocellular carcinoma¹⁷. Yang et al revealed the predominant upregulation of STMN2 in ovarian cancer and highlights its poor prognostic potential¹². Furthermore, highly expressed STMN2 is predicted to be tightly associated with taxane sensitivity in lung adenocarcinoma¹⁸. However, its role in THCA is undisclosed.

Herein, we evaluated the expression of STMN2 in THCA by TCGA and GETx database. Subsequent function assays were conducted to examine the influence of STMN2 on THCA growth in vitro and in vivo. Finally, the mechanisms behind the STMN2’s role during THCA malignancy were investigated.

Cell culture

Human THCA cell lines TPC-1 and CAL-62 were commercially obtained from the Cell Storage Center of Wuhan University (Wuhan, China). TPC-1 cells (RPMI-1640 medium, ThermoFisher, USA) and CAL-62 (DMEM, ThermoFisher, USA) were kept at 37℃ with 5% CO2. Both mediums were supplemented with 10% FBS and 1% penicillin-streptomycin.

Constructs and transfection

To enforce expression of STMN2 in TPC-1 cells, the cDNA fragment of STMN2 was inserted into pcDNA3.1-3xFlag (Promega, USA) and was transfected into 293T cells for amplification. Subsequently, TPC-1 cells were transfected with different doses of recombinant STMN2-flag vectors by calcium phosphate transfection (ThermoFisher, USA). The successful overexpression of STMN2 was validated by western blots.

For depletion of STMN2 in TPC-1 and CAL-62 cells, two sgRNAs on STMN2 exon 1 and exon 2 were designed on http://crispr.mit.edu and ligated into lentiviral CRISPR/Cas9 vectors (Addgene, USA). sgRNA1:5’AACGACTTCAAAACTGCGAT AGG3’. sgRNA2: 5’CTGCTTGAACCATTCGAATT TGG3’. The resultant Lenti-CRISPR/Cas9-STMN2 sgRNAs (Knockout1: KO1; Knockout2:KO2) were packaged in 293T cells with packaging plasmids. 48h postinfection, the virus production was treated using a 0.22 µm Filter Unit and pellet viral particles were collected for the infection of TPC-1 and CAL-62 with Lipofectamine 3000 (Thermo Fisher Scientific, USA) at 5 × 10⁸ transducing units. The infected THCA cells were screened with puromycin for 10 days. The cellular survival in puromycin was further validated by western blot.

CCK8 assay

After 24h, 48h, and 72 h cultivation, THCA cells (5 × 10³ cell/well) on 96-well plates were exposed to a 10 µL CCK8 reagent (Dojindo, Japan). 2h later, the plates were monitored by a microplate reader at 450 nm.

Colony formation assay

THCA cells (500 cells/well) on 12-well plates were cultivated for 14 days and inoculated with 10% crystal violet for 30min after fixation in alcohol. Cell colonies larger than 500 cells were quantified and plotted.

Dual-luciferase reporter assay

NF-κB luciferase reporter plasmids (Yeason, China) with with TCF/LEF-luciferase, a control luciferase were cotransfected with TPC-1 293T cells with STMN2-flag vectors or transfected into STMN2-deficient TPC-1 cells. 48h later, NF-κB-driven luciferase transcription was monitored on the luciferase reporter system (Promega, USA).

Western blots

Cell protein from THCA cells were isolated using RIPA lysis buffer (Beyotine, China). And then the protein samples were loaded and loaded on 12% SDS-PAGE. The gels were electritransferred onto PVDF membranes and treated with a 5% solution of skim milk at room temperature. 1h later, the proteins on membranes were detected using primary antibodies at 4°C and following exposed to the secondary antibodies for 1h at room temperature. Ultrasensitive ECL Kit (Shanghai Yeze Biotech Co.Ltd., Shanghai, China) was applied to visualize the immuneblots. The antibodies were listed as below: anti-flag antibodies (Cat#:K200001M, 1:1000, Solarbio, China), anti-GAPDH antibodies (Cat#K200057M,1:10000, Solarbio, China), anti-STMN2 antibodies (Cat#110733P,1:10000,Solarbio, China), anti-IkBa antibodies (Cat#K101551P,1:10000,Solarbio, China), and anti-mouse HRP secondary antibody (Cat#31430,1:0000, Invitrogen, USA), anti-goat HRP secondary antibody (Cat#31402, 1:10000,Invitrogen).

Xenograft mice model

12 nude mice (aged 5–7 weeks, weighing about 20g) were purchased from the the Experimental Animal Center of Wuhan University (Wuhan, China). The protocol was approved by the Animal Care Committee of Fujian Medical University, China. After 7-day acclimatization to the housing and feeding conditions, mice were allowed subcutaneous administration with STMN2-deficient CAL-62 cells (KO-1) or its parental cells. After a 28-day monitor, the mice underwent CO2 asphyxiation per the protocol and the tumor weight was recorded and plotted. The protocol was approved by the ethical committee of local hospital, China.

Data analysis

The TCGA pan-cancer database and GETx normal database were used to analyze the expression of STMN2 in pan-cancer via the R programming language. The differential expression of STMN2 in TCGA- pan-cancer tumors and normal tissues was also detected through the R programming language. The prognostic significance in the TCGA-THCA cohort was also plotted by the R package “survival.” The clinical phenotype data was retrieved from the TCGA-THCA cohort. The limma and ggpubr packages were undertaken to explore the correlation of STMN2 expression with clinical phenotypes of THCA patients. Additionally, R package edgeR 3.0.8 was used to analyze the Differential expression genes (DEGs) from the TCGA-THCA cohort. The DEG cutoff was set at a |log2 fold change| ≥ 1 and a false discovery rate < 5%. Gene set enrichment analysis (GESA) was used to identification of the STMN2-mediated molecular pathways.

Statistical analysis

The in vitro and in vivo assays were analyzed via Graphpad 8.0 software (GraphPad, USA). For two-group comparisons, an unpaired or paired Student t-test was applied, One-way ANOVA analysis was done to examine the difference amongy multiple groups. Pearson’s chi-square test was conducted to determine the association among DEGs. P < 0.05 was considered significant.

Upregulation of STMN2 in TCHA

We firstly carried out a series of bioinformatics analyses on the implication of SMTN2 in THCA progression. Compared to that in unpaired TCGA + GETx normal tissues, highly expressed STMN2 was observed in CHOL(Cholangiocarcinoma), KIRC (Kidney renal clear cell carcinoma), PCPG (Pheochromocytoma and Paraganglioma), THCA, and poorly expressed STMN2 was showed in COAD (Colon adenocarcinoma), HNSC (Head and Neck squamous cell carcinoma), READ (Rectum adenocarcinoma), STAD (Stomach adenocarcinoma) (Fig. 1A). Furthermore, compared with paired normal tissues from TCGA data, STMN2 was upregulated in CHOL, KIRC, THCA, and UCEC while downregulated in COAD, ESCA, HNSC, and READ (Fig. 1B). Indeed, STMN2 was prevalently expressed in TCGA-THCA tumor tissues compared with TCGA and GETx normal tissues (Fig. 1C). Furthermore, a similar upregulation of STMN2 was also displayed in TCGA-THCA tumor tissues compared with the counterpart normal tissues (Fig. 1D). In the TCGA cohort, ROC analysis demonstrated high sensitivity and specificity of STMN2 to diagnose THCA (AUC = 0.783, CI = 0.738–0.828, cutoff:30%). Therefore, STMN2 might be involved in THCA progression.

Association of STMN2 expression with clinicopathological features in TCAH

Afterward, we dissected the correlation of the differentially expressed SMTN2 with the age of THCA patients based on the TCGA-THCA dataset. As shown in Fig. 2A, SMTN2 expression levels were upregulated in patients aged < 65 compared with the patients aged > 65. And no expression difference of SMTN2 was detected in female and male patients (Fig. 2B). In different stage patients, we were able to detect statistical differences in SMTN2 expression (Fig. 2C). And yet, not differentially expressed SMTN2 was seen in M0 and M1 stages (Fig. 2D). Interesting, SMTN2 mRNA levels were elevated from the pathological stage of N0 to N1, while downregulated from N1 to NX, no difference was observed in the N0 stage and NX stage (Fig. 2E). More interesting, we could see an obvious reduction of SMTN2 mRNA levels in patients of stage T2 compared with that of stage T1, and yet a significant increment from stage 2 to patients stage 3. Excluded these differences, we verified no difference among different stages (Fig. 2F). To sum, SMTN2 mRNA levels were associated with clinicopathological characteristics of TCGA-THCA patients, including age, stage, N, and T, while did not associate with gender and M (Fig. 2G).

Clarification of DEGs between STMN2-low and STMN2-high THCA patients

Since differentially expressed STMN2 was tightly associated with THCA clinical features, we analyzed the DEGs between STMN2-high and STMN2-low groups based on the TCGA-THCA dataset. As shown in Fig. 3A and 3B witnesses DEG expression levels between two groups, evidenced by a heat map and volcano plot. After comparing DEG related with STMN2 differential expression, we performed a GESA analysis to clarify the enriched signaling pathways in which these DEGs participated. STMN2 was positively correlated with INTERFERON_GAMMA_RESPONSE (Fig. 3C), ALLOGRAFT REJECTION (Fig. 3D), INTERFERON_ALPHA_RESPONSE (Fig. 3E), TNFA SIGNALING _VIA NFKB (Fig. 3F) and IL6_JAK_STAT3_SIGNALING (Fig. 3G).

Enforced exogenous overexpression of STMN2 speeds up the proliferation of THCA cells in vitro

Having verified the obvious clinical importance of STMN2, we contracted the STMN2-overexpressing PTC-1 cells by introducing Flag-STMN2 vectors. The accumulated expression of STMN2 in TPC-1 cells was evidenced by western blot with anti-flag (Fig. 4A). Following we assayed the TPC-1 cells proliferation when STMN2 overexpression. As illustrated in Fig. 4B, TPC-1 cell proliferation was accelerated along with STMN2 high expression. Congruently, the stronger clone formation ability was also detectable in STMN2 overexpressing TPC-1 cells (Fig. 4C). In a words, STMN2 upregulation favors the uncontrolled proliferation of TPC-1 cells.

CRISPR-cas9 knockout of STMN2 slows down THCA growth

To better mine the function of STMN2 on THCA cell proliferation during THCA malignancy, we constructed STMN2-deficient TPC-1 cells. The efficiency of STMN2 deficiency in both cells was corroborated by western blot (Fig. 5A). The subsequent cell proliferation assays substantiated that STMN2 deficiency potently rendered TPC-1 and CAL-62 cells less proliferative capacity (Fig. 5B). Meanwhile, the STMN2 deficiency led to a lower cell colony number of both THCA cells compared with their parental cells (Fig. 5C). The suppressed proliferation was also vitnessed in the CAL-62 cells when STMN2 depletion (Fig. 5D-5F). Undoubtedly, when subcutaneously inoculating STMN2-deficient CAL-62 cells or its parental cells into mice, the suppressing effect of STMN2 in vitro was phenocoped in vivo, showing that STMN2 knockout reduced tumor weight and size (Fig. 5G-5H). Taken together, STMN2 knockout retards thyroid cancerogenesis in vitro and in vivo.

STMN2 stimulates NF-κB signaling pathway

Considering the association of STMN2 with NF-κB, we designed luciferase reporter assays to detect the impact of STMN2 on the NF-κB signaling pathway since it is prevalent during tumor-promoting inflammation. As shown in Fig. 6A, NF-κB transcriptional activity was enlarged in TPC-1 cells along with the accumulating dose of STMN2-flag vectors. A potent impairment of NF-κB transcription was also detectable in STMN2-deficient TPC-1 cells (Fig. 6B). IκBa expression was also reinforced when STMN2 overexpressing(Fig. 6C), while diminished in STMN2 deficient TPC-1 cells (Fig. 6D). Correspondingly, we also observed an obvious abrogation of IκBa expression in STMN2 overexpressing TPC-1 cells upon PDTC treatment (Fig. 6E). Therefore, STMN2 activates NF-κB signaling pathway to boost THCA progression.

In this study, we have revealed that STMN2 is amplified in TCGA-THCA tumor tissues compared with the matching normal tissues and GETx normal tissues. Moreover, overexpressing STMN2 endorses the cell proliferation of TPC-1 cells. Furthermore, CRISPR-cas9 knockout of STMN2 in two in vitro and in vivo THCA models triggers a potent inhibition of cell proliferation. Mechanically, we have demonstrated that STMN2 triggers the oncogenic NF-κB signaling pathway. Our findings suggest that STMN2 might activate the NF-κB signaling pathway might be a targetable molecular alternation to combat THCA.

The previous investigation has uncovered that STMN2 high expression in hepatocellular carcinoma enables malignant growth^{16, 17}. Furthermore, its prognostic significance is also well-documented in colon cancer and ovarian cancer¹². However, its role in THCA remains mysterious. Our bioinformatics analysis has discovered that STMN2 is highly expressed in TC tissues, using the TCGA-THCA cohort. The involvement of STMN2 during THCA malignancy was further substantiated as STMN2 expression is associated with clinicpathilogical characteristics of THCA patients. Indeed, the subsequent functional assays clarified that STMN2 overexpression hastened the THCA cell proliferation, and depletion of STMN2 tuned down the THCA growth in vitro and in vivo. Our findings extended the previous implying the pro-oncogenic role in THCA.

We interrogated the signaling pathways mediated by STMN2 during THCA malignancy through GESA analysis and found STMN2 is closely related to interferon Gamma response, Allograft rejection, interferon-alpha response, inflammatory response, TNFA signaling via NF-κB, and IL2-STA5 signaling. This data illustrated that highly expressed STMN2 caused an enrichment of inflammation with hyperactivated interferon Gamma response, NF-κB, IL2 -mediated cascade events. Indeed, chronic inflammation predisposes cancer initial and progression and is be classified as one of the clinic-pathologic risk factors to enable THCA progression^19–22. Among these multiply inflammatory signaling pathways, the NF-κB signaling pathway interested us. NF-κB is known as a critical modulator during inflammation response and participated in multifaceted inflammatory progress which favors the genesis of many solid tumors, including THCA^23–26. Constitutive activation of NF-κB is also tested in THCA tissues²⁷. NF-κB is also required for oncogene-driven tumor transformation in THCA^{28, 29}. Interestingly, our data of luciferase reporter assays showed that STMN2 elicited NF-κB transcriptional activity. Furthermore, IκBa, as an inflammatory mediator during NF-κB activation³⁰, was also accumulated in TPC-1 cells upon STMN2 overexpression, and while downregulated in STMN2-deficient TPC-1 cells. Furthermore, PDTC could abrogate the accumulation of IkBa expression in STMN2-overexpressing TPC-1 cells. Therefore, STMN2 stimulates the NF-κB signaling event which enables THCA cells to sustain proliferation. Earlier studies have also demonstrated that STMN2 is also responsible for the constitutive activation of wnt/beta-catenin and TGFβ signaling^{16, 17}. Additional mechanism investigation is needed to dissect the bypass signaling pathway during STMN2-driven THCA progression.

Conclusively, our research shows the amplification of STMN2 mRNA, and STMN2 activates NF-κB signaling pathway, ultimately resulting in THCA growth in vitro and in vivo. Thus, our results indicate that STMN2 might be an attractive therapeutic target for THCA.

Acknolegement

This work is supported by Fujian Medical University sailing fund project (2019qh1249), and Science and technology planning project of Fujian Provincial Health Commission (2020qn01010322), the Fujian Natural Science Foundation Program (2022J01120919, 2022J01120925), Fujian Medical University Qihang Fund Project (2019QH1249) and Science and Technology Plan Project of Fujian Health Commission (2020QN01010322)

Conflict of interest disclosure

None.

Author Contributions

Xiangjin Chen contributed to the conception of the study;

Xiaoyu Liu and Jiejun Zheng performed the experiment;

Xiaoyu Liu contributed significantly to analysis and manuscript preparation;

Xiaolong Chen and Congren Wang performed the data analyses and wrote the manuscript;

Zijian Su and Shaoyang Cai helped perform the analysis with constructive discussions.

Data Availability

The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

Ethics approval

The protocol was approved by the ethical committee of the first Affiliated Hospital of Fujian Medical Universityl, China.

Hu J, Yuan IJ, Mirshahidi S, Simental A, Lee SC and Yuan X. Thyroid Carcinoma: Phenotypic Features, Underlying Biology and Potential Relevance for Targeting Therapy. International journal of molecular sciences. 2021; 22.
Haroon Al Rasheed MR and Xu B. Molecular Alterations in Thyroid Carcinoma. Surgical pathology clinics. 2019; 12: 921-30.
Cabanillas ME, McFadden DG and Durante C. Thyroid cancer. Lancet. 2016; 388: 2783-95.
Abe I and Lam AK. Anaplastic thyroid carcinoma: Updates on WHO classification, clinicopathological features and staging. Histology and histopathology. 2021; 36: 239-48.
Dierks C, Seufert J, Aumann K, Ruf J, Klein C, Kiefer S, et al. Combination of Lenvatinib and Pembrolizumab Is an Effective Treatment Option for Anaplastic and Poorly Differentiated Thyroid Carcinoma. Thyroid : official journal of the American Thyroid Association. 2021; 31: 1076-85.
Laha D, Nilubol N and Boufraqech M. New Therapies for Advanced Thyroid Cancer. Frontiers in endocrinology. 2020; 11: 82.
Haddad RI, Nasr C, Bischoff L, Busaidy NL, Byrd D, Callender G, et al. NCCN Guidelines Insights: Thyroid Carcinoma, Version 2.2018. Journal of the National Comprehensive Cancer Network : JNCCN. 2018; 16: 1429-40.
Maniakas A, Dadu R, Busaidy NL, Wang JR, Ferrarotto R, Lu C, et al. Evaluation of Overall Survival in Patients With Anaplastic Thyroid Carcinoma, 2000-2019. JAMA oncology. 2020; 6: 1397-404.
Chmielik E, Rusinek D, Oczko-Wojciechowska M, Jarzab M, Krajewska J, Czarniecka A, et al. Heterogeneity of Thyroid Cancer. Pathobiology : journal of immunopathology, molecular and cellular biology. 2018; 85: 117-29.
Prete A, Borges de Souza P, Censi S, Muzza M, Nucci N and Sponziello M. Update on Fundamental Mechanisms of Thyroid Cancer. Frontiers in endocrinology. 2020; 11: 102.
Prudencio M, Humphrey J, Pickles S, Brown AL, Hill SE, Kachergus JM, et al. Truncated stathmin-2 is a marker of TDP-43 pathology in frontotemporal dementia. The Journal of clinical investigation. 2020; 130: 6080-92.
Yang Y, Qi S, Shi C, Han X, Yu J, Zhang L, et al. Identification of metastasis and prognosis-associated genes for serous ovarian cancer. Bioscience reports. 2020; 40.
Klim JR, Pintacuda G, Nash LA, Guerra San Juan I and Eggan K. Connecting TDP-43 Pathology with Neuropathy. Trends in neurosciences. 2021; 44: 424-40.
Klim JR, Williams LA, Limone F, Guerra San Juan I, Davis-Dusenbery BN, Mordes DA, et al. ALS-implicated protein TDP-43 sustains levels of STMN2, a mediator of motor neuron growth and repair. Nature neuroscience. 2019; 22: 167-79.
Guerra San Juan I, Nash LA, Smith KS, Leyton-Jaimes MF, Qian M, Klim JR, et al. Loss of mouse Stmn2 function causes motor neuropathy. Neuron. 2022; 110: 1671-88 e6.
Lee HS, Lee DC, Park MH, Yang SJ, Lee JJ, Kim DM, et al. STMN2 is a novel target of beta-catenin/TCF-mediated transcription in human hepatoma cells. Biochemical and biophysical research communications. 2006; 345: 1059-67.
Zhong FJ, Sun B, Cao MM, Xu C, Li YM and Yang LY. STMN2 mediates nuclear translocation of Smad2/3 and enhances TGFbeta signaling by destabilizing microtubules to promote epithelial-mesenchymal transition in hepatocellular carcinoma. Cancer letters. 2021; 506: 128-41.
Mueller HS, Fowler CE, Dalin S, Moiso E, Udomlumleart T, Garg S, et al. Acquired resistance to PRMT5 inhibition induces concomitant collateral sensitivity to paclitaxel. Proceedings of the National Academy of Sciences of the United States of America. 2021; 118.
Guarino V, Castellone MD, Avilla E and Melillo RM. Thyroid cancer and inflammation. Molecular and cellular endocrinology. 2010; 321: 94-102.
Pagano L, Mele C, Sama MT, Zavattaro M, Caputo M, De Marchi L, et al. Thyroid cancer phenotypes in relation to inflammation and autoimmunity. Frontiers in bioscience. 2018; 23: 2267-82.
Min JH, Kim MG, Kim SM, Park JW, Chun W, Lee HJ, et al. 3,4,5-Trihydroxycinnamic acid exerts a protective effect on pulmonary inflammation in an experimental animal model of COPD. International immunopharmacology. 2020; 85: 106656.
Xie Z, Li X, He Y, Wu S, Wang S, Sun J, et al. Immune Cell Confrontation in the Papillary Thyroid Carcinoma Microenvironment. Frontiers in endocrinology. 2020; 11: 570604.
DiDonato JA, Mercurio F and Karin M. NF-kappaB and the link between inflammation and cancer. Immunological reviews. 2012; 246: 379-400.
Lawrence T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harbor perspectives in biology. 2009; 1: a001651.
Jin S, Borkhuu O, Bao W and Yang YT. Signaling Pathways in Thyroid Cancer and Their Therapeutic Implications. Journal of clinical medicine research. 2016; 8: 284-96.
Ye R, Liu D, Guan H, AiErken N, Fang Z, Shi Y, et al. AHNAK2 promotes thyroid carcinoma progression by activating the NF-kappaB pathway. Life sciences. 2021; 286: 120032.
Gao B, Guo L, Luo D, Jiang Y, Zhao J, Mao C, et al. Steroid receptor coactivator-1 interacts with NF-kappaB to increase VEGFC levels in human thyroid cancer. Bioscience reports. 2018; 38.
Pacifico F and Leonardi A. Role of NF-kappaB in thyroid cancer. Molecular and cellular endocrinology. 2010; 321: 29-35.
Chen G, Gao Y, Wang G, Dai G and Tong L. MiR-145 inhibits the migration and invasion of papillary thyroid carcinoma cells through NF-kappaB pathway regulation. Journal of cellular biochemistry. 2020; 121: 3325-32.
LaCanna R, Liccardo D, Zhang P, Tragesser L, Wang Y, Cao T, et al. Yap/Taz regulate alveolar regeneration and resolution of lung inflammation. The Journal of clinical investigation. 2019; 129: 2107-22.

Download PDF

Editorial decision: Reject
12 Oct, 2023
Reviewers agreed at journal
25 Sep, 2023
Reviewers invited by journal
19 Jul, 2023
Editor assigned by journal
06 Jul, 2023
First submitted to journal
29 Jun, 2023

You are reading this latest preprint version

STMN2/NF-κB axis drives tumor growth in thyroid carcinoma

Status:

Version 1

Abstract

Figures

Introduction

Methods

Cell culture

Constructs and transfection

CCK8 assay

Colony formation assay

Dual-luciferase reporter assay

Western blots

Xenograft mice model

Data analysis

Statistical analysis

Results

Upregulation of STMN2 in TCHA

Association of STMN2 expression with clinicopathological features in TCAH

Clarification of DEGs between STMN2-low and STMN2-high THCA patients

CRISPR-cas9 knockout of STMN2 slows down THCA growth

STMN2 stimulates NF-κB signaling pathway

Discussion

Declarations

References

Status:

Version 1