Effects of hydrogen-rich water on antioxidant capacity, meat quality and cecum mic robiota of broiler chickens

doi:10.21203/rs.3.rs-3127640/v1

Download PDF

Research Article

Effects of hydrogen-rich water on antioxidant capacity, meat quality and cecum mic robiota of broiler chickens

https://doi.org/10.21203/rs.3.rs-3127640/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Hydrogen-rich water, which contains a high concentration of dissolved hydrogen gas, exhibits numerous advantageous properties, including anti-inflammatory, antioxidant, and metabolic regulatory functions. Its exceptional biosafety renders it highly promising for implementation in agricultural production, particularly in light of the growing concern for food safety. The aim of this study was to evaluate the effects of drinking hydrogen-rich water on broiler growth performance, antioxidant capacity, meat quality, and cecum microbiota, with the objective of assessing its potential as a beneficial component in broiler production. Broilers were provided either hydrogen-rich water or regular taping water throughout the experimental period of 1 to 42 days. On day 42, six birds from each treatment group were selectively chosen for slaughter and subsequent dissection.

Results: The results indicated that the administration of hydrogen-rich water had no significant effect on the growth performance of broilers. However, compared to the control group, the broilers receiving hydrogen-rich water group exhibited significantly higher levels of serum total antioxidant capacity (T-AOC) and superoxide dismutase activity (T-SOD). Moreover, the hydrogen-rich water group displayed significantly lower levels of reactive oxygen species (ROS) and malondialdehyde (MDA) in the liver, along with significantly higher catalase activity (CAT) compared to the control group. Regarding meat quality, the hydrogen-rich water group showed a significantly lower shearing force of chicken breast compared to the control group. Additionally, the proportions of leucine, lysine, and essential amino acids in chicken breast meat were significantly higher in the hydrogen-rich water group. Conversely, the percentage of undecanoic acid in chicken breast meat was significantly lower in the hydrogen-rich water group compared to the control group. Furthermore, the percentages of palmitoleic acid, oleic acid, erucic acid, γ-Linolenic acid, α-Linolenic acid, and monounsaturated fatty acids in chicken breast meat were significantly higher in the hydrogen-rich water group compared to the control group. In terms of cecum microbiota, no significant differences were observed between the two groups in terms of α diversity, β diversity, and phylum species composition. However, at the genus level, the relative abundance of Mediterraneibacter, Kineothrix, Roseburia, Stenotrophomonas, and Proteobacteria_Unclassifiedin the hydrogen-rich water group was significantly higher compared to the control group. On the other hand, the relative abundance of Ralstoniaand Symbiobacterium was significantly lower in the hydrogen-rich water group compared to the control group.

Conclusion: In summary, the results of this study highlight the beneficial effects of hydrogen-rich water on antioxidant parameters in the serum and liver of broilers. It also suggests its potential improving the quality and composition of amino acids and fatty acids in broiler breast meat. Additionally, hydrogen-rich water appears to have a significant impact on the cecum microbiota of broilers.

Hydrogen-rich water

Broiler

Growth performance

Antioxidant capacity

Meat quality

Cecum microbiota

Hydrogen, as the most abundant chemical element in nature, primarily exists as a colorless, odorless, and tasteless gas at standard temperature and pressure. Historically, hydrogen has been predominantly studied and utilized for its applications in energy-related fields, as it was considered physiologically inert[1]. In 1975, Dole et al. conducted a study that discovered the therapeutic effects of hydrogen on squamous cell carcinoma in mice[2]. Subsequently, Ohsawa et al. reported in 2007 that hydrogen can function as a selective antioxidant by specifically reducing cytotoxic oxygen radicals in a mouse model of ischemia-reperfusion[3]. These seminal studies have paved the way for further investigations into the biological effects of hydrogen. Subsequently, a growing body of literature has revealed the antioxidant, anti-inflammatory, anti-apoptotic, gene expression modulating, and signaling pathway regulating properties of hydrogen[4]. Numerous studies have delved into these diverse facets of hydrogen and its potential therapeutic applications. To administer hydrogen to animals, various methods have been employed, including inhalation of hydrogen gas[5], injection of hydrogen solution[6], and ingestion of hydrogen-rich water[7]. Among these methods, the consumption of hydrogen-rich water has gained significant attention due to its simplicity, cost-effectiveness, and safety. The process of obtaining hydrogen-rich water through the waster electrolysis is straightforward, making it a viable option for implementation in livestock production.

In a previous study conducted by our research team, we investigated the effects of hydrogen-rich water on piglets fed Fusarium toxin-contaminated diets. Our results demonstrated the beneficial effects of hydrogen-rich water on growth performance with reduced oxidative damage observed[8]. Furthermore, hydrogen-rich water was found to protest against intestinal morphological damage, preserve intestinal barrier function, and inhibit apoptosis of small intestinal epithelial cells[9]. Additionally, hydrogen-rich water played a role in maintaining imbalances within the intestinal microbiota[10]. These findings highlight the potential of hydrogen-rich water as a protective intervention against the detrimental effects of Fusarium toxin exposure in piglets. Another study conducted by Azad et al.[11] reported the positive impact of hydrogen-rich water on broilers experiencing heat stress, alleviating oxidative damage and improving growth performance. Furthermore, other studies have shown that hydrogen-rich water can enhance the antioxidant capacity of broilers[12]. Chicken breast, known for its high nutritional value, specifically its protein content and low-fat composition, holds great significance in broiler production. Moreover, chicken breast is versatile and widely used in various culinary applications, making it popular in the catering industry. Considering the importance of breast meat quality, as it directly influences consumer preferences, it is essential to explore the effects of hydrogen-rich water on broiler meat quality. However, no previous studies have investigated the impact of hydrogen-rich water on broiler meat quality. Therefore, the objective of this study is to examine the effects of drinking hydrogen-rich water on broiler growth performance, antioxidant capacity in blood and liver, meat quality, and cecum microbiota. The findings of this study aim to provide a theoretical foundation for the application and promotion of hydrogen-rich water in broiler production.

Experimental materials

The hydrogen production machine (NB-X71F) and hydrogen pressurization machine (NB-HS71A) were acquired from Shanghai Nanobubble Technology Co., Ltd. The hydrogen production machine utilizes the process of electrolysis on pure water to generate hydrogen. Subsequently, the hydrogen pressurization machine is employed to increase the pressure, resulting in the production of hydrogen-rich water. This hydrogen-rich water is then connected to the drinking water pipes of the broilers, enabling them to consume it freely as their drinking water source.

Animal and experimental design

A total of 240 healthy male AA broilers, aged 1 day, were randomly assigned to two groups with 6 replicates per group. Each replicate consisted of 10 chickens, and the allocation was based on similar body weights to ensure uniformity. The control group was provided with normal water, while the experimental group received hydrogen-rich water. Throughout the experiment, the broilers had ad libitum access to feed and water. The commercial feed utilized in this trial was purchased from Beijing Dabeinong Technology Group Co., Ltd. The composition and nutrient levels of the diet are outlined in Table 1. The trial was conducted over a duration of 42 days.

Table 1

Composition and nutrient levels of the experimental diets
Feeding period	1-21d	22-42d
Ingredients (%)
Corn	60.175	50.795
Soybean meal	31.3	25.5
Cottonseed meal	2	1.5
Soybean oil	1.5	6.6
Calcium hydrogen phosphate	1.3	0.7
Limestone	1	0.8
Corn gluten meal	0.6
Lysine sulfate	0.56	0.56
Pre-period premix	1
Methionine	0.29	0.25
Salt	0.26	0.28
Antioxidant	0.015	0.015
corn germ cake		12
Mid-term premix		1
Total	100	100
Nutrients levels
Moisture content (%)	12.53	11.85
Crude protein (%)	21.51	19.94
Ether extract (%)	4.37	9.89
Crude Ash (%)	5.44	4.72
Crude fiber (%)	3.33	3.47
Neutral detergent fiber (%)	10.42	12.11
Calcium (%)	0.87	0.65
Total phosphorus (%)	0.69	0.63
Available phosphorus (%)	0.39	0.28
Salt (%)	0.25	0.27
Potassium (g/kg)	8.82	7.37
Sodium (g/kg)	0.6	0.38
Chlorine (mg/kg)	0.46	0.53
Lysine	1.27	1.15
Methionine	0.58	0.52
Methionine + Cysteine	0.91	0.82
Note: The Pre-period premix premix provided the following per kg of diets: vitamin A, 13500 IU; vitamin D3, 3300 IU; vitamin E, 30 IU; vitamin K, 3.0 mg; vitamin B1, 3.0 mg; vitamin B2 9.0 mg; vitamin B6, 6.0 mg; vitamin B12, 0.03 mg; biotin, 0.15 mg; pantothenic acid, 18 mg; niacin, 65 mg; folic acid, 1.5mg; choline chloride, 450 mg; Fe, 60 mg; Mn, 98 mg; Zn, 82 mg; Cu, 60 mg; I, 1.5 mg; and Se, 0.3 mg.
The Mid-term premix premix provided the following per kg of diets: vitamin A, 11250 IU; vitamin D3, 3300 IU; vitamin E, 25 IU; vitamin K, 2.5 mg; vitamin B1, 2.5 mg; vitamin B2 7.5 mg; vitamin B6, 5.0 mg; vitamin B12, 0.025 mg; biotin, 0.12 mg; pantothenic acid, 15 mg; niacin, 55 mg; folic acid, 1.3mg; choline chloride, 350 mg; Fe, 60 mg; Mn, 98 mg; Zn, 82 mg; Cu, 100 mg; I, 1.5 mg; and Se, 0.3 mg.

Feeding management and sample collection

In this trial, the broilers were housed in a stepped system, and proper disinfection procedures were implemented. The broilers were also immunized following standard protocols. Daily feed intake was recorded throughout the duration of the trial. At both day 21 and day 42, the body weight of each bird was measured and documented. On day 42, one broiler from each replicate was selected based on their weight, aiming to choose the bird closest to the mean weight of the respective replicate. Blood samples were collected from the subwing vein, and subsequently, the selected broilers were slaughtered. The collected blood and liver samples were used for subsequent antioxidant measurements. Breast muscle samples were obtained for assessments related to meat quality, as well as the measurement of amino acid and fatty acid composition. Furthermore, cecum chyme samples were collected for microbiological analysis.

Growth performance

The average body weight (BW), average daily gain (ADG), average daily feed intake (ADFI), and feed-to-weight ratio (F/G) were calculated based on initial BW, BW at day 21, BW at day 42, and food intake.

Antioxidant capacity

The levels of reactive oxygen species (ROS) and malondialdehyde (MDA), as well as the enzyme activities of total superoxide dismutase (T-SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and total antioxidant capacity (T-AOC) in both serum and liver samples were measured using specific test kits.The ROS kit was purchased from Jiangsu Meimian Industrial Co., Ltd, while the remaining kits for measuring T-SOD, GSH-Px, CAT, MDA, and T-AOC were obtained from Nanjing Jiancheng Bioengineering Institute.

Determination of meat quality, amino acids, and fatty acids

The pH measurements were conducted using the PH-star instrument (Matthaus, Germany), while the color of the breast was assessed using the precision colorimeter CR18 (Kemei Runda, China). Shear force was determined using the C-LM3B digital display muscle tenderness meter (Northeast Agricultural University, China). Drip loss and cooking loss were measured by hanging and cooking the breast, following the method described by Carvalho[13], For amino acid determination, pre-treatment procedures were performed according to the method outlined by Adeola et al.[14]. The analysis of amino acids was carried out using the LA-8080 Hitachi fully automatic amino acid analyzer (Hitachi, Japan). Regarding the determination of fatty acids, pre-treatment was conducted following the procedure described by Figueiredo et al.[15]The analysis of fatty acids was performed using the TRACE 1310 gas chromatograph (Thermo, Germany) equipped with the TG-FAME column (Thermo, Germany).

Determination of short-chain fatty acid concentration in cecum chyme

Approximately 0.2 g of cecum chyme sample was weighed and then mixed with 1 ml of sterile ultrapure water. The mixture was vortexed to ensure thorough mixing. Subsequently, the supernatant was obtained by centrifuging the mixture at 12,000 rpm for 15 minutes.From the supernatant, 700 µL was extracted and combined with 140 µL of a metaphosphoric acid/crotonic acid mixture. The resulting mixture was vortexed to ensure proper mixing and then centrifuged once again at 12,000 rpm for 10 minutes.The supernatant obtained after centrifugation was filtered through a 0.22 µm aqueous needle filter. The filtered supernatant was then injected into a column (No. 34292-07B, Supelco, USA) using a 1 µL microsampler.The concentration of short-chain fatty acids was determined using a GC-14B meteorological chromatograph (Shimadzu, Japan). This analytical technique allows for the accurate measurement and quantification of short-chain fatty acids present in the cecum chyme sample.

DNA extraction and 16S rRNA sequencing of cecum chyme microbiota

DNA was extracted from six samples of each of the two groups of cecum chyme strictly according to the instructions by using QIAamp® PowerFecal® Pro DNA Kit(Qiagen, Germany), DNA concentration and purity were determined using an ultra-micro spectrophotometer (Nano-drop Technologies, USA).

The extracted DNA samples were sent to Shanghai Biozeronbiotechnology Co., Ltd. for 16S rRNA sequencing. The 16S V3-V4 region was amplified using the primer set 338F (ACTCCTACGGGAGGCAGCAG) as the upstream primer and 806R (GGACTACHVGGGTWTCTAAT) as the downstream primer. Three independent PCR amplifications were performed for each sample, and the resulting amplicons were then mixed together. The PCR products were purified using the AxyPrep DNA Gel Extraction Kit, and their concentrations were quantified using a Quantus™ Fluorometer. The purified PCR products were normalized to the appropriate sequencing volume for each sample. Libraries were constructed using the NEXTFLEX Rapid DNA-Seq Kit, and sequencing was carried out on Illumina's NovaSeq PE250 platform. Upon completion of sequencing, the raw sequence data underwent quality control using the fastp software (https://github.com/OpenGene/fastp, version 0.20.0). The sequences were then merged using the FLASH software (http://www.cbcb.umd.edu/software/flash, version 1.2.7) to obtain full-length sequences. The ASV (amplicon sequence variant) sequences were generated using the DADA2 ASV method based on Qiime2. Each sequence was assigned a species classification using the RDP classifier (http://rdp.cme.msu.edu/, version 2.2) and compared against the Silva 16S rRNA database (v138) with a comparison threshold set at 70%. Taxonomic analysis of the ASV representative sequences was performed using the uclust algorithm. The community composition of each sample was determined at each taxonomic level, allowing for subsequent analysis of the microbial community structure..

Statistical analysis

The data were initially compiled using Microsoft Office Excel 2019. Growth performance, serum and liver antioxidant capacity, meat quality indicators, and concentrations of short-chain fatty acids were subjected to independent samples t-test using IBM SPSS Statistics 25. A significance level of P < 0.05 was used to determine statistical significance, while P > 0.05 indicated a lack of statistical significance, and 0.05 < P < 0.1 suggested a trend of change. Furthermore, a significance level of P < 0.01 was used to denote a highly significant difference.The data are presented as "Mean ± Standard Deviation (SD)". The relative abundance of cecum microbiota at the phylum and genus levels between the two groups was analyzed for differences and identified as differential microbiota using non-parametric tests. Further analysis of microbial data was conducted using the OmicStudio tool available on the LianChuan BioCloud platform (https://www.omicstudio.cn/tool/). Alpha and beta diversity, as well as species composition, were analyzed. Microorganisms from phylum to genus levels between the two groups were subjected to LEfSe (Linear discriminant analysis Effect Size) analysis to identify differential bacteria with an LDA (Linear Discriminant Analysis) score greater than 3 as the criterion. Functional prediction was performed based on the PICRUSt2 results. Species composition and differential microbial histograms at the alpha diversity, phylum level, and genus level were generated using GraphPad Prism 8. Additionally, Spearman correlation analysis was conducted to examine the relationship between differential microbial genera and relevant indicators, and heat maps were created.

Growth performance

Table 2 presents the results of the effects of hydrogen-rich water on the body weight (BW), average daily gain (ADG), average daily feed intake (ADFI), and feed-to-weight ratio (F/G) of broilers at different stages. The statistical analysis revealed that the consumption of hydrogen-rich water did not have a significant effect (P > 0.05) on these growth performance parameters.

Table 2

Effects of hydrogen-rich water on growth performance of broilers
Items	CTR	HRW	P-value
Body Weight (g)
Day1 (g)	49 ± 1	49 ± 1	0.555
Day21 (g)	892 ± 25	900 ± 45	0.722
Day42 (g)	2873 ± 166	2938 ± 108	0.445
ADFI (g/d)
Day1-Day21	57.23 ± 3.19	57.62 ± 3.96	0.855
Day22-Day42	150.54 ± 5.35	150.26 ± 10.16	0.955
Day1-Day42	105.04 ± 8.36	105.07 ± 6.18	0.994
ADG (g/d)
Day1-Day21	40.47 ± 1.50	40.82 ± 1.00	0.644
Day22-Day42	90.66 ± 5.48	92.49 ± 8.40	0.665
Day1-Day42	73.98 ± 2.49	76.25 ± 2.09	0.117
F/G
Day1-Day21	1.41 ± 0.07	1.41 ± 0.10	0.974
Day22-Day42	1.67 ± 0.14	1.64 ± 0.19	0.774
Day1-Day42	1.42 ± 0.11	1.38 ± 0.07	0.451

Effect of hydrogen-rich water on antioxidant capacity of broilers

Table 3 displays the activity of total superoxide dismutase (T-SOD) in serum and total antioxidant capacity (T-AOC) of serum in broilers from the HRW group and the CTR group. The statistical analysis revealed that the HRW group exhibited significantly higher T-SOD activity in serum and T-AOC compared to the CTR group (P < 0.05). These findings suggest that hydrogen-rich water supplementation positively influenced the antioxidant capacity in the serum of broilers.

Table 3

Effects of hydrogen-rich water on serum antioxidant capacity of broilers
Items	CTR	HRW	P-value
ROS (pg/ml)	149.74 ± 13.9	141.28 ± 14.73	0.330
MDA (nmol/ml)	2.59 ± 1.09	2.17 ± 0.93	0.495
T-SOD (U/ml)	79.7 ± 27.44^b	124.81 ± 26.41^a	0.016
T-AOC (mmol Trolox/L)	0.35 ± 0.07^b	0.48 ± 0.08^a	0.013
GSH-Px (U/ml)	225.09 ± 42.81	245.6 ± 35.84	0.389
CAT (U/ml)	3.92 ± 2.25	3.63 ± 2.29	0.831

Table 4 presents the data on the levels of ROS and MDA in the liver of broilers in the HRW group and the CTR group. The statistical analysis reveals that the HRW group exhibited significantly lower levels of ROS and MDA in the liver compared to the CTR group (P < 0.05). This indicates that the consumption of hydrogen-rich water had a beneficial effect on reducing oxidative stress and lipid peroxidation in the liver of broilers, as evidenced by the decreased levels of ROS and MDA.

Table 4

Effects of hydrogen-rich water on liver antioxidant capacity of broilers
Items	CTR	HRW	P-value
ROS (pg/mgprot)	11.79 ± 0.93^a	10.32 ± 1.18^b	0.038
MDA (nmol/mgprot)	0.54 ± 0.10^a	0.38 ± 0.08^b	0.014
T-SOD (U/mgprot)	121.42 ± 10.80	115.88 ± 15.01	0.481
T-AOC (mmol Trolox/gprot)	19.90 ± 8.06	18.70 ± 11.33	0.840
GSH-Px/ (U/mgprot)	18.75 ± 3.65	19.69 ± 3.94	0.677
CAT (U/mgprot)	14.65 ± 5.16	23.89 ± 5.61	0.014

Effect of hydrogen-rich water on meat quality, composition of amino acid and fatty acid in breast of broilers

Table 5 illustrates the results of the shear force measurement on chicken breast meat, indicating that the HRW group exhibited significantly lower shear force compared to the CTR group (P < 0.05). This implies that the consumption of hydrogen-rich water contributed to improved tenderness of the chicken breast meat.In Fig. 1, the proportions of leucine and lysine in chicken breast meat were significantly higher in the HRW group compared to the CTR group (P < 0.05). Moreover, the proportions of non-essential amino acids were significantly lower, while the proportions of essential amino acids were significantly higher in the HRW group (P < 0.01). These findings suggest that hydrogen-rich water intake influenced the amino acid composition of chicken breast meat, enhancing the levels of specific essential amino acids. Figure 2 presents the fatty acid composition of chicken breast meat. The proportion of undecanoic acid (C11:0) in the HRW group was significantly lower than that in the CTR group (P < 0.01). Additionally, the proportion of erucic acid (C22:1n9) was significantly higher in the HRW group (P < 0.05). Furthermore, the proportions of palmitoleic acid (C16:1), oleic acid (C18:1n9c), γ-linoleic acid (C18:3n6), α-linoleic acid (C18:3n3), and monounsaturated fatty acids (MUFA) were significantly higher in the HRW group compared to the CTR group (P < 0.01). These results indicate that hydrogen-rich water consumption influenced the fatty acid composition of chicken breast meat, promoting the presence of certain beneficial fatty acids while reducing the levels of specific fatty acids. Overall, the findings highlight the positive impact of hydrogen-rich water on the tenderness, amino acid composition, and fatty acid profile of chicken breast meat.

Table 5

Effects of hydrogen-rich water on meat quality of broilers
Items	CTR	HRW	P-value
Lightness, L* 45min	42.95 ± 1.75	42.18 ± 1.24	0.399
Lightness, L* 24h	44.73 ± 0.14	45.49 ± 0.53	0.363
Redness, a* 45min	1.01 ± 1.45	1.01 ± 1.06	0.983
Redness, a* 24h	0.51 ± 0.83	0.31 ± 1.78	0.137
Yellowness, b* 45min	4.68 ± 0.28	4.43 ± 0.12	0.743
Yellowness, b* 24h	2.04 ± 0.83	2.46 ± 0.41	0.294
pH 45min	6.48 ± 0.12	6.40 ± 0.12	0.280
pH 24h	6.23 ± 0.15	6.14 ± 0.09	0.250
Drip loss 24h (%)	1.38 ± 0.63	1.53 ± 0.50	0.658
Drip loss 48h (%)	1.95 ± 0.69	2.24 ± 0.64	0.477
Cooking loss (%)	9.66 ± 2.00	9.29 ± 1.76	0.744
Shear force (N)	19.60 ± 1.15a	14.20 ± 1.60b	< 0.001

Effect of hydrogen-rich water on concentration of short-chain fatty acids in cecum chyme of broilers

Table 6 presents the concentrations of various short-chain fatty acids in broiler cecum chyme. The results indicate that hydrogen-rich water did not have a significant effect (P > 0.05) on the concentrations of these short-chain fatty acids. However, there was a trend towards an increase in the concentration of total short-chain fatty acids in broiler cecum chyme(0.05 < P < 0.1). Although this trend did not reach statistical significance, it suggests a potential influence of hydrogen-rich water on the overall concentration of short-chain fatty acids in the cecum chyme of broilers. Further investigation with a larger sample size may be necessary to confirm this observation.

Table 6

Effects of hydrogen-rich water on concentration of short-chain fatty acids in cecum chyme of broilers
Items	CTR	HRW	P-value
Concentration (µg/ml)
Acetic acid	33.26 ± 6.14	34.62 ± 5.04	0.111
Propionic acid	6.47 ± 2.33	7.84 ± 1.66	0.151
Isobutyric acid	0.98 ± 0.02	1.14 ± 0.38	0.694
Butyric acid	6.20 ± 0.72	6.43 ± 1.94	0.160
Isovaleric acid	0.98 ± 0.13	1.21 ± 0.23	0.753
Valeric acid	1.22 ± 0.19	1.50 ± 0.58	0.598
Total SCFA	49.10 ± 7.08	52.74 ± 3.86	0.063

Effect of hydrogen-rich water on the microbial diversity of broiler cecum

Figure 3 illustrates the impact of hydrogen-rich water on the α-diversity and β-diversity of broiler cecum microbiota. In Fig. 3A, it is evident that hydrogen-rich water did not exert a significant effect on the four α-diversity indices, namely Chao1, ACE, Shannon, and Simpson, of broiler cecum microbiota (P > 0.05). Similarly, Fig. 3B demonstrates that hydrogen-rich water had no significant effect on the β-diversity of broiler cecum microbiota (P > 0.05). These findings suggest that the introduction of hydrogen-rich water did not result in substantial alterations in the diversity of the cecum microbiota in broilers.

Effect of hydrogen-rich water on the composition and relative abundance of microbiota in the cecum of broilers

As depicted in the Venn plot (Fig. 4A), a total of 393 ASVs were found to be shared between the CTR and HRW groups, with 1205 ASVs specific to the CTR group and 1085 ASVs specific to the HRW group. Figure 4B displays the relative abundance of microbiota at the phylum level in the cecum of the two broiler groups. The dominant phyla, defined as those with a relative abundance > 1%, included Firmicutes, Proteobacteria, Bacteroidetes, and Verrucomicrobia. The relative abundance of each dominant phylum did not show significant differences between the two groups (P > 0.05). At the genus level, dominant genera were defined as those with a relative abundance > 1%, while the remaining genera were combined as Others. As presented in Fig. 4C, the shared dominant genera between both groups comprised Blautia, Cronobacter, Bacteroides, Vibrio, Akkermansia, Barnesiella, Sporobacter, Salmonella, Escherichia, Alistipes, Mediterraneibacter, Ligilactobacillus, Enterocloster, Phocaeicola, Eisenbergiella, Sellimonas, Murimonas, Anaerobutyricum, Tidjanibacter, Acutalibacter, Faecalimonas, Anaeromassilibacillus, Fusibacter, and Kineothrix, totaling 24 genera.

Among the dominant genera, the relative abundance of Kineothrix and Mediterraneibacter was found to be significantly higher in the HRW group compared to the CTR group (P < 0.05). Upon adjusting the screening range to a lower threshold of 0.1%, it was observed that the relative abundance of Roseburia, Stenotrophomonas, and Proteobacteria_Unclassified in the HRW group was significantly higher than that in the CTR group (P < 0.05). Conversely, the relative abundance of Ralstonia (P < 0.05) and Symbiobacterium (P < 0.01) was significantly lower in the HRW group compared to the CTR group.

LEfSe(Linear discriminant analysis Effect Size) analysis was conducted to identify statistically different biomarkers between the groups. The Cladogram evolutionary branching diagram (Fig. 5A) illustrates bacteria at five taxonomic levels, phylum, class, order, family, and genus. Bacteria enriched in the CTR group are indicated in red, while those enriched in the HRW group are indicated in blue. Figure 5B displays the histogram of LDA (Linear Discriminant Analysis) values, where higher values indicate greater abundance of bacteria in the respective group. The LEfSe analysis results revealed 14 groups with significant differences between the two groups at the phylum, order, family, and genus levels. Specifically, at the genus level, the abundance of Kineothrix, Mediterraneibacter, Roseburia, and Stenotrophomonas was significantly higher in the HRW group compared to the CTR group (P < 0.05), while the abundance of Massilimaliae and Symbiobacterium was significantly lower in the HRW group compared to the CTR group(P < 0.05).

Effect of hydrogen-rich water on microbial metabolic pathways in the cecum of broilers

The PICRUSt2 analysis revealed a significant impact of feeding hydrogen-rich water on the metabolic pathways of broiler cecum microbiota at the KEGG Level 3 (Fig. 6). Among the top 20 metabolic pathways in terms of relative abundance, several pathways exhibited notable differences between the HRW group and the CTR group. Specifically, the following pathways showed significantly lower relative abundance in the HRW group compared to the CTR group (P < 0.05): Citrate cycle, Carbon fixation pathways in prokaryotes, Biosynthesis of siderophore group nonribosomal peptides, Base excision repair, Valine, leucine and isoleucine degradation, Nitrogen metabolism, Huntington disease, Folate biosynthesis, C5-Branched dibasic acid metabolism, beta-Alanine metabolism, Taurine and hypotaurine metabolism, Nicotinate and nicotinamide metabolism, Limonene and pinene degradation, Inositol phosphate metabolism, Glutathione metabolism, Biotin metabolism, Arachidonic acid metabolism, and Alzheimer's disease. Additionally, the relative abundance of the PPAR signaling pathway and Peroxisome functional gene expression was significantly lower in the HRW group compared to the CTR group (P < 0.01).

Correlation analysis of different microbial genera of broiler cecum with antioxidant capacity and meat quality index

In Fig. 7, the correlation analysis between different genera of microbiota in the cecum of broilers and various indicators of serum antioxidant capacity and meat quality is presented. The following correlations were observed: Mediterraneibacter in the cecum of broilers was significantly and positively correlated with T-SOD and T-AOC in serum, the proportion of leucine, C16:1, C18:1n9c, C18:3n6, C18:3n3 in breast (P < 0.05), was highly significantly and positive correlated with MUFA (P < 0.01), and was significantly and negatively correlated with shear force in breast (P < 0.05). Kineothrix in the cecum of broilers was significantly and positively correlated with T-AOC in serum, the proportion of leucine, lysine, essential amino acids, C16:1, C18:1n9c, C18:3n6, MUFA in breast (P < 0.05), and was significantly and negatively correlated with nonessential amino acids in breast (P < 0.05). Roseburia in the cecum of broilers was significantly and positively correlated with the proportion of leucine and lysine in breast (P < 0.05). Stenotrophomonas in the cecum of broilers was significantly and positively correlated with the proportion of leucine in breast (P < 0.05). Ralstonia was highly significantly and negative correlated with T-AOC in serum, was highly significantly and negative correlated with the proportion of leucine, lysine, essential amino acids, C16:1, C18:3n6 in breast (P < 0.01). Proteobacteria_Unclassified was significantly and positively correlated with the proportion of leucine in breast (P < 0.05). Symbiobacterium was significantly and negatively correlated with T-AOC in serum, the proportion of leucine, lysine, C16:1, C18:3n6 in breast (P < 0.05), was highly significantly and negative correlated with essential amino acids in breast (P < 0.01), was highly significantly and positively correlated with nonessential amino acids in breast (P < 0.01). In Fig. 7, the correlation analysis between different genera of microbiota in the cecum of broilers and various indicators of serum antioxidant capacity and meat quality is presented. The following correlations were observed: Mediterraneibacter in the cecum of broilers showed a significant positive correlation with T-SOD and T-AOC in serum, as well as the proportions of leucine, C16:1, C18:1n9c, C18:3n6, and C18:3n3 in breast (P < 0.05). It also exhibited a highly significant positive correlation with MUFA (P < 0.01) and a significant negative correlation with shear force in breast (P < 0.05). Kineothrix in the cecum of broilers demonstrated a significant positive correlation with T-AOC in serum, as well as the proportions of leucine, lysine, essential amino acids, C16:1, C18:1n9c, and C18:3n6 in breast (P < 0.05). It also showed a significant negative correlation with nonessential amino acids in breast (P < 0.05).Roseburia in the cecum of broilers exhibited a significant positive correlation with the proportions of leucine and lysine in breast (P < 0.05).Stenotrophomonas in the cecum of broilers displayed a significant positive correlation with the proportion of leucine in breast (P < 0.05).Ralstonia showed a highly significant negative correlation with T-AOC in serum and a highly significant negative correlation with the proportions of leucine, lysine, essential amino acids, and C18:3n6 in breast (P < 0.01).Proteobacteria_Unclassified demonstrated a significant positive correlation with the proportion of leucine in breast (P < 0.05). Symbiobacterium showed a significant negative correlation with T-AOC in serum, as well as the proportions of leucine, lysine, C16:1, and C18:3n6 in breast (P < 0.05). It also displayed a highly significant negative correlation with essential amino acids in breast (P < 0.01) and a highly significant positive correlation with nonessential amino acids in breast (P < 0.01).

Previous studies conducted in both mammals and poultry have demonstrated the potential of hydrogen-enriched water to mitigate the negative impact on growth performance induced by adverse external factors[8, 11]. However, it is important to note that these studies primarily focused on animals experiencing challenging physiological conditions. In the present experiment, broilers were subjected to normal physiological conditions, and the findings align with existing research, suggesting that hydrogen-rich water does not exert a significant effect on the growth performance of broiler chickens under such conditions. It is worth mentioning that the potential of hydrogen-enriched water to alleviate the decline in broiler growth performance resulting from health impairments remains an area that requires further investigation and exploration. While the current study did not observe substantial effects on growth performance under normal physiological conditions, it does not discount the possibility of hydrogen-rich water exerting positive effects in situations where broilers are subjected to health-related challenges. Therefore, future research should delve into the mechanisms underlying the potential beneficial effects of hydrogen-enriched water in mitigating growth performance declines caused by health damage in broiler chickens. Such investigations would provide valuable insights into the application of hydrogen-rich water as a potential therapeutic approach in poultry farming practices.

Oxidative stress in broiler production can have detrimental effects on health, including reduced immunity, intestinal damage, decreased nutrient absorption, and ultimately, impaired production performance. The body's antioxidant capacity plays a crucial role in maintaining broiler health. Excessive accumulation of ROS can lead to damage to cell membranes, proteins, and DNA, disrupting cellular functions[16], MDA, a byproduct of lipid peroxidation, is a marker of oxidative stress and a toxic compound that can cause lipid peroxidation in cell membranes[17]. T-SOD and CAT are two antioxidant enzymes that scavenge oxygen free radicals and protect the body from oxidative damage. T-AOC is an index used to evaluate the overall antioxidant capacity of the organism. In this study, feeding hydrogen-rich water significantly increased serum T-AOC and enhanced T-SOD and CAT activity in the liver of broiler chickens. Moreover, it reduced the levels of ROS and MDA in the liver, indicating an improvement in the antioxidant properties of broilers and a reduction in the likelihood of oxidative stress. Previous studies have reported the antioxidant effects of hydrogen-rich water, such as alleviating chronic graft-versus-host disease in mice[18], and reducing oxidative stress in mice with DSS-induced chronic ulcerative colitis[19]. Shin et al.[12] demonstrated that hydrogen-rich water increased T-AOC in broilers and elevated T-SOD activity in serum and breast tissue. Azad et al.[11] also showed that hydrogen-rich water alleviated oxidative damage in skeletal muscle of broilers. These findings highlight the promising application of hydrogen-rich water as an antioxidant to prevent and mitigate oxidative stress in livestock and poultry production.

Chicken breast meat is highly valued by consumers due to its low fat content, low calorie count, and high protein content, which can account for over 86% of the total mass[20]. Therefore, selecting and breeding broiler chickens with desirable breast meat characteristics is a crucial focus in poultry production. Shear force, a measure of tenderness, is an important indicator of chicken breast quality. The results of this experiment revealed that consuming hydrogen-rich water significantly reduced the shear force of chicken breasts, indicating an improvement in tenderness and taste. The amino acid composition is another essential criterion for evaluating meat products. In this study, the consumption of hydrogen-rich water increased the ratio of leucine to lysine and the total essential amino acid content in chicken breast meat. Essential amino acids are necessary for the body, as they cannot be synthesized internally and must be obtained from external sources. Leucine, in particular, aids in blood sugar control, protein synthesis, and muscle function maintenance[21];Lysine plays a vital role in various life cycle processes, promoting energy metabolism, mineral absorption, bone growth, protein synthesis, immune function, and anxiety reduction. When evaluating the fatty acid composition of chicken breast meat, it is important to consider saturated fatty acids (SFA), monounsaturated fatty acids (MUFA), and polyunsaturated fatty acids (PUFA). Long-term intake of SFA, which contains saturated bonds in their carbon chains, may increase the risk of cardiovascular disease. On the other hand, unsaturated fatty acids, including monounsaturated fatty acids (MFUA) and polyunsaturated fatty acids (PUFA), are considered essential nutrients for the human body. PUFA exhibit anti-inflammatory properties, promote brain development, and help prevent cardiovascular disease[22], MUFA also offer beneficial effects such as blood sugar regulation, blood lipid control, heart protection, and cholesterol reduction[23]. In this experiment, drinking hydrogen-rich water significantly reduced the proportion of C11:0 (SFA) in chicken breast meat and decreased the proportion of C22:1n9 (MUFA), while highly increasing the proportion of C16:1 (MUFA), C18:1n9c (MUFA), and total MUFA. Additionally, there was a significant increase in the proportion of C18:3n6 (PUFA) and C18:3n3 (PUFA). Overall, feeding hydrogen-rich water improved the quality and tenderness of chicken breast meat, as well as enhanced the amino acid and fatty acid composition of the meat.

The intestinal microbiota plays a vital role in maintaining animal health by performing various functions such as vitamin production, nutrient absorption, and development of the host immune system[24]. In this experiment, it was observed that consuming hydrogen-rich water led to an increase in the relative abundance of Kineothrix, Mediterraneibacter, Roseburia, and Stenotrophomonas at the genus level, while the relative abundance of Ralstonia and Symbiobacterium significantly decreased. Both Mediterraneibacter[25] and Kineothrix[26] are butyrate-producing bacteria in the intestine. Butyrate, as a metabolite of the intestinal microbiota, plays a crucial role in the interaction between the gut flora and the host. Numerous studies have demonstrated the therapeutic effects of butyrate on intestinal tumors, inflammation, and malabsorption. Therefore, the increased relative abundance of Mediterraneibacter and Kineothrix can enhance butyrate production in the intestine, thereby improving the health status of broilers. Furthermore, the LEfse analysis revealed that the relative abundance of Roseburia was significantly higher in the HRW group compared to the CTR group. Roseburia is another beneficial bacterium known for its ability to produce butyrate, contributing to the overall health of the host. The increased relative abundance of Roseburia is beneficial for the host's well-being. Although the relative abundance of several butyric acid-producing bacteria mentioned above increased, the results of cecum chyme short-chain fatty acid concentration measurements showed that there was no significant difference in butyric acid concentration between the two groups. The speculation is that the butyric acid produced is absorbed and used by the host to improve the host's health. The predicted functional analysis of the gut microbiota showed that the HRW group exhibited decreased relative abundance of pathways related to amino acid and fatty acid metabolism (Valine, leucine, and isoleucine degradation, Nitrogen metabolism, Arachidonic acid metabolism, and PPAR signaling pathway), as well as antioxidant-related pathways (Glutathione metabolism and Peroxisome). These findings suggest that hydrogen-rich water may modulate the composition of the intestinal microbiota, leading to changes in the metabolic pathways associated with amino acid, fatty acid, and antioxidant metabolism. Correlation analysis further revealed significant and positive associations between the relative abundance of Mediterraneibacter and Kineothrix in the HRW group with serum antioxidant performance, as well as certain amino acid and fatty acid proportions. These findings suggest that hydrogen-rich water may improve broiler antioxidant performance by modulating the composition of the intestinal microbiota, ultimately influencing the quality of chicken breast meat, as well as its amino acid and fatty acid composition.

In conclusion, the findings of this study suggest that the consumption of hydrogen-rich water in broilers has several advantageous effects. It enhances antioxidant activity in both serum and liver, resulting in a decrease in oxidative stress. Additionally, it positively impacts the quality of chicken breast meat by improving its amino acid and fatty acid composition, which contributes to better improving taste and tenderness. Moreover, hydrogen-rich water influences the structure of the cecum microbiota, promoting the growth of beneficial bacteria involved in butyrate production. Importantly, these benefits effects are achieved without compromising the growth performance of broilers. Therefore, the application of hydrogen-rich water can be considered a safe and feasible approach in broiler production.

HRW	Hydrogen-rich water
CTR	Control
T-AOC	Total antioxidant capacity
T-SOD	Superoxide dismutase activity
ROS	Reactive oxygen species
MDA	Malondialdehyde
CAT	Catalase
BW	Body weight
ADG	Average daily gain
ADFI	Average daily food intake
F/G	Feed-to-weight ratio
Lefse	Linear discriminant analysis Effect Size
LDA	Linear Discriminant Analysis

Ethics approval and consent to participate

The experiment was approved by the Animal Care and Use Committee of Nanjing Agricultural University.

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that there are no conflicts of interest.

Funding

Not applicable.

Authors’ contributions

WJZ and WY designed the study. HZ conducted the experiment. HYY provided hydrogen-related instruments HZ performed and collected the data. HZ analyzed the data. HZ wrote the manuscript. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Zeng J, Ye Z, Sun X. Progress in the study of biological effects of hydrogen on higher plants and its promising application in agriculture [J]. Med Gas Res. 2014;4:15.
Dole M, Wilson FR, Fife WP. Hyperbaric hydrogen therapy: a possible treatment for cancer [J]. Science. 1975;190(4210):152–4.
Ohsawa I, Ishikawa M, Takahashi K, Watanabe M, Nishimaki K, Yamagata K, et al. Hydrogen acts as a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals [J]. Nat Med. 2007;13(6):688–94.
Li HM, Shen L, Ge JW, Zhang RF. The transfer of hydrogen from inert gas to therapeutic gas [J]. Med Gas Res. 2017;7(4):265–72.
Kurioka T, Matsunobu T, Satoh Y, Niwa K, Shiotani A. Inhaled hydrogen gas therapy for prevention of noise-induced hearing loss through reducing reactive oxygen species [J]. Neurosci Res. 2014;89:69–74.
Shen L, Wang J, Liu K, Wang C, Wang C, Wu H, et al. Hydrogen-rich saline is cerebroprotective in a rat model of deep hypothermic circulatory arrest [J]. Neurochem Res. 2011;36(8):1501–11.
Xin HG, Zhang BB, Wu ZQ, Hang XF, Xu WS, Ni W, et al. Consumption of hydrogen-rich water alleviates renal injury in spontaneous hypertensive rats [J]. Mol Cell Biochem. 2014;392(1–2):117–24.
Zheng W, Ji X, Zhang Q, Du W, Wei Q, Yao W. Hydrogen-Rich Water and Lactulose Protect Against Growth Suppression and Oxidative Stress in Female Piglets Fed Fusarium Toxins Contaminated Diets [J]. Toxins (Basel). 2018;10(6):288.
Ji X, Zhang Q, Zheng W, Yao W. Morphological and molecular response of small intestine to lactulose and hydrogen-rich water in female piglets fed Fusarium mycotoxins contaminated diet [J]. J Anim Sci Biotechnol. 2019;10:9.
Zheng W, Ji X, Zhang Q, Yao W. Intestinal Microbiota Ecological Response to Oral Administrations of Hydrogen-Rich Water and Lactulose in Female Piglets Fed a Fusarium Toxin-Contaminated Diet [J]. Toxins (Basel). 2018;10(6):246.
Azad MA, Kikusato M, Zulkifli I, Toyomizu M. Electrolysed reduced water decreases reactive oxygen species-induced oxidative damage to skeletal muscle and improves performance in broiler chickens exposed to medium-term chronic heat stress [J]. Br Poult Sci. 2013;54(4):503–9.
Shin D, Cho ES, Bang HT, Shim KS. Effects of oxygenated or hydrogenated water on growth performance, blood parameters, and antioxidant enzyme activity of broiler chickens [J]. Poult Sci. 2016;95(11):2679–84.
Carvalho LT, Owens CM, Giampietro-Ganeco A, Malagoli De Mello JL, Ferrari FB, De Carvalho F et al. a L,. Quality of turkeys breast meat affected by white striping myopathy [J]. Poult Sci, 2021, 100(4): 101022.
Adeola O, Shafer DJ, Nyachoti CM. Nutrient and energy utilization in enzyme-supplemented starter and grower diets for White Pekin ducks [J]. Poult Sci. 2008;87(2):255–63.
Figueiredo IL, Claus T, Oliveira Santos Junior O, Almeida VC, Magon T, Visentainer JV. Fast derivatization of fatty acids in different meat samples for gas chromatography analysis [J]. J Chromatogr A. 2016;1456:235–41.
Ezraty B, Gennaris A, Barras F, Collet JF. Oxidative stress, protein damage and repair in bacteria [J]. Nat Rev Microbiol. 2017;15(7):385–96.
Del Rio D, Stewart AJ, Pellegrini N. A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress [J]. Nutr Metab Cardiovasc Dis. 2005;15(4):316–28.
Qian L, Liu J, Ma W, Liu Y, Wang X, Liu D. Hydrogen-Rich Water Ameliorates Murine Chronic Graft-versus-Host Disease through Antioxidation [J]. Oxid Med Cell Longev, 2021, 2021: 1165928.
Song L, Zhang Y, Zhu C, Ding X, Yang L, Yan H. Hydrogen-rich water partially alleviate inflammation, oxidative stress and intestinal flora dysbiosis in DSS-induced chronic ulcerative colitis mice [J]. Adv Med Sci. 2022;67(1):29–38.
Dalle Zotte A, Ricci R, Cullere M, Serva L, Tenti S, Marchesini G. Research Note: Effect of chicken genotype and white striping-wooden breast condition on breast meat proximate composition and amino acid profile [J]. Poult Sci. 2020;99(3):1797–803.
Duan Y, Li F, Li Y, Tang Y, Kong X, Feng Z, et al. The role of leucine and its metabolites in protein and energy metabolism [J]. Amino Acids. 2016;48(1):41–51.
Liu Y, Ren X, Fan C, Wu W, Zhang W, Wang Y. Health Benefits, Food Applications, and Sustainability of Microalgae-Derived N-3 PUFA [J]. Foods, 2022, 11(13).
Ravaut G, Legiot A, Bergeron KF, Mounier C. Monounsaturated Fatty Acids in Obesity-Related Inflammation [J]. Int J Mol Sci, 2020, 22(1).
Adak A, Khan MR. An insight into gut microbiota and its functionalities [J]. Cell Mol Life Sci. 2019;76(3):473–93.
Kim JS, Lee KC, Suh MK, Han KI, Eom MK, Lee JH, et al. Mediterraneibacter butyricigenes sp. nov., a butyrate-producing bacterium isolated from human faeces [J]. J Microbiol. 2019;57(1):38–44.
Haas KN, Blanchard JL. Kineothrix alysoides, gen. nov., sp. nov., a saccharolytic butyrate-producer within the family Lachnospiraceae [J]. Int J Syst Evol Microbiol. 2017;67(2):402–10.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Effects of hydrogen-rich water on antioxidant capacity, meat quality and cecum mic robiota of broiler chickens

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Experimental materials

Animal and experimental design

Feeding management and sample collection

Growth performance

Antioxidant capacity

Determination of meat quality, amino acids, and fatty acids

Determination of short-chain fatty acid concentration in cecum chyme

DNA extraction and 16S rRNA sequencing of cecum chyme microbiota

Statistical analysis

Results

Growth performance

Effect of hydrogen-rich water on antioxidant capacity of broilers

Effect of hydrogen-rich water on concentration of short-chain fatty acids in cecum chyme of broilers

Effect of hydrogen-rich water on the microbial diversity of broiler cecum

Effect of hydrogen-rich water on microbial metabolic pathways in the cecum of broilers

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1