Ethical statement
The studies involving human participants were reviewed and approved by the Medical Ethics Committee of the Wuhan Children’s Hospital (Wuhan Maternal and Child Healthcare Hospital), Tongji Medical College, Huazhong University of Science &Technology. The patients/participants provided their written informed consent to participate in this study (No. 2020E042-E02).
Collection of clinical samples
Patients aged 20-35, menopause for 40-60 days, HCG (+) and early uterine ultrasound found the original pericardial beats of the pregnant sac, but the disappearance of the later stage, were diagnosed as missed abortion, who had a history of one or more unexplained abortion in the past. Four cases of uterine decidual tissue without gene chromosomal abnormalities were taken as the URSA group, and four patients of uterine decidual tissue from early normal pregnancy (indicating the gestational sac and original cardidial beats) requiring artificial abortion to terminate pregnancy were collected as the Control group. The clinical characteristics of the included participants were shown in Table 1.
Isolation of macrophages from tissues samples
Macrophages were isolated from decidual tissue using the conventional adherent method. Tissue samples (weighing about 5-8 g) from each patient were washed twice with sterile phosphate-buffered saline (PBS, Gibco) to remove visible blood clots. The tissue was sheared beforehand and added to a 10 cm sterile cell culture dish along with 2 ml of pancreatic enzyme analog (ATV, TrypLE™Express) at 37°C for 15 mins in a thermostatic cell incubator. Then, 50ml sterile centrifuge tubes were prepared, each corresponding to a patient's tissue sample and marked separately. A 70 μm cell filter (Biosharp, Labgic, Beijing, China) was placed at the mouth of each tube. The ATV-digested decidual tissue was removed from the cell incubator, placed on the corresponding filter screen, and ground with 5 ml of sterile syringe and PBS. The cell suspension was collected in the centrifuge tube under the filter screen. After collection, a volume of 40 ml of PBS was added, thoroughly mixed, and then centrifuged at room temperature for 5 minutes at a speed of 1500 rpm. The resulting supernatant was discarded, and another 40 ml of PBS was added, mixed thoroughly, and centrifuged again at 1500 rpm for 5 minutes at room temperature. Once again, the supernatant was discarded, and this time 15 ml of PBS was added. Human red blood cell lysates, previously diluted to 1× with sterilized dd H2O, were added to the prepared cell suspension at a 1:1 ratio, thoroughly mixed at room temperature, and then placed in a black light protection box for 15 minutes. Following this, the cell suspension was removed, centrifuged at 1500 rpm for 5 minutes at room temperature, and the supernatant was discarded. Subsequently, 40 ml of PBS was added, thoroughly mixed, and centrifuged at 1500 rpm for 5 minutes at room temperature. Once again, the supernatant was discarded. Based on the amount of cell precipitation in the lower layer, the cells were resuspended in 8-10 ml of complete medium prepared with Gibco RPMI1640 medium + 10% Gibco fetal calf serum (FBS) + 1% double-antibody (penicillin + streptomycin, PS) + 1% 4-2-hydroxyethyl-1-ethylonic acid (HEPES). The cell count was measured, and 2 ml of the cell suspension was spread into a six-well plate for each patient sample. After a period of 6 hours, the RPMI 1640 complete medium was replaced, and the condition of cell adhesion was observed using a microscope. The cells were replaced every 1-2 days thereafter and collected after 5-7 days. The entire process of sample collection was completed in the biosafety cabinet. After discarding the upper cell medium, 2 ml of PBS was added to each well, and the attached macrophages were rinsed by gently shaking the plate. Next, 300 µl ATV was added, and the surface was sprayed with 75% alcohol sterilized and digested in a 37°C constant static cell incubator for 15 min. After the adherent cells became suspended under the 40x light microscope, digestion was terminated by adding sterile PBS (1 ml) to each well, and the cell suspension was transferred to a new sterile EP tube. Because there were fewer cells in each patient under the light microscope, cell samples from 4 patients in the URSA group and 4 patients in the Control group were combined.
Cell culture and polarization, VX765 treatment
The THP-1 cell line was a gift from Professor Xi Zhou (LRV-Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China). The THP-1 cells were cultured in RPMI 1640 medium (Gibco, Thermo Fisher, USA) supplemented with 10% fetal bovine serum (Gibco, Thermo Fisher, USA), 1% penicillin, 1% streptomycin and 1% 4- (2-hydroxyethyl) -1-piperazine ethylene sulfonic acid (Gibco, Thermo Fisher Scientific, USA) in an incubator containing 5% CO2 at 37 oC. The cell polarization was induced by incubating THP-1 cells (106/ml) with phorbol 12-myristate 13-acetate (PMA) at a final concentration of 100 ng/ml (#P1585, Sigma, USA) for a 24-h period. This caused the THP-1 cells to differentiate into M0 macrophages. To further polarize the M0 macrophages, interferon-γ (IFN-γ) at a concentration of 20 ng/ml (#285-IF, R&D Systems, USA) and lipopolysaccharide (LPS) at 10 pg/ml (#L2630, Sigma, USA), Interleukin4 (IL-4) at 20 ng/ml (#204-IL, R&D Systems, USA) and interleukin13 (IL-13) at 20 ng/ml (#213-ILB, R&D Systems, USA), were added to the complete medium for 48 hours, resulting in the polarization of M0 into M1 and M2 macrophages respectively.
In addition, during the polarization of M1 macrophages, the caspase1 inhibitor VX765(#HY13205, MCE, working concentration: 25 µM) and equal amounts of dimethyl sulfoxide (DMSO, the solvent of VX765, 2.5 µl/10ml) were added, together with IFN-γ and LPS.
Knockdown of TRIM38 and MITA in THP-1 cells
Lentiviral particles were used to knock down the TRIM38 and MITA genes in THP-1 cells. The particles targeting TRIM38 were obtained from Santa (#sc-95352-V, USA) and had a pool-sequence of GATCCGTACAGATTCAGAGACAAATTCAAGAGATTTGTCTCTGAATCTGTACTTTTT+GATCCGTAGACTGAGGGACTATGATTCAAGAGATC ATAGTCCCTCAGTCTACTTTT+GATCCCTGTCTCCTTGGAACTTCATTCAAGAGATGAAGTTCCAAGGAGACAGTTTTT, with a titer of 106 TU/ml. The particles targeting MITA were obtained from GenePharma (#D01001, China) and had a sequence of GCTGTCCATCTATTTCTACTA, with a titer of 108 TU/ml. The vector used for the MITA particles contained GFP green fluorescence. Blank lentiviral particles were obtained from GenePharma (#D03JZ, China). Transduction was carried out with a multiplicity of infection (MOI) of 1:100, as per the manufacturer's instructions. Knockdown efficiency was confirmed through qRT-PCR and western blot analysis. THP-1 cells were polarized into M1 and M2 macrophages after knockdown of TRIM38 or MITA, and labeled as shTRIM38-M1, shTRIM38-M2, shMITA-M1, and shMITA-M2, respectively. When both TRIM38 and MITA were knocked down, THP-1 cells were polarized into M1 and M2 macrophages and labeled as shTRIM38+shMITA-M1 and shTRIM38+shMITA-M2, respectively.
Transfection of 293T cell
The 293T cell line was provided as a gift from Professor Xi Zhou of LRV-Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China. The 293T cells were cultured in DMEM medium (Gibco, Thermo Fisher Scientific, USA) and maintained in an incubator at 37°C with 5% CO2. The following plasmids were established by Miaolingbio, China: Flag-tagged TRIM38 plasmid (Flag-TRIM38), Flag-tagged TRIM38 plasmid without the Ring-Finger domain (Flag-TRIM38 (d-RF)), Flag-tagged TRIM38 plasmid without the B-BOX domain (Flag-TRIM38 (d-BB)), Flag-tagged TRIM38 plasmid without the SPRY domain (Flag-TRIM38 (d-SP)), HA-tagged MITA plasmid (HA-MITA), and His-tagged K48 ubiquitination plasmid (His-K48). Flag-TRIM38, Flag-TRIM38 (d-RF), Flag-TRIM38 (d-BB), and Flag-TRIM38 (d-SP) were co-transfected with 8 μg of HA-MITA and His-K48 plasmids using Opti-MEM (Gibco, Thermo Fisher Scientific, USA) and PEI MAX (SenGene, Shanghai, China), following the manufacturer’s instructions. After 6-8 hours of transfection, the medium was replaced with fresh DMEM medium, and the cells were harvested after incubating for 24 hours.
Flow cytometry and cell sorting
1 mL of each tissue sample suspension was treated with red cell lysate and resuspended in 40 mL of PBS. Subsequently, the samples underwent centrifugation at a speed of 1500 rpm for a duration of 5 minutes. Following the removal of the supernatant, each tube was supplemented with 0.3-0.5% BSA (#V900933, Merck, USA) in PBS, which had been pre-cooled to 4°C, in order to resuspend the cells. The cell suspension was then subjected to centrifugation at 500 g and 4°C for 5 minutes, and this process was repeated once more after discarding the supernatant. The cells were resuspended in PBS to 200 µL, and the cell density was adjusted to 10^6/mL by cell counting. The cell suspension was then passed through a 40 µm cell filter (Biosharp, Labgic, Beijing, China) into a new 1.5 mL EP tube. The filtered cell suspensions were divided into negative control (20 µL), CD14 (20 µL), FVS780 (20 µL), CD86 (20 µL), CD209 (20 µL), and sample tubes (100 µL). The negative control tube directly had PBS added to the resuspension to 300 µL, and the other tubes were filled with the recommended staining ratio (5 µL/100 µL cell suspension). FVS780 (20 µL) with 0.1 µL (1 µL/1000 µL cell suspension), 5 µL of flow antibodies CD14 (#12-0149-42; PE channel, BD Biosciences, USA)/CD86 (#305412; APC channel, Biolegend, USA)/CD209 (#330104; FITC channel, Biolegend, USA) and 0.1 µL of FVS780 (#565388; APC-CY7 channel, BD Biosciences, USA) were added to the sample tubes (100 µL) respectively. The cell suspension in the above EP tubes was fully mixed and then placed in a fully sealed black light avoidance box for staining at room temperature for 30 minutes. After staining, 0.3-0.5% BSA in PBS, pre-cooled at 4°C, was added to each tube to resuspend the cells. The cell suspension was centrifuged at 500 g and 4°C for 5 minutes, and the operation was repeated once after discarding the supernatant. The cell suspension of the above EP tubes was resuspended with PBS to 300 µL, placed on ice together with the negative control to protect from light, and then analyzed by flow cytometry with a FACSAriaTM III (BD Biosciences). Data analysis was performed using FlowJoV10.8.0 software.
THP-1 cells and THP-1 cells with TRIM38 and MITA knockdown were seeded in T75 flasks at a density of 2.5 × 106 cells per flask and differentiated with PMA. After incubation with either IFN-γ and LPS or IL-4 and IL-13, respectively, the cells were washed with cold PBS. The macrophages derived from M1 polarization were stained with flow antibodies of FVS780 and CD86, while M2 was stained with FVS780 and CD209, following the same flow steps as for the tissue. Since the lentiviral particles vector for knocking down the MITA gene contained GFP green fluorescence, CD209 (#330108; APC channel, Biolegend) was used in M2 with MITA knockdown. In other M2 macrophages, CD209 (#330104; FITC channel, Biolegend, USA) was still used. The cells were analyzed by flow cytometry with a FACSAriaTM III (BD Biosciences), and data analysis was performed using FlowJoV10.8.0 software. M1 with FVS780(-) and CD86(+), and M2 with FVS780(-) and CD209(+) were collected in sterile 15ml centrifuge tubes containing RPMI 1640 medium for subsequent experiments.
Real-time Quantitative PCR (qPCR)
the isolation of total RNA from tissues was carried out using Trizol reagent (Takara, Japan), while cells were isolated using a kit from Sangon Biotech (Shanghai, China). The RNA was then reverse-transcribed using the high-capacity cDNA reverse transcriptase kit (TaKaRa, Japan) according to the manufacturer's instructions. qPCR assays were conducted using SYBR Green PCR Master Mix (TaKaRa, Japan) and the Fast qPCR System (QuantStudio5, Thermo Fisher, USA). Gene-specific primers were designed and obtained from Ruibo Biology Co., Ltd (Shanghai, China). The primer sequences can be found in Table 2. To normalize gene expression levels, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was chosen as the internal control. Three biological replicates were utilized for each sample. The 2−ΔΔCt method was employed to calculate and normalize the gene expression levels relative to the internal controls.
Extraction of supernatants and cell components
The cell supernatants were collected in sterile EP tubes. Trichloroacetic acid (TCA, Sinopharm Chemical Reagent Co., Ltd) was added at a ratio of 1:10 and mixed well. The mixture was placed in a 4 oC refrigerator overnight and then transferred to a 4 oC low-temperature centrifuge at 12000 g for 10 mins. The upper liquid was discarded and the protein precipitate at the bottom of the tube was gently washed with 1 ml of sterilized PBS. The PBS was then taken away, and 60-100 µl of western & IP lysate was added to dissolve the precipitation, depending on the amount of precipitation. Next, 5X loading buffer was added and the sample was cooked in a 95 oC water bath for 10 mins.
Western blotting
Cell lysis was performed using Western & IP lysates (Beyotime, Shanghai, China) for cells and RIPA lysate (GBCBIO Technologies, Guangzhou, China) for tissues. The protease inhibitor cocktail (Solarbio, Beijing, China) was added at a ratio of 1:100. Following lysis, the cells or tissues were transferred into tubes designed for cell or tissue crushing. Subsequently, they were centrifuged at 12,000 g for 15 minutes at a temperature of 4°C. The resulting supernatants were extracted separately and mixed with 5X loading buffer. To facilitate protein denaturation, the samples were boiled at 95°C for 10 minutes. Afterward, the collected samples were subjected to electrophoresis on a 10% SDS-PAGE gel at a voltage of 80 V for 2 hours. Following electrophoresis, the proteins were transferred to a membrane using a current of 350 mA for 2 hours. To prevent non-specific binding, the membrane was blocked with 5% skim milk for 1 hour and subsequently incubated overnight at 4°C with the appropriate primary antibodies. The western blot bands derived from cells or tissues were visualized using an enhanced chemiluminescence (ECL, MILLIPORE, USA) developer and a chemiluminescence imaging system (Shanghai Qinxiang Scientific Instrument Co., Ltd.).
The primary antibodies used in this study are listed below: rabbit monoclonal [EPR13130-55] to MITA (#239074, Abcam, USA), mouse monoclonal anti-human TRIM38 (#MA5-26235, Invitrogen), rabbit monoclonal [EPR19672] to Caspase-1 (#207802, Abcam, USA), rabbit monoclonal [EPR20829-408] to cleaved N-terminal GSDMD (#215203, Abcam, USA), rabbit monoclonal [EPR19829] to GSDMD (#210070, Abcam, USA), and rabbit monoclonal [EPR26492-84] to cGAS (#302617, Abcam, USA). Rabbit anti-GAPDH (#181602, Abcam, USA) was used as the internal control. IgG (HRP) goat anti-rabbit antibody (#6721, Abcam, USA) and IgG (HRP) goat anti-mouse antibody (#6789, Abcam, USA) were used as the secondary antibodies.
Co-Immunoprecipitation (Co-IP)
Endogenous Co-IP was performed on decidual tissues, M1 and M2 macrophages using Western & IP lysates (Beyotime, Shanghai, China).
To perform immunoprecipitation, monoclonal antibodies against MITA (#239074, Abcam, USA) were utilized to immunoprecipitate tissue and cell lysates. In the case of exogenous co-immunoprecipitation (Co-IP), 293T cells were collected 24 hours after transfection and subsequently lysed using a buffer containing 25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1 mM EDTA, and a proteinase inhibitor cocktail (Solarbio, Beijing, China). Whole cell lysates were subjected to immunoprecipitation using monoclonal antibodies against Flag (#2368, CST, USA), HA (#236632, Abcam, USA), or His (#12698, CST, USA) in the presence of magnetic beads (MCE, USA). For both endogenous and exogenous Co-IP, Normal Rabbit IgG (#2729, CST, USA) was employed as a negative control. To minimize non-specific interference, all lysates were incubated with 10 µl magnetic beads (MCE, USA) on a rotating shaker at 4°C for 2 hours. Generally, 1-2 μg of commercial antibody was added to 500 μl of tissue or cell lysates, and the mixture was incubated overnight at 4°C. The immunocomplexes captured on the affinity gel or magnetic beads were thoroughly washed with lysis buffer and subsequently eluted with SDS loading buffer through boiling for 5 minutes. Subsequently, the samples were subjected to SDS-PAGE and analyzed by Western blotting.
Immunohistochemistry staining of TRIM38 and MITA in decidual tissues
The collected decidual tissues underwent fixation in 4% paraformaldehyde and subsequent embedding in paraffin. Microtome (HM355; Microm) was used to cut sections (4 μm), which were then deparaffinized through a series of incubations: 10 minutes in Xylene, followed by 100%, 96%, and 70% ethanol, and deionized water. Antigen retrieval was performed using citrate buffer (pH 6.0), and to remove endogenous peroxidase, the sections were incubated with 3% hydrogen peroxide for 30 minutes. For staining, the sections were blocked with 3% bovine serum albumin at room temperature for 30 minutes and then incubated overnight at 4°C with the following primary antihuman antibodies: rabbit monoclonal [EPR13130-55] to MITA (#239074, Abcam, Dilution 1:4000) and mouse monoclonal anti-human TRIM38 (#MA5-26235, Invitrogen, Dilution 1:150). After washing with phosphate-buffered saline three times for 5 minutes each, the sections were incubated with corresponding secondary antibodies (goat anti-rabbit antibody, 1:400, #5220-0336, SeraCare; goat anti-mouse antibody, 1:400, #5220-0341, SeraCare) for 1 hour at room temperature. To visualize the expression of MITA and TRIM38 in the decidua, diaminobenzidine chromogen was utilized. Finally, the sections were counter-stained with hematoxylin.
Triple immunofluorescence staining of decidual tissues
The obtained decidual tissues were fixed using 4% paraformaldehyde and subsequently embedded in paraffin. Using a microtome (HM355; Microm), sections with a thickness of 4 μm were obtained. These sections were then deparaffinized by treatment with Xylene for 10 minutes, followed by sequential washing with 100%, 96%, and 70% ethanol, as well as deionized water. Antigen retrieval was performed using citrate buffer (pH 6.0), and endogenous peroxidase was removed by incubating the sections with 3% hydrogen peroxide for 30 minutes. For the triple staining of CD86 + CD206 and TRIM38, the sections were treated with 3% bovine serum albumin at room temperature for 30 minutes, followed by overnight incubation at 4°C with the primary anti-human antibody CD206 (#60143-1-Ig, Proteintech, Dilution 1:400). After washing the sections with PBST three times, each for 5 minutes, a secondary antibody (1:400, #5220-0341, SeraCare) was applied and incubated at room temperature for 1 hour. Subsequently, the sections were washed with PBST three times, each for 5 minutes, and incubated with Alexa Fluor™ 488 tyramide for 30 minutes at room temperature. Then, the sections were treated again for antigen retrieval and endogenous peroxidase quenching, followed by blocking. After that, the staining of CD80 was performed by incubating the sections with the corresponding primary antibody against CD80 (#bs-1035R, 1:200, Bioss), secondary antibody (#5220-0341, 1:400, SeraCare) and Cy3 tyramide. Similarly, staining of TRIM38 was detected by incubating with the corresponding primary antibody against TRIM38 (#334BAA80, 1:100, Invitrogen), secondary antibody (#5220-0341, 1:400, SeraCare), and Cy5 tyramide. The nucleus was stained with DAPI.
A similar protocol was used for the triple staining of CD86 + CD206 and MITA, where after staining CD86 and CD206, the staining of MITA was detected by incubating with the corresponding primary antibody against MITA (#ab239073, 1:100, Abcam), secondary antibody (#5220-0336, 1:400, SeraCare), and Cy5 tyramide. The nucleus was stained with DAPI. Signal analysis was carried out using fluorescence microscopy (Olympus BX50) and digitally photographed.
Statistical analysis”
All the statistical analysis was performed using GraphPad Prism 9 (GraphPad Software, La Jolla, USA)”. “All the data were presented as mean ± standard deviation. Significant differences between/among different groups were assessed using unpaired t-test or one-way ANOVA followed by Bonferroni’s multiple comparison tests”. “P < 0.05 was considered statistically significant”.
