Effect of chronic F- exposure on ionotropic glutamate AMPA and NMDA receptors in rat hippocampus

doi:10.21203/rs.3.rs-3131594/v1

Download PDF

Research Article

Effect of chronic F- exposure on ionotropic glutamate AMPA and NMDA receptors in rat hippocampus

https://doi.org/10.21203/rs.3.rs-3131594/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Our previous study has shown that long-term consumption of excessive fluoride (F⁻) impaired spatial learning and formation of long-term memory of Wistar rats. The present study examined alterations in expression of a few subunits composing glutamate AMPA and NMDA receptors in hippocampal cells in response to F⁻ poisoning at transcriptional and translational levels, as well as their subcellular distribution and phosphorylation state. The rats were given water with background 0.4 (control), 5, 20 and 50 ppm F⁻ (as NaF) for 12 months. The expression of Gria1, Gria2 and Gria3 genes remained stable in the hippocampal tissues of F⁻-exposed animals. However, long-term F⁻ intake resulted in translocation of GluA2 subunits of AMPA receptors from membranes to cytosol and opposite trafficking of GluA3 subunits, whereas subcellular distribution of GluA1 subunits was unaltered. These changes were accompanied by increased phosphorylation of GluA1 and GluA2 subunits in cytosol and/or membranes. The expression of Grin1 gene and GluN1 subunits of NMDARs were comparable in hippocampal cells of rats from all groups. In contrast, F⁻ poisoning was accompanied by a rise in both Grin2a and Grin2b mRNA content and enhanced levels of total and phosphorylated forms of GluN2A and GluN2B subunits in/or cytosol and membranes. Such changes indicate the predominance of Ca²⁺-permeable AMPARs and altered ratio between different types of NMDARs subunits at membranes of hippocampal cells of F⁻-exposed rats, which may underly the disturbances in cognitive capacities of animals.

rat

hippocampus

AMPARs

NMDARs

gene expression

subcellular distribution

phosphorylation

Fluoride is ubiquitously distributed in the nature due to release from natural (volcanic and geothermal activity, mineral leaching) and anthropogenic (coal burning, metals and fertilizers processing) sources to atmosphere and water [1, 2]. In endemic areas, high levels of naturally occurring F^- (above permissible level of 1.5 mg/L) are found in drinking water available for daily human needs and farm animal livestock. In developed countries, an intentional F^- supplementation of drinking water, salt, milk and especially dental products to protect against tooth caries is a second but not less important pathway of F^- consumption. Chronic exposure to F^- at industrial metals, fertilizers and insecticides producing sites or accidental poisoning with F–containing chemicals at home are also not rare [1, 2]. As a result, epidemiological observations of humans and experimental animal studies have demonstrated a wide spectrum of F–induced health disorders such as dental and skeletal fluorosis and damage to various soft tissues. Being the most reactive element of Periodic table, F^- is able to induce a large variety of intracellular alterations like inhibition of metalloproteins, impairment of mitochondrial functions and oxidative stress [1, 3, 4]. Most important, many recent works have raised a concern on possible F^- neurotoxicity including increased risk of neurodegenerative problems such as Parkinson’s disease, Alzheimer’s disease, autism spectrum disorders, and even susceptibility to brain tumors [4–9]. Different studies have suggested that drinking highly fluoridated water is related to neurological disorders in children and adolescents and may significantly decrease the Intelligence quotient (IQ) score and induce difficulties with attention [10–12]. Other studies, however, claim an absence of thorough clinical investigations and convincing scientific evidences in favor of association between long-tern F^- intake and neurotoxicity, while the existing findings are insufficient or non-correlative [13–14]. Such controversies highlight the necessity of new researches focused on the mechanisms related to cognitive capacities of F–exposed humans and animals.

It is known that fluoride ions relatively freely transit hematoencephalic barrier and accumulate in virtually all brain structures to a degree which directly reflects the level of consumption. In hippocampus of F⁻-exposed animals, for example, F⁻ content was found to be 4-7-times higher in comparison to control (summarized in [3]). Our previous works on rats [15, 16] have shown that long-term consumption of relatively high F⁻ doses with drinking water resulted in pathological alterations and death of neurons in CA1 and CA3 zones of hippocampus and impairment of spatial learning and formation of memory. Moreover, such cognitive decline was associated with alterations in protein expression of Ca²⁺-dependent signaling molecules implicated in long-term potentiation (LTP).

The processes of learning and memory formation are believed to be based on synaptic plasticity, whereas cognitive decline and memory impairment are strongly associated with perturbations in synaptic processes and excitatory neurotransmission. F⁻ poisoning was shown to be accompanied by alterations in the levels of neurotransmitters including glutamate [3]. Thus, changed glutamate content was reported in the brain of both adult rats given excessive F⁻ for a few months [17–19] and in hippocampus of rat pups exposed to F⁻ prenatally and for 12 weeks after birth [20].

Glutamate provides its functions through a variety of receptors clustered at postsynaptic membranes and classified according to their agonist selectivity - ionotropic AMPA (a-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid), NMDA (N-methyl-D-aspartate) and kainite receptors, and metabotropic glutamate receptors (mGluR) [21, 22]. AMPA receptors (AMPARs) are the central mediators of rapid excitatory glutamatergic synaptic transmission and plasticity playing major role in molecular substrates of learning and memory [23–26]. In mammalian brain, AMPARs are tetrameric cation-permeable receptors composed of various combinations of pore-forming subunits GluA1-GluA4 encoded by Gria1-Gria4 genes. Such diversity allows to control biophysical properties and traffic of AMPARs to the synapses thus regulating the synaptic strength and plasticity. In excitatory neurons of mature hippocampus, AMPARs are predominantly exist as two types at approximately similar ratios: most common heterodimers possessing GluA1 and GluA2 subunits (GluA1/2), and that composed of GluA2 and GluA3 subunits (GluA2/3). GluA2-containing AMPARs are impermeable for Ca²⁺, whereas that with GluA1, GluA3 and GluA4 transit Ca²⁺ following activation. GluA1-possessing AMPARs are inserted into synapses following LTP and play an important role in formation of memory. GluA2/3 are not significantly involved in LTP, neurotransmission or memory formation, but modulate the synaptic strength. A large body of evidence links GluA2-containing AMPARs with long-term depression (LTD). GluA3 exist at many CNS synapses and contributes to formation of functional AMPARs, which also suggests a key role of this subunit in brain functions. GluA4 is expressed in early development, although some of them survive until adulthood.

NMDARs are known to implicate in induction of long-term synaptic plasticity associated with transcription-dependent processes, because stimulation of NMDARs regulates gene transcription and affects global protein synthesis [27–29]. The family of NMDARs includes three types of subunits, GluN1, GluN2 and GluN3. The functional NMDARs are highly permeable to Ca²⁺ and represent tetramer complexes composed of two obligatory GluN1 subunits and two GluN2, GluN3 or GluN2/GluN3 subunits. GluN2A and GluN2B are the most abundant regulatory subunits in cognitive-related brain structures. GluN2A-containing NMDARs are located primarily at synaptic sites and believed to implicate in protective pathways, whereas GluN2B-containing receptors are distributed mainly at extrasynaptic sites and increase neuronal vulnerability. GluN2B-containing NMDARs are predominant during prenatal life. Following development, the number of GluN2A subunits increases, while GluN2B expression remains constant, resulting in the shift of GluN2A/GluN2B ratio known as “NMDAR developmental switch”. Modifications in this relationship have been associated with learning and memory, but also with different pathologies.

The goal of present study was a thorough evaluation of possible changes in expression of a few major subunits composing AMPARs and NMDARs in rat hippocampus following long-term excessive F⁻ consumption at transcriptional and translational levels, as well as their subcellular distribution and phosphorylation state. The work was focused on hippocampus because it has been proven to provide the synaptic base for initiation, formation and consolidation of memory.

Animals

Fourty male Wistar rats of minimal disease status procured from the Animal Facility of Sechenov Institute were used for the study. They were maintained under standard conditions of vivarium (temperature of 22–25 ^oC and 12 h light/12 h dark cycle) and given food and water ad libitum. Low-F⁻ natural-ingredients diet was manufactured following recommendations of Nutrient Requirements of Laboratory Animals [30]. All procedures were in accordance with Animal Welfare act (2006) and approved by Bioethics Committee of Sechenov Institute of Evolutionary Physiology and Biochemistry (Protocol # 9/2021 of 24.09.2021).

The scheme of experiments was the same as in our previous works [15, 16]. At the age of 6 weeks (PND 42) the animals were randomly assigned into 4 groups. The control rats were given regular tap water with natural background F⁻ content of 0.4 ppm provided by the local water supplier. The animals from other groups were administered the same water supplemented with 5, 20 and 50 ppm F⁻ (as NaF) during 12 months. The doses of F⁻ were comparable to those existing in water available for humans in the regions of endemic fluorosis taken into account that the rate of F⁻ clearance in rats is much higher than that in humans. For instance, F⁻ content of 1.72 µM in the serum of rats given 22.6 ppm F⁻ [31] was similar to F⁻ concentration measured in the plasma of humans consuming 2–3 ppm F⁻ [32, 33]. In our previous study, the consumption of 20 ppm F⁻ by the rats for year yielded 5.9 ± 0.4 µM F⁻ in plasma [34].

Examination of cognitive capacities

Morris water maze test

Within the last four weeks of F⁻ exposure the rats were subjected for behavior experiments. The efficiency of spatial learning of rats and formation of memory was evaluated by Morris water maze test as described in our previous work [16]. Briefly, the experiments were performed in a circular plastic pool filled with opaque water (temperature of 22–24 ^oC) which was changed every day. The pool was divided into 4 quadrants (north, south, east and west) used as the starting points from which the animals were placed in the water. Before the beginning of test series, the rats were habituated to water by swimming for 60 seconds. Next day, the escape platform was fixed in the geometric center of southwest quadrant and submerged 1 cm below water surface, and four objects of various shape were placed on the walls of pool to help the animals to learn an environment. The rats were allowed to find the platform and stay on it for 15 seconds. During the next 5 consecutive days, the animals were subjected for hidden platform acquisition test from different sides. The rats were placed into water and allowed to find the platform for 60 seconds. The time required to locate the platform (escape latency) was established. When the rat failed to find the platform within testing time, it was guided there by researcher, and escape latency for these animals was fixed as 60 s. After finding the platform, the rats were allowed to rest on it for 15 s. Each day, four consecutive swimming attempts from different starting points with a rest interval of 15 s between them were performed. The swimming time, pathway, and speed were recorded using ANY-maze behavioral Video Tracking System software (Stoelting Co., USA). After session, the animals were toweled, dried and returned to their housing cages.

Novel object recognition test (NOR)

The formation of short-term and long-term memory of animals was evaluated using novel object recognition test. A day before testing, the rats were habituated to experimental cage by allowing to explore it for 5 min in the absence of objects. The training session was performed first at the next day. The rats were placed in the center of cage in front of two identical objects and allowed to examine them for 5 min. The formation of short-term memory was examined in 1 h after training, while the efficiency of long-term memory – in 24 h. During both testing sessions, one of familiar objects was replaced with new one. All objects were odorless glasses of different shape and color but similar in volume and height. The recognition was considered successful if the rats touched the objects with nose or hands. The objects were cleaned with 75% ethanol solution after each rat to remove the smell of previous animal. Total exploration time was recorded with video system. The results of both testing sessions were analyzed by calculating discrimination index (%): DI = (novel object) / (novel object + familiar object) x 100%.

mRNA extraction and cDNA synthesis

In two weeks after the end of behavior tests the rats were anesthetized with Zoletil-100 by intraperitoneal injection (100 mg/kg BW) and sacrificed by dissecting abdominal aorta. The whole brains were removed and placed in ice-cold conditions. The hippocampi from one hemisphere were quickly isolated and incubated in the reagent Intact RNA (Eurogene, Russia, Moscow) for 24 hours at 4 ^oC to stabilize RNA. Then the samples were homogenized in the appropriate volume of monophasic aqueous ExtractRNA reagent (Eurogen, Russia, Moscow) according to the manufacturer's instructions. Total RNA concentration (absorption at 260 nm) and purity (260/280 nm absorption ratio) were evaluated using a CLARIOstar Plus multimodal reader (BMG LABTECH, Ortenberg, Germany). The absorption ratio at 260/280 nm exceeded 1.8 in all samples, which indicated their high purity. Total RNA (1µg) was reverse-transcribed into cDNA using the MMLV RT kit for synthesis of first cDNA chain (Eurogen, Russia, Moscow) in accordance with the manufacturer's instructions. The reaction mixture was incubated for 5 min at 25 ^оC, 60 min at 42 ^оC and 5 min at 70 ^оC. The cDNA was diluted 10-fold before the PCR step. The primers used in the study were provided by Eurogen (Russia, Moscow) and are listed in the Table 1. The sequences of forward and reverse primers pairs for each chosen gene were checked, and the melting temperature was optimized using Primer Blast tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast). The product size was 70–250 base pairs and GC content was 40–60%.

Table 1

Details of the primers used in the study
Target gene / Amplicon length	Accession	Sequence / GC content	T(^oC), time (s)	Amplification efficiency (%) / Correlation coefficient (R2)
Rattus norvegicus glutamate ionotropic receptor NMDA type subunit 1 (Grin1) / 208 bp	NM_017010.2	Forward: TCTGTCCGCAGCCACAATAG Reverse: GGCATCACCACTGAATACCG	55, 30	100.73 / 0.994
Rattus norvegicus glutamate ionotropic receptor NMDA type subunit 2A (Grin2a) / 178 bp	NM_012573.4	Forward: GCTCTAAGCCTCACCAGCAA Reverse: TGATACACCCCAAACCAGGC	57, 30	97.79 / 0.995
Rattus norvegicus glutamate ionotropic receptor NMDA type subunit 2B (Grin2b) / 197 bp	NM_012574.1	Forward: AGGAACCAGGCTACATCAAAAA Reverse: TAGTGATCCCACTGCCATGTAG	55, 20	94.72 / 0.997
Rattus norvegicus glutamate ionotropic receptor NMDA type subunit 3A (Grin3a) / 205 bp	NM_138546.2	Forward: GAAGAAAAGCAGCCACGTTC Reverse: GGTTTTGTCCTTCCTCGTCA	55, 20	94.1 / 0.967
Rattus norvegicus glutamate ionotropic receptor AMPA type subunit 1 (Gria1) / 114 bp	NM_031608.1	Forward: GGCTCCCTTGACCATAACCT Reverse: ACACCTGGCTTGGACTTCTG	59, 20	100.74 / 0.994
Rattus norvegicus glutamate ionotropic receptor AMPA type subunit 2 (Gria2) / 145 bp	NM_017261	Forward: GCATCGCCACACCTAAAGGA Reverse: TTACTTCCCGAGTCCTTGGC	58, 20	97.37 / 0.994
Rattus norvegicus glutamate ionotropic receptor AMPA type subunit 3 (Gria3) / 183 bp	NM_001112742.1	Forward: CTCCTGATCCTCCCAATGAA Reverse: TCAGGAAAGCAGCAAGGTTT	55, 15	101.14 / 0.994

Quantitative real-time PCR

Quantitative real-time qPCR was performed on C1000 Touch Thermal Cycler equipped with the CFX96 real-time detection system (Bio-Rad, Hercules, CA, USA). The reactions were carried out in a volume of 25 µl using qPCRmix-HS SYBR Master Mix (Eurogen, Russia, Moscow). The mixture contained 17 µl of dH₂O, 2 µl of direct and reverse primer (500 nM), 1 µl of cDNA and 5 µl of qPCRmix-HS SYBR. The cycling protocol included initial denaturation at 95 ^oC for 5 min followed by 40 amplification programs each consisting of denaturation step at 95°C for 5 s, annealing step at 57–63°C (depending on the optimal temperature for each pair of primers) for 10 s, and extension step at 72°C for 30 s. Fluorescence was measured at the end of each extension step. All RT-qPCR experiments were performed in three repeats. Control samples without a matrix were negative in all experiments. The specificity of amplification was routinely verified after amplification by analysis of melting curves. The amplicons were subjected to thermal denaturing cycle consisting of incubation at 65°C for 5 s and slow heating to 95°C, and the fluorescence was measured in the slow heating phase.

The qPCR curves were analyzed using CFX Manager software (Bio-Rad Laboratories, Inc., Hercules, California, USA). The expression of target genes was normalized to that of Eef1a1/Ppia pair of reference genes which were chosen based on our previous work showing the highest stable expression [35]. The threshold cycle (Ct) values for target and reference genes were less than 40 for all reactions. The relative expression of genes was estimated by comparative 2 − ΔΔCt method, where ΔCt is the difference between studied and reference genes [36]. The average Ct and standard deviation (SD) values for each qPCR product were calculated from three individual biological repeats.

Western blotting analysis

The hippocampi from the second hemisphere were immediately frozen at -80 ^оС until processing. Whole hippocampi were homogenized in ice-cold RIPA buffer supplemented with protease inhibitor cocktail. The homogenates were centrifuged for 15 min at 1000 g to sediment nuclear material and cell debris, and the supernatants were centrifuged again for 15 min at 11000 g and 4 ^oC to pellet the mitochondria. Then the aliquots of each supernatant were centrifuged for 30 min at 25000 g and 4 ^oC. The resulting supernatants were collected as cytosolic fractions containing various microsomes and vesicles (further referred to as cytosols), whereas the pellets were diluted with small amount of the same buffer and collected as membrane-containing fractions (further referred to as membranes). The samples were frozen at − 80 ^oC until use. Total protein content in the probes was determined by Lowry method.

The proteins in the samples were solubilized, separated by SDS–PAGE in 10% polyacrylamide gels (60 µg/well) and transferred to nitrocellulose membranes. Non-specific membrane binding was blocked for 1 h at room temperature with 5% non-fat dry milk solution. Then the membranes were incubated overnight with primary antibodies against GluA1 (1 : 750), phospho-GluA1 (1 : 750), GluA2 (1 : 750), phospho-GluA2 (1 : 750), GluA3 (1 : 750), GluN1 (1 : 500), phospho-GluN1 (1 : 500), (1 : 200), GluN2A (1 : 500), phospho-GluN2A (1 : 200), GluN2B (1 : 500) and phospho-GluN2B (1 : 200), followed by 1-h treatment with secondary HRP-conjugated antibodies (1 : 1000). Immunostained proteins were visualized by exposure with ECL detection system. To control protein loading, the membranes were striped and re-probed with antibodies against cytosolic protein GAPDH or membrane protein β-аctin (1 : 1000) followed by secondary HRP-conjugated antibodies. Relative protein expression was evaluated by densitometric analysis using ImageJ program (NIH, USA). The optical densities of target proteins were normalized to that of reference (GAPDH for cytosolic and β-actin for membranes) proteins.

RIPA buffer was obtained from Santa Cruz Biotechnology Inc. (USA). Rabbit antibodies to GluA1 (#13185), phospho-GluA1 (#8084), GluA2 (#5306), phospho-GluA2 (#3921), GluA3 (#4676), GluN1 (#5704), phospho-GluN1 (#3381), GluN2A (#4205), phospho-GluN2A (#4206), GluN2B (#4207) and phospho-GluN2B (#4208) were purchased from Cell Signaling Technology (Netherlands). Mouse monoclonal antibodies against GAPDH (sc-32233) and β-actin (sc-517582) were obtained from Santa Cruz Biotechnology. Secondary antibodies and chemiluminescent ECL system were purchased from GE Health Care/Life Sciences (UK), X-ray film, developer and fixer solutions were from CEA (Sweden).

Statistics

The statistical analysis was performed using GraphPad Prism 6 software (San Diego, CA, USA). The results of experiments were subjected to one-way ANOVA multiple comparison followed by Bonferroni posthoc test. The data are presented as mean ± SE. The differences were considered statistically significant at p < 0.05.

Influence of excessive F⁻ consumption on memory formation

At the beginning of Morris water maze test (day 1), the rats from all groups including control needed comparable time to locate the hidden platform (Fig. 1). However, starting from the day 2, escape latency registered for animals given all three F⁻ doses was significantly greater than that for control ones, indicating that the efficiency of spatial learning of F⁻-treated rats was lower. Thus, exposure of animals to excessive F⁻ disrupted the processes of spatial learning and formation of long-term memory. In the 1-h session of NOR test, the values of discrimination index calculated for rats from all group were comparable, i.e. the animals exhibited preference for new object (Fig. 1). In 24 h after training, however, DIs calculated for F⁻-poisoned rats were significantly lower than that for control animals, which indicates that they were not able to remember old object and discriminate between new and familiar objects. These results resemble the data obtained in our previous work [16] which also showed that excessive F⁻ consumption did not affect the formation of short-term memory, but impaired long-term memory.

Effect of fluoride on expression of subunits composing AMPA receptors in rat hippocampus

The expression of Gria1 gene encoding GluA1 subunits of AMPA receptors was comparable in hippocampal tissues of control and F–poisoned rats (Fig. 2A). The analysis of subcellular distribution of GluA1 at the protein level has shown that content of native form of GluA1 subunits of AMPARs did not change either in the cytosolic or membrane fractions of rat hippocampus (Fig. 2B and C). However, the expression of phosphorylated (Ser845) form of GluA1 subunits increased in the cytosolic fraction of hippocampal cells of animals consumed all excessive F^- doses (Fig. 2B and C). In membrane fractions, the amounts of phospho-GluA1 subunits remained stable.

The mRNA levels of Gria2 gene encoding GluA2 subunits of AMPA receptors did not differ between the hippocampi of rats consumed excessive F^- amounts and that of control animals (Fig. 3A). However, the pronounced changes were revealed at the protein level. Thus, the relative content of GluA2 protein increased in the cytosolic fraction but decreased in membranes (Fig. 3B and C). Moreover, the similar alterations were observed for phosphorylated (Tyr869/Tyr873/Tyr876) form of GluA2 subunits reaching the statistical significance at 20 and 50 ppm F^-.

The expression of Gria3 gene encoding GluA3 subunits of AMPA receptors was stable in the hippocampal tissues of rats from all groups including that exposed to high F^- doses (Fig. 4A). However, the protein expression level of GluA3 subunits declined in cytosolic fraction, but increased in membranes of hippocampal cells of animals consumed 20 and 50 ppm F^- (Fig. 4B and C).

Since many neuropathological conditions are accompanied by the shifts in expression levels of different subunits composing AMPARs, we calculated the ratio between genes and proteins of GluA subunits composing Ca²⁺-impermeable and Ca²⁺-permeable receptors. This analysis did not reveal any changes in the Gria1/Gria2 mRNA ratio in the hippocampal cells of rats consumed 5 and 20 ppm F^-, but showed statistically its significant elevation at 50 ppm F^- (Fig. 5A). The GluA1/GluA2 ratio for both native and phosphorylated forms of proteins remained unaltered in cytosolic fraction (not shown), but considerably enhanced in membranes of animals from 20 and 50F groups (Fig. 5B). The Gria3/Gria2 ratio did not change as well (Fig. 5C), although the GluA3/GluA2 ratio decreased in the cytoplasm (Fig. 5D) but increased in membrane fractions (Fig. 5E). Besides, chronic F^- poisoning led to a rise in GluA3/GluA1 ratio in hippocampal membranes of rats given 20 and 50 ppm F^- (Fig. 5F).

Effect of fluoride on expression of subunits composing NMDA receptors in rat hippocampus

The expression level of Grin1 gene encoding GluN1 subunit of NMDA receptors did not respond to excessive F^- consumption by the animals (Fig. 6A). Accordingly, increasing F^- concentrations did not change the subcellular distribution of GluN1 subunits. The relative content of both native and phosphorylated (Ser890) forms of GluN1 in the cytosolic and membrane fractions of hippocampal cells was stable as well (Fig. 6B and C).

The mRNA level of Grin2a gene encoding GluN2A subunit of NMDA receptors significantly increased in the hippocampal cells of rats consumed all three excessive F^- doses in comparison to control animals (Fig. 7A). The expression of both total and phosphorylated (Tyr1246) forms of GluN2A subunits were enhanced as well (Fig. 7B and C).

The expression of Grin2b gene encoding GluN2B subunit of NMDA receptors was unchanged in the hippocampus of rats exposed to 5 ppm F^-, but considerably increased in the cells of animals given 20 and 50 ppm F^- (Fig. 8A). These changes were accompanied by a rise in the levels of both total and phosphorylated (Tyr1472) forms of GluN2B subunits (Fig. 8B and C).

The mRNA content of Grin3a gene was comparable in hippocampal cells of control rats and animals treated with 5 and 20 ppm F⁻, but slightly increased in the cells of rats from 50F group (Fig. 9).

The Grin2a/Grin2b, Grin2a/Grin1 and Grin2b/Grin1 expression ratios did not change in the hippocampus of rats exposed to excessive F⁻ (Fig. 10A, C and E). The ratio between native GluN2A/GluN2B subunits in the cytosol was unaltered as well (not shown), but significantly increased in membranes of hippocampal cells from all F⁻-poisoned rats, while that of phosphorylated forms was enhanced in hippocampi of animals given 50 ppm F⁻ (Fig. 10B). In contrast, the changes in GluN2A/GluN1 and GluN2B/GluN1 ratios were observed predominantly in the cytosolic fraction (Fig. 10D and F).

The results of present study show a complicated picture of alterations in expression of different subunits composing AMPA and NMDA glutamate receptors in the hippocampus of F⁻-exposed rats at both transcriptional and translational levels. Such changes indicate the disturbances in glutamatergic system in the hippocampus cells and can be at least partially underly the decline in cognitive capacities of animals (Fig. 1).

First, we observed the pronounced changes in subcellular distribution and/or phosphorylation state of all examined types of GluA subunits, although the expression of corresponding Gria genes was relatively stable. GluA2 subunits exhibited considerable redistribution from membranes to cytoplasm indicating their increased intracellular retention (Fig. 3). In contrast, GluA3 subunits translocated from cytosol to membranes (Fig. 4). Moreover, phosphorylated GluA1-Ser845 subunits were revealed in the cytoplasm of hippocampal cells (Fig. 2), while phospho-GluA2 (Tyr869/Tyr873/Tyr876) subunits were observed in both cytosolic and membrane fractions (Fig. 3). As a result, chronic F⁻ poisoning was accompanied by a shift between Ca²⁺-impermeable GluA2 and Ca²⁺-permeable GluA1 and GluA3 subunits in membrane AMPARs (Fig. 5).

However, the impact of F⁻ on AMPARs has not been consistently studied before, either in the brain tissues of fluorotic animals or in the F⁻-treated neuronal cells. One of scarce works attempting to examine an influence of F⁻ on synaptic plasticity is that of Yang et al. [37] which showed that depressed LTP in hippocampal microglial cells following exposure of rats to 120 ppm F⁻ for 12 weeks was associated with decreased protein expression levels of GluA2. The expression of GluA2 mRNA was also significantly reduced in the brain of mouse pups exposed to 25–100 ppm NaF prenatally and during lactation, although no changes were observed for GluA1 level [38].

The changes in synaptic AMPARs number and subunit composition which can last from minutes to days are believed to be one of the primary mechanisms that regulate diverse forms of synaptic plasticity and affect cognitive capacities [39–41]. On the other hand, subcellular AMPARs redistribution, such as replacement of GluA2-containing Ca²⁺-impermeable AMPARs with inwardly rectifying GluA1-dominant Ca²⁺-permeable AMPARs at synaptic sites is observed in many neuropathological conditions and neurodegenerative disorders [41]. For instance, GluA2 protein level was considerably lower in membrane fractions, but higher in the cytosolic vesicles isolated from dorsal spinal cord of Sprague-Dawley rats underwent peripheral nerve injury [42] or suffered from diabetic neuropathy [43]. Ischemic insult promoted endocytosis of GluA2-containing AMPARs and facilitates delivery of GluA2-lacking AMPARs to synaptic sites [44]. Internalization and reduced membrane number of AMPARs associated with LTD and synaptic failure has been linked with Alzheimer’s disease (AD) [45]. Thus, age-dependent reduction in synaptic AMPARs density in pyramidal cells and interneurons accompanied by increase in AMPARs subunits in intracellular compartments was demonstrated in the APP/PS1 transgenic mouse AD model [46]. Declined trafficking and altered number of AMPARs were observed at synaptic and extrasynaptic membranes of different types of hippocampal neurons from P301S tau transgenic mice [47]. The mechanisms underlying stress-induced behavior changes included an insertion of Ca²⁺-permeable AMPARs in the synaptic pathway from orbitofrontal cortex to the basolateral nucleus of amygdala [48]. An analysis of postmortem studies which evaluate the expression of AMPARs in different brain regions of schizophrenic patients has revealed decreased GluA subunits levels or receptor binding in hippocampus [49]. The mutations in GluA3 gene are linked to a number of brain disorders as well. The study on GluA3-knockout mice has establish a crucial role of GluA3-containing AMPARs in amyloid-β-triggered synaptic and memory deficits [50], while Peng et al. [51] showed that GluA3 dysfunction at least partially underlies aggressive behavior. An increased GRIA3 expression correlated with mild cognitive decline, an intermediate state between normal aging and early AD [52]. In our study, the combination of stable expression of GluA1, internalization of GluA2 and membrane trafficking of GluA3 changes the ratio between Ca²⁺-permeable and Ca²⁺-impermeable subunits in membrane AMPARs leading to the prevalence of Ca²⁺-permeable AMPARs, which can dramatically alter the synaptic functions.

Phosphorylation of GluA subunits at different residues is another important mechanism regulating many aspects of AMPARs biophysical properties and functions [24]. Phosphorylation of GluA1 subunits at Ser845 and Ser831 increases mean channel open probability and single channel conductance, respectively, lowering the threshold to initiate or potentiate LTP [53–55]. The study on mice with mutations at both Ser845 and Ser831 confirmed an important role of GluA1 phosphorylation in learning and motivated behavior [56]. On the other hand, phosphorylation can underly LTD by regulating GluA subunits trafficking to different subcellular compartments thus promoting AMPARs movement to synapses or endocytosis and degradation [53]. For instance, Ser845-GluA1 phosphorylation is believed to be a key mechanism controlling the recruitment of this subunits to extrasynaptic membranes for synaptic insertion or removal from synapses during synaptic plasticity, while Tyr876-GluA2 phosphorylation prevents from endocytosis. The disruption of these processes induces a variety of neurodegenerative and neuropsychiatric diseases. Both GluA1 (Ser845 and Ser831) and GluA2 (Ser880) subunits exhibited opposite phosphorylation in different brain regions in response to acute stress possibly mediating its negative effects on cognitive capacities of animals [57, 58]. Alterations in the ratio between native and phosphorylated GluA1 subunits at least partially underly memory impairment in APP/PS1 mouse model of AD [59]. The depressive disorders are associated with phosphorylation of both GluA1 and GluA2 AMPARs subunits at various residues [60]. The results obtained in our study demonstrate that exposure of the rats to excessive F⁻ impairs intracellular AMPARs trafficking which contributes to altered ratio of various GluA subunits at the membranes.

In contrast to AMPARs, F⁻-induced changes in expression of NMDARs subunits in rat hippocampus occurred at both transcriptional and translational levels (Figs. 6–9). While the expression of GluN1 subunits was stable (Fig. 6), mRNA and/or protein content of native and phosphorylated forms of other subunits composing NMDARs (GluN2A, GluN2B and GluN3A) increased in the cytosolic and/or membranes fractions of hippocampus of animals exposed to 20 and/or 50 ppm F⁻ (Figs. 7–10) which indicates their enhanced synthesis and redistribution between cellular compartments. Partially different results were obtained in the recent work of Wei et al. [61]. Using three experimental systems (the brains of adult rats given 50 ppm F⁻ with the drinking water for 6 months, their offspring sacrificed during early postnatal life, and primary cultured hippocampal neurons of neonatal rats treated with 5 and 50 ppm F⁻ for 48 h), the authors showed that gene and protein expression levels of GluN1 and GluN2B subunits enhanced, while that of GluN2A did not change, and GluN3A decreased. In contrast, microglia-induced neuroinflammation in hippocampus of rats given 120 ppm F⁻ for 12 weeks was associated with decline in NMDA2B protein [37].

However, although a few attempts have been made to study F⁻ effects on the functioning of glutamate receptors, the data are controversial. An enhanced expression of mRNAs encoding GluN1 and GluN2B subunits of NMDA receptors, as well as of corresponding proteins, was reported in the brains of adult rats consumed 50 ppm F⁻ for 6 months, their 28-days offspring, and in the primary hippocampal neurons of neonatal rats cultured with 50 ppm F⁻ for 48 h, while that of GluN3A reduced and GluN2A unchanged [61]. Similar up-regulation of NMDAR1 at mRNAs and protein levels was described in the hippocampus of rat pups exposed to 150 mg/L NaF prenatally and until PND28 [20]. In contrast, NMDAR2A and NMDAR2B mRNAs expression was suppressed in hippocampus of mice pups exposed to 50―100 mg/L NaF during gestation and lactation [38]. Down-regulation of total NMDAR mRNA or protein was reported in the brains of offspring mice treated with 50―100 ppm F⁻ for 90 days [62].

Similar to AMPARs, an overwhelming body of evidence centered NMDARs as inductors of synaptic plasticity and memory formation. GluN2A-containing receptors have a higher open probability, faster decay times and lower sensitivity to glutamate in comparison to GluN2B-containing NMDARs [27, 28]. The shift in GluN2A/GluN2B ratio changes threshold for the induction of plasticity during learning. Thus, in hippocampus of young juvenile and adult rats, the expression of GluN1 and GluN2A subunits increased during early memory consolidation, in 70–75 min after training in object recognition test, and returned to normal in 90 min after training [63]. Despite this favorable role, the changes in GluN2A/GluN2B ratio can induce excitotoxicity and implicate in a wide range of neurological disorders [29]. Increased GluN2A/GluN2B ratio in amygdala neurons of transgenic mice before fear learning significantly disrupts long term memory consolidation [64]. Changed GluN2A/GluN2B ratio following reduction of GluN2A expression with specific shRNA was associated with impaired contextual fear-conditioning memory and increased seizure susceptibility in adult male Wistar rats [65]. The modeling of rat schizophrenia by repeated administration of methamphetamine was accompanied by decreased expression of a few Grin genes in different brain regions [66]. The mutations in GRIN2B gene are associated with pathogenic phenotypes of neurodevelopmental disorders such as intellectual disability, developmental delay, motor impairments, autism spectrum disorder, and epilepsy [67]. An imbalance between synaptic and extrasynaptic NMDARs was shown to be a common feature of synaptophaty typical for Alzheimer’s disease [45]. The pathologic mutations, allosteric modulations or disturbed trafficking of NMDARs and impairment of their interaction with AMPARs are well acknowledged events in epileptogenesis [68]. The predominance of GluN2B-containing NMDARs with reduced expression of GluN2A was observed in ventral hippocampus and cortex areas of rats in pilocarpine-induced model of epilepsy [69], while increase in the total NMDARs number due to overexpression of GluN1 and GluN2A or GluN2B was revealed after PTZ-induced status epilepticus [70]. Epilepsy-induced neurodegeneration accompanied by incorporation of GluN3A subunits to NMDARs resulted in formation of triheteromeric receptors which possess increased selectivity for Ca²⁺ over Na⁺ and make the neurons more susceptible to excitotoxic damage [71, 72]. On the other hand, the works [73–75] suggested neuroprotective function of hippocampal astrocytic NMDARs since pharmacological antagonism of GluN2A and GluN2B exacerbates β-amyloid (Aβ) induced synaptotoxicity, while knockdown of Grin2a gene aggravated cognitive decline induced by sleep deprivation or application of Aβ. The beneficial role of modulating NMDARs activities was proposed for correction of autism spectrum disorders and emotional disorders like anxiety and depression [76, 77]. The results obtained in our study indicate that long-term F⁻ consumption leads to considerable alterations in NMDARs subunit composition and subcellular distribution in rat hippocampal cells which might disturb the synaptic functions. Such changes can indicate both active trafficking and insertion of newly synthesized GluN2A subunits to membranes and increased internalization of GluN2B subunits. These processes might at least partially underly an impairment of spatial learning and formation of long-term memory of rats observed in this and previous [16] studies and associated with decline in the protein level of brain-derived neurotrophic factor (BDNF) and activation of Ca²⁺-dependent protease calpain. The reduction in BDNF protein and disrupted neuronal surface expression of synaptic AMPARs are the primary features of many neurodegenerative diseases [78], while functional activity of calpain is closely associated with stimulation of NMDARs [79]. Thus, our findings are in line with the data obtained previously. On the other hand, since GluN2A subunits are believed to have a protective role in brain cells, such changes can indicate a compensatory mechanism necessary for alleviating the rate of neuron death under influence of F⁻.

Overall, the results of our study revealed the pronounced changes in expression of a few subunits composing AMPA and NMDA receptor in hippocampal cells of F⁻ poisoned rats which are typical for disturbed synaptic processes and neurological disorders. The major findings are the prevalence of Ca²⁺-permeable GluA1- and GluA3-containing AMPARs in membranes with internalization of Ca²⁺-impermeable GluA2-containing AMPARs, upregulation of Grin1-3 genes, shift in the ratio between different NMDARs-composing subunits, and altered phosphorylation of these subunits indicating disturbed trafficking of examined subunits within the cells. All these phenomena can dramatically alter the synaptic functions and at least partially underly the impairment of spatial learning and formation of long-term memory. However, the methods applied by us cannot distinguish between neurons and glial cells, between synaptic and extra-synaptic receptors, between their trafficking to membranes or endocytosis, so we cannot evaluate the number of receptors directly implicated in excitotoxic F⁻ effects, as well as cannot say which of the processes of synaptic plasticity (LTP or LTD) is disturbed. More precise mechanisms of F⁻ neurotoxicity warrant further investigations.

Funding

The work was performed within the state assignment of Federal Agency of Scientific Organizations of Russia (theme No 075-00967-23-00). The experiments were carried out using the equipment of the Center for Joint Usage of the Sechenov Institute of Evolutionary Physiology and Biochemistry.

Authors contribution

Olga Nadei: Methodology, Validation, Investigation, Formal analysis, Writing – review and editing; Natalia Agalakova: Conceptualization, Resources, Writing – original draft, Writing – review and editing.

Data availability

The data generated and analyzed during the current study will be available from the corresponding authors on reasonable request.

Ethics Approval Not applicable.

Consent to Participate Not applicable.

Consent for Publication All authors read and approved the final manuscript.

Competing Interests The authors declare no competing interests.

Acknowledgements Not applicable.

Johnston NR, Strobel SA (2020) Principles of fluoride toxicity and the cellular response: a review. Arch Toxicol 94(4):1051–1069. https://doi.org/10.1007/s00204-020-02687-5
Lubojanski A, Piesiak-Panczyszyn D, Zakrzewski W, Dobrzynski W, Szymonowicz M, Rybak Z, Mielan B, Wiglusz RJ, Watras A, Dobrzynski M (2023) The Safety of Fluoride Compounds and Their Effect on the Human Body-A Narrative Review. Mater (Basel) 16(3):1242. https://doi.org/10.3390/ma16031242
Agalakova NI, Nadei OV (2020) Inorganic fluoride and functions of brain. Crit Rev Toxicol 50(1):28–46. https://doi.org/10.1080/10408444.2020.1722061
Adkins EA, Brunst KJ (2021) Impacts of fluoride neurotoxicity and mitochondrial dysfunction on cognition and mental health: a literature review. Int J Environ Res Public Health 18(24):12884. https://doi.org/10.3390/ijerph182412884
Strunecka A, Strunecky O (2019) Chronic fluoride exposure and the risk of autism spectrum disorder. Int J Environ Res Public Health 16(18):3431. https://doi.org/10.3390/ijerph16183431
Spittle B (2019) Further recognition of fluoride-induced neurotoxicity. Fluoride 52(2):99–104
Till C, Green R (2021) Controversy: the evolving science of fluoride: when new evidence doesn't conform with existing beliefs. Pediatr Res 90(5):1093–1095. https://doi.org/10.1038/s41390-020-0973-8
Ottappilakkil H, Babu S, Balasubramanian S, Manoharan S, Perumal E (2023) Fluoride induced neurobehavioral impairments in experimental animals: a brief review. Biol Trace Elem Res 201(3):1214–1236. https://doi.org/10.1007/s12011-022-03242-2
Żwierełło W, Maruszewska A, Skórka-Majewicz M, Gutowska I (2023) Fluoride in the central nervous system and its potential influence on the development and invasiveness of brain tumours-a research hypothesis. Int J Mol Sci 24(2):1558. https://doi.org/10.3390/ijms24021558
Duan Q, Jiao J, Chen X, Wang X (2018) Association between water fluoride and the level of children's intelligence: a dose-response meta-analysis. Public Health 154:87–97. https://doi.org/10.1016/j.puhe.2017.08.013
Grandjean P (2019) Developmental fluoride neurotoxicity: an updated review. Environ Health 18(1):110. https://doi.org/10.1186/s12940-019-0551-x
Veneri F, Vinceti M, Generali L, Giannone ME, Mazzoleni E, Birnbaum LS, Consolo U, Filippini T (2023) Fluoride exposure and cognitive neurodevelopment: systematic review and dose-response meta-analysis. Environ Res 221:115239. https://doi.org/10.1016/j.envres.2023.115239
Guth S, Hüser S, Roth A, Degen G, Diel P, Edlund K, Eisenbrand G, Engel KH, Epe B, Grune T, Heinz V, Henle T, Humpf HU, Jäger H, Joost HG, Kulling SE, Lampen A, Mally A, Marchan R, Marko D, Mühle E, Nitsche MA, Röhrdanz E, Stadler R, van Thriel C, Vieths S, Vogel RF, Wascher E, Watzl C, Nöthlings U, Hengstler JG (2020) Toxicity of fluoride: critical evaluation of evidence for human developmental neurotoxicity in epidemiological studies, animal experiments and in vitro analyses. Arch Toxicol 94(5):1375–1415. https://doi.org/10.1007/s00204-020-02725-2
Miranda GHN, Alvarenga MOP, Ferreira MKM, Puty B, Bittencourt LO, Fagundes NCF, Pessan JP, Buzalaf MAR, Lima RR (2021) A systematic review and meta-analysis of the association between fluoride exposure and neurological disorders. Sci Rep 11:22659. https://doi.org/10.1038/s41598-021-99688-w
Nadei OV, Ivanova TI, Sufieva DA, Agalakova NI (2020) Morphological Changes of the Rat Hippocampal Neurons Following Excessive Fluoride Consumption. J Anat Histopathol 9(2):53–60. https://doi.org/10.18499/2225-7357-2020-9-2-53-60
Nadei OV, Khvorova IA, Agalakova NI (2020) Cognitive decline of rats with chronic fluorosis is associated with alterations in hippocampal calpain signaling. Biol Trace Elem Res 197:495–506. https://doi.org/10.1007/s12011-019-01993-z
Reddy YP, Tiwari S, Tomar LK, Desai N, Sharma VK (2021) Fluoride-Induced Expression of Neuroinflammatory Markers and Neurophysiological Regulation in the Brain of Wistar Rat Model. Biol Trace Elem Res 199(7):2621–2626. https://doi.org/10.1007/s12011-020-02362-x
Vani ML, Reddy KP (2000) Effects of fluoride accumulation on some enzymes of brain and gastrocnemius muscle of mice. Fluoride 33:17–26
Jiang C, Zhang S, Liu H, Guan Z, Zeng Q, Zhang C, Lei R, Xia T, Wang Z, Yang L, Chen Y, Wu X, Zhang X, Cui Y, Yu L, Wang A (2014) Fluoride and arsenic exposure impairs learning and memory and decreases mGluR5 expression in the hippocampus and cortex in rats. PLoS ONE 9:e96041. https://doi.org/10.1371/journal.pone.0096041
Niu R, Sun Z, Cheng Z, Li Z, Wang J (2009) Decreased learning ability and low hippocampus glutamate in offspring rats exposed to fluoride and lead. Environ Toxicol Pharmacol. https://doi.org/10.1016/j.etap.2009.04.012. 28:254—258
Kim JH, Marton J, Ametamey SM, Cumming P (2020) A review of molecular imaging of glutamate receptors. Molecules 25(20):4749. https://doi.org/10.3390/molecules25204749
Chakraborty P, Dey A, Gopalakrishnan AV, Swati K, Ojha S, Prakash A, Kumar D, Ambasta RK, Jha NK, Jha SK, Dewanjee S (2023) Glutamatergic neurotransmission: A potential pharmacotherapeutic target for the treatment of cognitive disorders. Ageing Res Rev 85:101838. https://doi.org/10.1016/j.arr.2022.101838
Diering GH, Huganir RL (2018) The AMPA receptor code of synaptic plasticity. Neuron 100:314–329. https://doi.org/10.1016/j.neuron.2018.10.018
Purkey AL, Dell'Acqua ML (2020) Phosphorylation-dependent regulation of Ca²⁺-permeable AMPA receptors during hippocampal synaptic plasticity. Front Synaptic Neurosci 12:8. https://doi.org/10.3389/fnsyn.2020.00008
Italia M, Ferrari E, Di Luca M, Gardoni F (2021) GluA3-containing AMPA receptors: from physiology to synaptic dysfunction in brain disorders. Neurobiol Dis 161:105539. https://doi.org/10.1016/j.nbd.2021.105539
Chater TE, Goda Y (2022) The shaping of AMPA receptor surface distribution by neuronal activity. Front Synaptic Neurosci 14:833782. https://doi.org/10.3389/fnsyn.2022.833782
Paoletti P, Bellone C, Zhou Q (2013) NMDA receptor subunit diversity: impact on receptor properties, synaptic plasticity and disease. Nat Rev Neurosci 14:383–400. https://doi.org/10.1038/nrn3504
Gardoni F, Di Luca M (2021) Protein-protein interactions at the NMDA receptor complex: from synaptic retention to synaptonuclear protein messengers. Neuropharmacology 190:108551. https://doi.org/10.1016/j.neuropharm.2021.108551
Franchini L, Carrano N, Di Luca M, Gardoni F (2020) Synaptic GluN2A-Containing NMDA Receptors: From Physiology to Pathological Synaptic Plasticity. Int J Mol Sci 21(4):1538. https://doi.org/10.3390/ijms21041538
Nutrient requirements of laboratory Animals: Fourth Revised Edition (1995) National Academy Press. Washington, DC
Lyaruu DM, Bronckers AL, Santos F, Mathias R, DenBesten P (2008) The effect of fluoride on enamel and dentin formation in the uremic rat incisor. Pediatr Nephrol 23:1973–1979. https://doi.org/10.1007/s00467-008-0890-2
Ekstrand J (1978) Relationship between fluoride in the drinking water and the plasma fluoride concentration in man. Caries Res 12:123–127. https://doi.org/10.1159/000260321
Spencer AJ, Do LG, Mueller U, Baines J, Foley M, Peres MA (2018) Understanding optimum fluoride intake from population-level evidence. Adv Dent Res 29:144–156. https://doi.org/10.1177/0022034517750592
Agalakova NI, Gusev GP (2013) Excessive fluoride consumption leads to accelerated death of erythrocytes and anemia in rats. Biol Trace Elem Res 153(1–3):340–349. https://doi.org/10.1007/s12011-013-9691-y
Nadei OV, Agalakova NI (2023) Optimal reference genes for RT-qPCR experiments in hippocampus and cortex of rats chronically exposed to excessive fluoride. Biol Trace Elem Res. https://doi.org/10.1007/s12011-023-03646-8
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method. Methods 25(4):402–408. https://doi.org/10.1006/meth.2001.1262
Yang L, Jin P, Wang X, Zhou Q, Lin X, Xi S (2018) Fluoride activates microglia, secretes inflammatory factors and influences synaptic neuron plasticity in the hippocampus of rats. Neurotoxicology 69:108–120. https://doi.org/10.1016/j.neuro.2018.09.006
Sun Z, Zhang Y, Xue X, Niu R, Wang J (2018) Maternal fluoride exposure during gestation and lactation decreased learning and memory ability, and glutamate receptor mRNA expressions of mouse pups. Hum Exp Toxicol 37:87–93. https://doi.org/10.1177/0960327117693067
Hanley JG (2014) Subunit-specific trafficking mechanisms regulating the synaptic expression of Ca. Semin Cell Dev Biol 27:14–22. https://doi.org/10.1016/j.semcdb.2013.12.002
Hardt O, Nader K, Wang YT (2014) GluA2-dependent AMPA receptor endocytosis and the decay of early and late long-term potentiation: possible mechanisms for forgetting of short- and long-term memories. Philos Trans R Soc Lond B Biol Sci 369(1633):20130141. https://doi.org/10.1098/rstb.2013.0141
Wu QL, Gao Y, Li JT, Ma WY, Chen NH (2022) The role of AMPARs composition and trafficking in synaptic plasticity and diseases. Cell Mol Neurobiol 42(8):2489–2504. https://doi.org/10.1007/s10571-021-01141-z
Chen SR, Zhou HY, Byun HS, Pan HL (2013) Nerve injury increases GluA2-lacking AMPA receptor prevalence in spinal cords: functional significance and signaling mechanisms. J Pharmacol Exp Ther 347(3):765–772. https://doi.org/10.1124/jpet.113.208363
Chen SR, Zhang J, Chen H, Pan HL (2019) Streptozotocin-induced diabetic neuropathic pain is associated with potentiated calcium-permeable AMPA receptor activity in the spinal cord. J Pharmacol Exp Ther 371(2):242–249. https://doi.org/10.1124/jpet.119.261339
Liu B, Liao M, Mielke JG, Ning K, Chen Y, Li L, El-Hayek YH, Gomez E, Zukin RS, Fehlings MG, Wan Q (2006) Ischemic insults direct glutamate receptor subunit 2-lacking AMPA receptors to synaptic sites. J Neurosci 26(20):5309–5319. https://doi.org/10.1523/JNEUROSCI.0567-06.2006
Babaei P (2021) NMDA and AMPA receptors dysregulation in Alzheimer's disease. Eur J Pharmacol 908:174310. https://doi.org/10.1016/j.ejphar.2021.174310
Martín-Belmonte A, Aguado C, Alfaro-Ruíz R, Itakura M, Moreno-Martínez AE, de la Ossa L, Molnár E, Fukazawa Y, Luján R (2020) Age-dependent shift of AMPA receptors from synapses to intracellular compartments in Alzheimer's disease: immunocytochemical analysis of the CA1 hippocampal region in APP/PS1 transgenic mouse model. Front Aging Neurosci 12:577996. https://doi.org/10.3389/fnagi.2020.577996
Alfaro-Ruiz R, Aguado C, Martín-Belmonte A, Moreno-Martínez AE, Merchán-Rubira J, Hernández F, Ávila J, Fukazawa Y, Luján R (2022) Alteration in the Synaptic and Extrasynaptic Organization of AMPA Receptors in the Hippocampus of P301S Tau Transgenic Mice. Int J Mol Sci 23(21):13527. https://doi.org/10.3390/ijms232113527
Kuniishi H, Yamada D, Wada K, Yamada M, Sekiguchi M (2020) Stress induces insertion of calcium-permeable AMPA receptors in the OFC-BLA synapse and modulates emotional behaviours in mice. Transl Psychiatry 10(1):154. https://doi.org/10.1038/s41398-020-0837-3
Yonezawa K, Tani H, Nakajima S, Nagai N, Koizumi T, Miyazaki T, Mimura M, Takahashi T, Uchida H (2022) AMPA receptors in schizophrenia: A systematic review of postmortem studies on receptor subunit expression and binding. Schizophr Res 243:98–109. https://doi.org/10.1016/j.schres.2022.02.033
Reinders NR, Pao Y, Renner MC, da Silva-Matos CM, Lodder TR, Malinow R, Kessels HW (2016) Amyloid-β effects on synapses and memory require AMPA receptor subunit GluA3. Proc Natl Acad Sci USA 113(42):E6526–E6534. https://doi.org/10.1073/pnas.1614249113
Peng S, Pei J, Rinaldi B, Chen J, Ge YH, Jia M, Wang J, Delahaye-Duriez A, Sun JH, Zang YY, Shi YY, Zhang N, Gao X, Milani D, Xu X, Sheng N, Gerard B, Zhang C, Bayat A, Liu N, Yang JJ, Shi YS (2022) Dysfunction of AMPA receptor GluA3 is associated with aggressive behavior in human. Mol Psychiatry 27(10):4092–4102. https://doi.org/10.1038/s41380-022-01659-8
Berchtold NC, Sabbagh MN, Beach TG, Kim RC, Cribbs DH, Cotman CW (2014) Brain gene expression patterns differentiate mild cognitive impairment from normal aged and Alzheimer's disease. Neurobiol Aging 35(9):1961–1972. https://doi.org/10.1016/j.neurobiolaging.2014.03.031
Lu W, Roche KW (2012) Posttranslational regulation of AMPA receptor trafficking and function. Curr Opin Neurobiol 22(3):470–479. https://doi.org/10.1016/j.conb.2011.09.008
Wang JQ, Guo ML, Jin DZ, Xue B, Fibuch EE, Mao LM (2014) Roles of subunit phosphorylation in regulating glutamate receptor function. Eur J Pharmacol 728:183–187. https://doi.org/10.1016/j.ejphar.2013.11.019
Corti E, Duarte CB (2023) The role of post-translational modifications in synaptic AMPA receptor activity. Biochem Soc Trans 51(1):315–330. https://doi.org/10.1042/BST20220827
Crombag HS, Sutton JM, Takamiya K, Holland PC, Gallagher M, Huganir RL (2008) A role for alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid GluR1 phosphorylation in the modulatory effects of appetitive reward cues on goal-directed behavior. Eur J Neurosci 27(12):3284–3291. https://doi.org/10.1111/j.1460-9568.2008.06299.x
Caudal D, Godsil BP, Mailliet F, Bergerot D, Jay TM (2010) Acute stress induces contrasting changes in AMPA receptor subunit phosphorylation within the prefrontal cortex, amygdala and hippocampus. PLoS ONE 5(12):e15282. https://doi.org/10.1371/journal.pone.0015282
Caudal D, Rame M, Jay TM, Godsil BP (2016) Dynamic regulation of AMPAR phosphorylation in vivo following acute behavioral stress. Cell Mol Neurobiol 36(8):1331–1342. https://doi.org/10.1007/s10571-016-0332-9
Zhao YB, Hou XF, Li X, Zhu LS, Zhu J, Ma GR, Liu YX, Miao YC, Zhou QY, Xu L, Zhou QX (2022) Early memory impairment is accompanied by changes in GluA1/p-GluA1 in APP/PS1 mice. Curr Alzheimer Res. https://doi.org/10.2174/1567205020666221019124543
Lee MT, Peng WH, Kan HW, Wu CC, Wang DW, Ho YC (2022) Neurobiology of depression: chronic stress alters the glutamatergic system in the brain-focusing on AMPA receptor. Biomedicines 10(5):1005. https://doi.org/10.3390/biomedicines10051005
Wei N, Dong YT, Deng J, Wang Y, Qi XL, Yu WF, Xiao Y, Zhou JJ, Guan ZZ (2018) Changed expressions of N-methyl-d-aspartate receptors in the brains of rats and primary neurons exposed to high level of fluoride. J Trace Elem Med Biol 45:31–40. https://doi.org/10.1016/j.jtemb.2017.09.020
Ge Y, Chen L, Yin Z, Song X, Ruan T, Hua L, Liu J, Wang J, Ning H (2018) Fluoride-induced alterations of synapse-related proteins in the cerebral cortex of ICR offspring mouse brain. Chemosphere 201:874–883. https://doi.org/10.1016/j.chemosphere.2018.02.167
Cercato MC, Vázquez CA, Kornisiuk E, Aguirre AI, Colettis N, Snitcofsky M, Jerusalinsky DA, Baez MV (2017) GluN1 and GluN2A NMDA receptor subunits increase in the hippocampus during memory consolidation in the rat. front. Behav Neurosci 10:242. https://doi.org/10.3389/fnbeh.2016.00242
Holehonnur R, Phensy AJ, Kim LJ, Milivojevic M, Vuong D, Daison DK, Alex S, Tiner M, Jones LE, Kroener S, Ploski JE (2016) Increasing the GluN2A/GluN2B ratio in neurons of the mouse basal and lateral amygdala inhibits the modification of an existing fear memory trace. J Neurosci 36(36):9490–9504. https://doi.org/10.1523/JNEUROSCI.1743-16.2016
Acutain MF, Griebler Luft J, Vazquez CA, Popik B, Cercato MC, Epstein A, Salvetti A, Jerusalinsky DA, de Oliveira Alvares L, Baez MV (2021) Reduced expression of hippocampal GluN2A-NMDAR increases seizure susceptibility and causes deficits in contextual memory. Front Neurosci 15:644100. https://doi.org/10.3389/fnins.2021.644100
Oka M, Ito K, Koga M, Kusumi I (2020) Changes in subunit composition of NMDA receptors in animal models of schizophrenia by repeated administration of methamphetamine. Prog Neuropsychopharmacol Biol Psychiatry 103:109984. https://doi.org/10.1016/j.pnpbp.2020.109984
Sabo SL, Lahr JM, Offer M, Weekes A, Sceniak MP (2023) GRIN2B-related neurodevelopmental disorder: current understanding of pathophysiological mechanisms. Front Synaptic Neurosci 14:1090865. https://doi.org/10.3389/fnsyn.2022.1090865
Sivakumar S, Ghasemi M, Schachter SC (2022) Targeting NMDA receptor complex in management of epilepsy. Pharmaceuticals (Basel) 15(10):1297. https://doi.org/10.3390/ph15101297
Zubareva OE, Kovalenko AA, Kalemenev SV, Schwarz AP, Karyakin VB, Zaitsev AV (2018) Alterations in mRNA expression of glutamate receptor subunits and excitatory amino acid transporters following pilocarpine-induced seizures in rats. Neurosci Lett 686:94–100. https://doi.org/10.1016/j.neulet.2018.08.047
Postnikova TY, Zubareva OE, Kovalenko AA, Kim KK, Magazanik LG, Zaitsev AV (2017) Status epilepticus impairs synaptic plasticity in rat hippocampus and is followed by changes in expression of NMDA receptors. Biochem (Mosc) 82(3):282–290. https://doi.org/10.1134/S0006297917030063
Beesley S, Sullenberger T, Kumar SS (2020) The GluN3 subunit regulates ion selectivity within native N-methyl-d-aspartate receptors. IBRO Rep 9:147–156. https://doi.org/10.1016/j.ibror.2020.07.009
Beesley S, Sullenberger T, Lee C, Kumar SS (2022) GluN3 subunit expression correlates with increased vulnerability of hippocampus and entorhinal cortex to neurodegeneration in a model of temporal lobe epilepsy. J Neurophysiol 127(6):1496–1510. https://doi.org/10.1152/jn.00070.2022
Li Y, Chang L, Song Y, Gao X, Roselli F, Liu J, Zhou W, Fang Y, Ling W, Li H, Almeida OF, Wu Y (2016) Astrocytic GluN2A and GluN2B oppose the synaptotoxic effects of amyloid-β1–40 in hippocampal cells. J Alzheimers Dis 54(1):135–148. https://doi.org/10.3233/JAD-160297
Du Z, Song Y, Chen X, Zhang W, Zhang G, Li H, Chang L, Wu Y (2021) Knockdown of astrocytic Grin2a aggravates β-amyloid-induced memory and cognitive deficits through regulating nerve growth factor. Aging Cell 20(8):e13437. https://doi.org/10.1111/acel.13437
Zhang W, Chen X, Du Z, Mao X, Gao R, Chen Z, Wang H, Zhang G, Zhang N, Li H, Song Y, Chang L, Wu Y (2022) Knockdown of astrocytic Grin2a exacerbated sleep deprivation-induced cognitive impairments and elevation of amyloid-beta. Sleep Med 100:280–290. https://doi.org/10.1016/j.sleep.2022.08.021
Wang S, Bian L, Yin Y, Guo J (2022) Targeting NMDA receptors in emotional disorders: their role in neuroprotection. Brain Sci 12(10):1329. https://doi.org/10.3390/brainsci12101329
Lee K, Mills Z, Cheung P, Cheyne JE, Montgomery JM (2022) The role of zinc and NMDA receptors in autism spectrum disorders. Pharmaceuticals (Basel) 16(1):1. https://doi.org/10.3390/ph16010001
Keifer J (2022) Regulation of AMPAR trafficking in synaptic plasticity by BDNF and the impact of neurodegenerative disease. J Neurosci Res 100(4):979–991. https://doi.org/10.1002/jnr.25022
Yildiz-Unal A, Korulu S, Karabay A (2015) Neuroprotective strategies against calpain-mediated neurodegeneration. Neuropsychiatr Dis Treat 11:297–310. https://doi.org/10.2147/NDT.S78226

Download PDF

Reviewers agreed at journal
31 Jul, 2023
Reviewers invited by journal
31 Jul, 2023
Editor invited by journal
25 Jul, 2023
Editor assigned by journal
12 Jul, 2023
First submitted to journal
04 Jul, 2023

You are reading this latest preprint version

Effect of chronic F- exposure on ionotropic glutamate AMPA and NMDA receptors in rat hippocampus

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Animals

Examination of cognitive capacities

Morris water maze test

Novel object recognition test (NOR)

mRNA extraction and cDNA synthesis

Quantitative real-time PCR

Western blotting analysis

Statistics

Results

Influence of excessive F⁻ consumption on memory formation

Effect of fluoride on expression of subunits composing AMPA receptors in rat hippocampus

Effect of fluoride on expression of subunits composing NMDA receptors in rat hippocampus

Discussion

Conclusions

Declarations

References

Status:

Version 1

Effect of chronic F- exposure on ionotropic glutamate AMPA and NMDA receptors in rat hippocampus

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Animals

Examination of cognitive capacities

Morris water maze test

Novel object recognition test (NOR)

mRNA extraction and cDNA synthesis

Quantitative real-time PCR

Western blotting analysis

Statistics

Results

Influence of excessive F− consumption on memory formation

Effect of fluoride on expression of subunits composing AMPA receptors in rat hippocampus

Effect of fluoride on expression of subunits composing NMDA receptors in rat hippocampus

Discussion

Conclusions

Declarations

References

Status:

Version 1

Influence of excessive F⁻ consumption on memory formation