Inflammasomes in Rheumatoid Arthritis: A Pilot Study

doi:10.21203/rs.3.rs-3137167/v1

Download PDF

Research Article

Inflammasomes in Rheumatoid Arthritis: A Pilot Study

https://doi.org/10.21203/rs.3.rs-3137167/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 30 Oct, 2023

Read the published version in BMC Rheumatology →

You are reading this latest preprint version

Background

The inflammasome plays an important role in rheumatoid arthritis (RA), which was little systematically reported. The aim of this study was to understand whether the levels of inflammasome were related to the severity of RA disease, which might provide a stronger theoretical basis for RA treatment.

Methods

The mRNA expression levels of some inflammasomes and associated molecules including IL-1beta and IL-18 in peripheral blood peripheral blood mononuclear cells (PBMCs) from 30 RA patients (n = 30) and 16 healthy controls (HC) were detected by quantitative real-time polymerase chain reaction (qRT-PCR), and the levels of plasma IL-1beta and IL-18 were also measured by Enzyme-Linked Immunosorbent Assay (ELISA). Moreover, clinical characteristics and laboratory results of the patients were collected and analyzed in this study.

Results

Compared to HC group, the relative mRNA expression levels of NLRP3, NLRC4, AIM2, caspase-1, and IL-1beta were significantly higher, but notably lower in NLRP1, NLRP2 and NLRC5 in RA group. Moreover, the plasma IL-1beta and IL-18 levels were markedly increased in RA group. Additionally, the mRNA level of AIM2 was negatively correlated with DAS28 by stepwise linear regression analysis. and ESR was positively correlated with DAS28 by multiple linear regression analysis in RA group.

Conclusions

These findings implied the critical role of NLRP3, NLRC4, AIM2, caspase-1 mRNA, plasma IL-1beta and IL-18 in the pathogenesis of RA patients, which provided potential targets for the diagnosis and treatment of RA.

Inflammasome

Rheumatoid arthritis

NLRP3

NLRC4

AIM2

Rheumatoid arthritis (RA) is a systemic autoimmune disease characterized by chronic erosive arthritis. The pathogenesis is marked by persistent, chronic inflammation of the synovial membrane, leading to synovitis and damage to bone and joints, which ultimately causes joint deformity, loss of function, and even disability^{[1, 2]}. The pathogenesis of RA remains unclear, although the inflammasomes are considered to be closely involved in RA pathogenesis. Inflammasomes are an important component of the immune system, identifying pathogen-associated molecular patterns (PAMPs), damage-associated molecular patterns (DAMPs), or homeostasis-altering molecular processes (HAMPs) on pathogens through pattern recognition receptors (PRRs), recognize and eliminate exogenous pathogenic microorganisms or endogenous molecules released by the host itself ^{[3, 4]}. The canonical inflammasomes are composed of a sensor molecule, an adapter protein (apoptosis-associated speck-like protein containing a caspase recruitment domain, ASC), and an effector molecule^[5]. The sensors include the members of the NLR family, the absent in melanoma 2 (AIM2)-like receptor (ALR) family and pyrin, specifically NOD-like receptor protein 1 (NLRP1), NLRP2, NLRP3, NOD-like receptor family apoptosis inhibitory protein (NAIP), NLR family CARD domain-containing 4 (NLRC4), NLRC5, NLRP6, NLRP7, NLRP9, NLRP12, AIM2, human interferon (IFN) γ-inducible protein (IFI) 16 and pyrin, and so on^{[6, 7]}. The Caspases include human caspases-1/4/5 and mouse Caspases-1/11 and active inflammatory caspases to cleave pro-IL-1beta and pro-IL-18 to produce active IL-1beta and IL-18, thus exerts pro-inflammatory effects, as well as promote the cleavage of the pore-forming protein gasdermin D (GSDMD) to induce pyroptosis^{[5, 8]}.

Inflammasomes are expressed in immune cells such as T cells, monocytes, macrophages, as well as non-immune cells including epithelial cells and myofibroblasts^[5]. An appropriate inflammatory response is beneficial for the body, but it will trigger excessive tissue damage and lead to disease when it is uncontrolled. While there are numerous reports on inflammasomes in RA, no systematic studies have been found.

In the study, we assessed the mRNA levels of NLRP1, NLRP2, NLRP3, NLRC4, NLRC5, NLRP12, AIM2, CARD8, IFI16, Pyrin, NAIP, caspase-1, caspase-4, caspase-5, IL-1beta, IL-18 in PBMCs from RA patients and HC, and conducted a pilot investigation of common inflammasomes and associated molecules to provide a stronger theoretical basis for RA treatment.

2.1. Objective

This study aimed to perform a pilot study about the expression levels of inflammasomes and associated molecules to provide a stronger theoretical value for RA treatment.

2.2 Study design and participants

A total of 30 patients with RA were enrolled including 10 males, 20 females in this study. The average age of these patients was 55 years (range 31 to 75 years). The RA patients who fulfilled the revised American College of Rheumatology (ACR) 2010 criteria for RA were consecutively enrolled in the Shaoxing People’s Hospital between October 2021 and March 2022^[9]. and these RA patients were excluded from other inflammatory or autoimmune diseases, cancers, and mental disorders or hormonal diseases, as well as pregnant and lactating women. The information on disease activity score 28 (DAS28), rheumatoid factor (RF), anti-cyclic citrullinated peptide antibodies (anti-CCP), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), white blood cell count (WBC), neutrophils count, monocyte count, and lymphocyte count and other data were collected. A total of 16 healthy controls (HC) with matched-sex and age were alos enrolled including 5 males and 11 females, aged from 40 to 72 years old, and the HC group had no autoimmune or inflammatory diseases. The characteristics of these enrolled cases were summarized in Table 1.

Table 1

Clinical details of the patients with RA and HC
Clinical characteristic	RA	HC
Number of subjects	30	16
Sex, male/female	10/20	5/11
Age(range)	55(31–75)	57(40–72)
BMI(Kg/m2)	22.4 ± 4.1
Smoking(Yes/No)	8/22
Alcohol drinking(Yes/No)	10/20
DAS28-CRP	3.66 ± 1.79
RF, IU/ml	255.20 ± 237.70
Anti-CCP, RU/ml	366.90 ± 476.27
ESR, mm/h	36.60 ± 27.52
CRP, mg/l	16.91 ± 22.07
plasma IL-1beta, pg/ml	6.62 ± 1.65^∗∗∗	4.93 ± 0.98
plasma IL-18, pg/ml	759.79 ± 661.36^∗∗	307.89 ± 230.42
WBC, 10⁹/l	5.96 ± 1.87	5.38 ± 1.25
N, 10⁹/l	3.87 ± 1.64	2.97 ± 1.01
M, 10⁹/l	0.43 ± 0.17	0.39 ± 0.09
L, 10⁹/l	1.78 ± 1.16^∗	1.86 ± 0.37
Note: DAS28-CRP, disease activity score for 28 joints based on C-reactive protein; RF, rheumatoid factor; Anti-CCP, anti-cyclic citrullinated peptide antibody; ESR, erythrocyte sedimentation rate; IL-1beta, interleukin-1beta; WBC, white blood cell count; N, neutrophils count; M, monocyte count; L, lymphocyte count. * P < 0.05, P < 0.01, * P < 0.001.

2.3 Human PBMCs separation and total RNA extraction.

The fresh peripheral blood samples were collected into EDTA-K₂ containing tubes, centrifuged at 800 g for 5 minutes, the plasma was collected into the tubes and stored at -80°. The remaining blood components were diluted with equal volume of phosphate buffered saline (PBS) and then collected PBMCs by gradient centrifugation according to Lympholyte®-H (CEDARLANE, Netherlands) manufacturer’s protocols. The total RNA in PBMCs from the each case was extracted as quickly as possible also according to the protocol by using RNA Extraction Kit (Vazyme Biotech, Nanjing, China), respectively. The integrity and concentration of the RNA was assessed by NanoDrop 2000 (Thermo Scientific, USA) spectrophotometer.

2.4 qRT-PCR Analysis

The quantitative real-time polymerase chain reaction (qRT-PCR) were carried out with the PrimeScript™ RT kit (Vazyme Biotech, Nanjing, China) and SYBR Premix Ex Taq™ II (Vazyme Biotech, Nanjing, China), respectively. The housekeeping gene encoding GADPH was considered as an internal control, and the primers are listed in Table 2. The relative expression levels of the target genes were analyzed using the 2^−ΔΔCt method.

Table 2

The amplification primers sequences
Gene name	GeneBank accession no.	Primer sequence (5’-3’)
NLRP1	NM_033004	F-ATTGAGGGCAGGCAGCACAGAT
		R-CTCCTTCAGGTTTCTGGTGACC
NLRP2	NM_017852	F- CATTCTGCGTCAAGCACTGTCG
		R- CCGTCCAGAAAGGAAGCATGTG
NLRP3	NM_004895	F-GGACTGAAGCACCTGTTGTGCA
		R-TCCTGAGTCTCCCAAGGCATTC
NLRC4	NM_021209	F-AGGTCCCACAACTCGTCAAGCT
		R-TGCTCACACGATTTCCCGCCAA
NLRC5	NM_032206	F-AGTGGCTCTTCCGCTTGGACAT
		R- CGGAACCCTAAGAACTTGGCTG
NLRP12	NM_144687	F- CAGGCATGATGCTGCTTTGCGA
		R- AGCACAGAAGCCATCTCCTGAC
AIM2	NM_004833	F-GCTGCACCAAAAGTCTCTCCTC
		R-CTGCTTGCCTTCTTGGGTCTCA
CARD8	NM_014959	F- GTGTGGGATACTGAGGTGAAGC
		R- TGTCCTGGAGATCATCGAGCAC
IFI16	NM_005531	F- GATGCCTCCATCAACACCAAGC
		R-CTGTTGCGTTCAGCACCATCAC
Pyrin	NM_000243	F- GCTGCTCTTCTGTGAGGATCAC
		R- CTCAGCTTCTTCAGATGCTCCAG
NAIP	NM_004536	F- CCGAACAGGAACTGCTTCTCAC
		R- CCACAGACAGTTCTTTCAGGCAC
Caspase-1	NM_033292	F-GCTGAGGTTGACATCACAGGCA
		R-TGCTGTCAGAGGTCTTGTGCTC
Caspase-4	NM_001225	F- GGGATGAAGGAGCTACTTGAGG
		R- CCAAGAATGTGCTGTCAGAGGAC
Caspase-5	NM_004347	F- ACAACCGCAACTGCCTCAGTCT
		R- GAATCTGCCTCCAGGTTCTCAG
IL1beta	NM_000576	F-CCACAGACCTTCCAGGAGAATG
		R-GTGCAGTTCAGTGATCGTACAGG
IL-18	NM_001562	F- GATAGCCAGCCTAGAGGTATGG
		R- CCTTGATGTTATCAGGAGGATTCA
GAPDH	NM_002046	F- GTCTCCTCTGACTTCAACAGCG
		R- ACCACCCTGTTGCTGTAGCCAA
Note: NLRP1, NOD-like receptor protein1; AIM2, absent in melanoma 2; IFI16, human interferon (IFN)g-inducible protein 16; NAIP, NOD-like receptor family apoptosis inhibitory protein.

2.5 Enzyme-linked immunosorbent assay (ELISA)

The plasma concentrations of IL-1beta and IL-18 were determined by Enzyme-linked immunosorbent assay (ELISA) according to the Kit’s protocol (Boster Biological, Wuhan, China). The detection wavelength was 450nm, and experiments were conducted in triplicate with consistent results.

2.6 Statistical analysis

Statistical analysis and graphic presentation were performed by SPSS version 25.0 and GraphPad Prism 9.0. Unpaired Student’s t-test or one-way ANOVA was used when the data passed the normality test, otherwise, the nonparametric Mann–Whitney test or the Kruskal-Wallis test was used. The correlation analysis was performed by multiple linear regression analysis and stepwise linear regression analysis, excluding the interference of confounding factors. Two-tailed P < 0.05 was considered to be statistically significant.

3.1 Characteristics of study subjects

Thirty patients with RA and sixteen healthy adults were enrolled in this study. There were no gender or age differences between RA patients and HC group. There was no statistical difference in the count of WBCs, monocytes and neutrophils between the two groups, while the number of lymphocytes in RA group was higher than that in HC group (P = 0.04), respectively.

3.2 The mRNA expression levels between RA and HC group

The mRNA expression level of NLRP3, NLRC4, AIM2, caspase-1 and IL-1beta in the RA patients was remarkably elevated (Figure.1A-E), but the level of NLRP1, NLRP2 and NLRC5 was notably decreased in comparison with that in HC group (Figure.1F-H), respectively. Moreover, there was no significant difference in NLRP12, CARD8, IFI16, pyrin, NAIP, Caspase-4/5 and IL-18 mRNA level between two groups (Supplementary material: Table S1). Although there was no significant difference in the relative expression levels of IL-18 mRNA between two groups, it was found that the female group was remarkably higher than the male group in RA patients (Figure.1I).

3.3 Inflammasomes and DAS28-CRP in RA patients

To assess whether these inflammasomes and related proteins differed at different disease activity levels, the RA group was divided into high activity (DAS28-CRP > 5.1), moderate activity (3.2 < DAS28-CRP < 5.1), low activity (2.6 < DAS28-CRP < 3.2), and remission (DAS28-CRP < 2.6) groups according to DAS28-CRP^[9]. It was found that NLRP1 mRNA level in the RA with different activity groups (low, moderate and high activity) was noticeable different from the HC group, respectively, and there were no significant differences between RA remission group with HC group. The relative expression levels of NLRP1 mRNA were not markedly different among different RA activity groups (low, moderate and high activity) (Figure.2A). The comparison of RA groups into active (including moderate and high activity groups) and inactive (low activity and remission groups) led to the following results: the mRNA levels of NLRP3 and caspase-1 in both inactive and active groups were higher than those in HC group, while there was no notably difference between inactive and active groups (Figure.2B, C). The levels of AIM2 mRNA in inactive group were the highest, and were significantly different from those in the HC group and the active group (Figure.2D). The CRP and ESR levels in the high activity group were remarkably higher than those in the low activity group and the remission group.

3.4 Measure of plasma IL-1beta and IL-18

To determine whether there were differences between the plasma IL-1beta and IL-18 in RA patients and HC groups, which were detected by ELISA. The plasma IL-1beta (6.62 ± 1.65, P = 0.000) and IL-18 (759.79 ± 661.36, P = 0.001) levels in RA group were noticeable higher than those in HCs (Figure.3A, B). There was a statistically noticeable difference among the active, inactive, and HC group (Figure.3C), while no difference was showed between the active and inactive groups. The level of IL-18 was the highest in the active group, which was markedly different from that in the HC group (Figure.3D).

3.5 Correlation of mRNA expression level and clinical features of RA patients

In order to explore the relationship between the mRNA expression levels of these inflammasomes, plasma IL-1beta, IL-18 levels and clinical characteristics of RA patients, multiple linear regression analysis was used to analyze the relative mRNA expression level of NLRP1, NLRP2, NLRP3, NLRC4, NLRC5, NLRP12, AIM2, CARD8, IFI16, Pyrin, NAIP, Caspase-1, Caspase-4, Caspase-5, IL-1beta, IL-18 mRNA and plasma IL-1beta, IL-18 levels with the clinical characteristics of RF, anti-CCP, CRP and ESR, but no statistical difference was found, respectively.

To understand the correlation between the expression level of these inflammasomes and related molecules with disease activity, multiple linear regression analysis and stepwise linear regression analysis were concluded, the results showed that the mRNA level of AIM2 was negatively correlated with DAS28 (β=-0.420, P = 0.021, 95% CI -1.832 to -0.162, R squared after adjustment 0.147). Additionally, to know whether the laboratory findings were associated with DAS28, we compared the RF, anti-CCP, CRP, ESR, neutrophils, monocyte and lymphocyte count with DAS28 using multiple linear regression analysis, the results showed that ESR was positively correlated with DAS28 (β = 0.711, P = 0.01, 95% CI 0.013 to 0.083, R squared after adjustment 0.623).

It is well known that the inflammasome is an important part of the innate immune system. Activation of inflammasomes triggers a series of inflammatory cascade responses, leads to the secretion of various cytokines including the production of IL-1beta and IL-18, which has implications for the pathogenesis of many diseases such as RA, systemic lupus erythematosus (SLE) and influenza virus infection^[10]. In view of the role of inflammasomes in RA disease, we investigated the relative mRNA expression levels of the common inflammasomes including NLRP1, NLRP2, NLRP3, NLRC4, NLRC5, NLRP12, AIM2, CARD8, IFI16, Pyrin and its related molecules inlcuding NAIP, caspase-1, caspase-4, Caspase-5, IL-1beta and IL-18 in human PBMCs of RA patients and HC. The results showed that the relative mRNA expression levels of NLRP3, NLRC4, AIM2, caspase-1, IL-1beta in RA group were noticeable higher than that in HC group, respectively. However, the relative mRNA expression levels of NLRP1, NLRP2, NLRC5 were notably decreased compared to HC group, respectively. Moreover, there was no significant difference in NLRP12, CARD8, IFI16, pyrin, NAIP, Caspase-4/5, IL-18 mRNA between RA patients and HC group. Interestingly, the mRNA levels of IL-18 were significantly higher in the female group than in the male group in RA patients. Although the lymphocyte count in the RA was higher than that in the HC, the two groups were comparable due to the present study compared relative expression levels in human PBMCs. Activated inflammasome leads to increased levels of pro-inflammatory cytokines IL-1beta and IL-18^{[5, 10]}. Therefore, we examined the plasma levels of IL-1beta and IL-18 in RA and HC groups, and found that plasma IL-1beta and IL-18 levels in RA were markedly higher than those in HC group. To further explore whether plasma IL-1beta and IL-18 can reflect the disease activity and inflammation, we correlated the inflammasome mRNA levels and cytokines with DAS28-CRP, CRP, ESR, RF and anti-CCP. The results showed that the mRNA level of AIM2 was negatively correlated with DAS28 and ESR was positively correlated with DAS28.

Wang et al. showed that NLRP3, IL-1beta mRNA in human PBMCs of RA patients had no statistical difference from controls, and caspase-1 mRNA levels were lower than controls, which was different from the results of the present study, probably due to factors such as disease duration or drug use^[11]. We divided NLRP3, caspase-1 and IL-1beta mRNA into five or three groups according to DAS28-CRP, and there was no noticeable difference between the groups (data not shown), suggesting that these mRNAs were not highly expressed due to increased disease activity. Some studies have shown that Tofacitinib (TOF) attenuates NLRP3 activation and reduces serum IL-1beta production^[12]. NLRP3 expression is increased in adjuvant arthritis (AA), collagen-induced arthritis (CIA) animal models^{[13, 14]}. Both IL-1beta and NLRP3 are increased in PBMCs of RA patients^{[15, 16]}, suggesting that NLRP3 exacerbates the inflammatory response in RA. Moreover, inhibitors targeting NLRP3 have been applied to a variety of clinical diseases with good clinical efficacy^[8]. Therefore, NLRP3 plays a pathogenic role in the disease process of RA.

Our study showed that AIM2 levels were significantly high in RA patients compared to the HC group, which was consistent with previous report^[17]. After we divided AIM2 into three groups according to disease activity, the results showed a statistical difference between the active, inactive group and HC group. The highest AIM2 levels were found in the inactive group, which might explain why the relative mRNA levels of AIM2 were negatively correlated with DAS28. Animal models of AIM2 deficiency exhibited milder inflammatory responses and pathological changes^{[18, 19]}. Although the AIM2 levels in RA patients were lower than that in HCs, fibroblast-like synovial cells (FLSs) proliferation was inhibited after AIM2 was silenced in FLSs from RA patients^[20]. Although performance of the results were inconsistent, AIM2 remains a target for RA treatment as far as the current findings. Additionally, there are fewer studies on NLRC4 in RA, only one research from Brazil supports the role of NLRC4 in RA^[21]. Our results showed higher NLRC4 levels in the RA than in the HC group. In conclusion, both AIM2 and NLRC4 may also play pathogenic roles in the RA disease process.

Gene polymorphism of NLRP2 is associated with susceptibility to RA in Chinese Han population^[22]. There are no other reports on NLRP2 in RA, while the present study firstly found that NLRP2 levels in PBMCs of RA patients were significantly lower than those in HC group, but its function still needs to be further studied. In addition, we found that the mRNA levels of NLRP1 were also remarkably lower than those of HCs, consistent with the previous report^[11]. After the RA group was grouped by DAS28, there was no statistical difference between thees groups, indicating that NLRP1 was not associated with disease activity. Different results have been reported on whether genetic polymorphisms of NLRP1 are associated with RA, and some studies have also reported that inflammatory conditions in animal models can be attenuated by inhibiting NLRP1 inflammasome^[23–25]. Taken together, the role of NLRP1 in RA need to be furher explored with larger sample sizes that exclude the influence of other relevant factors. NLRC5 was significantly increased in synovial tissues of AA rats and FLSs of RA patients, and inflammatory cytokines were significantly decreased after NLRC5 silencing^[26–28]. In our study, low NLRC5 mRNA levels showed a strong correlation with NLRP1, probably due to the different cell types.

Regarding CARD8, its genetic polymorphism has been most studied for its association with RA susceptibility or anti-TNF therapy^{[29, 21]}. Caspase-4/5 as a downstream protein of the non-canonical pathway of inflammasome is rarely reported in RA, and genetic polymorphisms of caspase-5 are associated with increased risk of RA development^[30]. Studies have shown that NLRP12 negatively regulates the phosphorylation of signal transducer and activator of transcription 3 (STAT3), the inflammatory response is exacerbated in the NLRP12-/- antigen-induced arthritis (AIA) mouse model^{[31, 32]}. Roles of the inflammasomes mentioned above need to be further investigated.

The levels of plasma IL-1beta and IL-18 in RA patients were significantly increased in comparision with HC group, and there was no significant difference between the groups when IL-1beta was divided into five or three groups, respectively. The use of leflunomide has been reported to decrease the serum level of IL-18^[33]. In this experiment, the study subjects were divided into the group using leflunomide, the group using hormone and the group using both drugs. The plasma level of IL-18 was analyzed between the three groups, and there was no statistical difference in our study. Vasilev et al. reported that serum IL-18 levels were significantly reduced in females^[34]. In the study, there was no statistical difference in plasma IL-18 levels after grouping by gender, while IL-18 mRNA levels were notably lower in the female group than in male, and IL-18 mRNA was correlated with plasma IL-18. The results of this study may also suggest the use of drugs with more targeted IL-18 in the treatment of female patients with RA.

Although common inflammasomes have been reported gradually in RA, there are no systematic studies reporting multiple inflammasomes simultaneously. Our study is a more comprehensive report of common inflammasomes and their associated proteins in RA disease. Future studies with larger sample sizes, in newly diagnosed patients with RA or with a single drug alone are needed due to sample size limitations and drug use. The human body as a complex whole, its pathogenesis is not controlled by one single cytokine and involves complex interactions between pro-inflammatory and anti-inflammatory factors. For example, caspase-1 is a downstream protein of many inflammasomes, so its level can be increased or decreased by a variety of factors. Because of this, inhibitors targeting caspase-1 have also become the focus of research. For example, VX-740(pralnacasan)attenuates osteoarthritis injury, and VX-765༈belnacasan༉inhibits cytokine secretion in RA models^{[35, 36]}. It also includes MCC950, which directly targets the NACHT domain of NLRP3 inflammasome, as well as tranilast༈TR༉^{[37, 38]}. And there is anakinra, an antagonist against IL-1 receptor (IL-1Ra), an anti-IL-1β monoclonal antibody Canakinumab, etc. ^{[39, 40]}. With the deepening of the research on the mechanism of inflammasome, the inhibitors of inflammasome itself or its related upstream and downstream proteins are gradually applied. RA is caused by a variety of factors, genetic or environmental, and its pathogenesis and therapeutic approaches are constantly evolving. Given the important role of inflammasomes in the disease process of RA, a deeper understanding of the mechanisms of action of each inflammasome is important for the development of RA treatment strategies. Overall, our findings indicated the important role of inflammasomes and associated molecules in the pathogenesis of RA patients, which contributed to the diagnosis and treatment of RA.

PBMCs: peripheral blood peripheral blood mononuclear cells

ELISA: Enzyme-Linked Immunosorbent Assay

PAMPs: pathogen-associated molecular patterns

DAMPs: damage-associated molecular patterns

HAMPs: homeostasis-altering molecular processes

PRRs: pattern recognition receptors

NLRP3: NOD-like receptor protein 3

NLRC4: NLR family CARD domain-containing 4

AIM2: absent in melanoma 2

IFI16: human interferon (IFN)g-inducible protein 16

NAIP: NOD-like receptor family apoptosis inhibitory protein

GSDMD: pore-forming protein gasdermin D

CRP: C-reactive protein

ESR: erythrocyte sedimentation rate

RF: rheumatoid factor

anti-CCP: anti-cyclic citrullinated peptide antibodies

DAS28: disease activity score 28

Availability of data and materials

All datasets generated for this study are included in the manuscript and the Supplementary material.

Ethics declarations

Ethics approval and consent to participate

This project was approved by the Ethics Committee of the Shaoxing People’s Hospital (no. 2022-Y346-01) and all study protocols complied with the Declaration of Helsinki. All involved participants provided written informed consent.

Consent for publication

Not applicable.

Competing interests

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Authors’ contributions

DC, GY and RL conceived and designed the experiments. QJ, XW, XX, LH and GZ performed the experiments. QJ, XX and DC analyzed the data. QJ and XW wrote the manuscript. DC revised the manuscript, contributed reagents, materials. QJ and XW contributed equally to this work. All authors contributed to the article and approved the submitted version.

Funding statement

This work was supported by the Basic Public Welfare Research Plan of Zhejiang Province (LGD21H100001), Zhejiang Medical Health Science and Technology Project (No. 2022RC275, 2023RC105), Shaoxing People's Hospital Youth Fund (No. 2022YA10), National Natural Science Foundation of China (No. 81871709), Suzhou Science and Technology Project (No. SYS2019109).

Acknowledgments

We gratefully appreciate the native English speaking editors at American Journal Experts (AJE) for providing reputable English language editing service for our manuscript.

Aletaha D, Smolen JS. Diagnosis and Management of Rheumatoid Arthritis: A Review. JAMA. 2018;320(13):1360–72. https://doi.org/doi:10.1001/jama.2018.13103.
Smolen JS, Aletaha D, McInnes IB. Rheumatoid arthritis. Lancet (London England). 2016;388(10055):2023–38. https://doi.org/doi:10.1016/s0140-6736(16)30173-8.
Strowig T, Henao-Mejia J, Elinav E, Flavell R. Inflammasomes in health and disease. Nature. 2012;481(7381):278–86. https://doi.org/doi:10.1038/nature10759.
Kanneganti TD, Lamkanfi M, Núñez G. Intracellular NOD-like receptors in host defense and disease. Immunity. 2007;27(4):549–59. https://doi.org/doi:10.1016/j.immuni.2007.10.002.
Xue Y, Enosi Tuipulotu D, Tan WH, Kay C, Man SM. Emerging Activators and Regulators of Inflammasomes and Pyroptosis. Trends Immunol. 2019;40(11):1035–52. https://doi.org/doi:10.1016/j.it.2019.09.005.
Martinon F, Burns K, Tschopp J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell. 2002;10(2):417–26. https://doi.org/doi:10.1016/s1097-2765(02)00599-3.
Chen L, Cao SQ, Lin ZM, He SJ, Zuo JP. NOD-like receptors in autoimmune diseases. Acta Pharmacol Sin. 2021;42(11):1742–56. https://doi.org/doi:10.1038/s41401-020-00603-2.
Jiang Q, Wang X, Huang E, Wang Q, Wen C, Yang G, et al. Inflammasome and Its Therapeutic Targeting in Rheumatoid Arthritis. Front Immunol. 2021;12:816839. https://doi.org/doi:10.3389/fimmu.2021.816839.
Aletaha D, Neogi T, Silman AJ, Funovits J, Felson DT, Bingham CO 3, et al. 2010 Rheumatoid arthritis classification criteria: an American College of Rheumatology/European League Against Rheumatism collaborative initiative. Arthritis Rheum. 2010;62(9):2569–81. https://doi.org/doi:10.1002/art.27584.
Shin JI, Lee KH, Joo YH, Lee JM, Jeon J, Jung HJ, et al. Inflammasomes and autoimmune and rheumatic diseases: A comprehensive review. J Autoimmun. 2019;103:102299. https://doi.org/doi:10.1016/j.jaut.2019.06.010.
Wang T, Zhu CL, Wang S, Mo LW, Yang GD, Hu J, et al. Role of NLRP3 and NLRP1 inflammasomes signaling pathways in pathogenesis of rheumatoid arthritis. Asian Pac J Trop Med. 2014;7(10):827–31. https://doi.org/doi:10.1016/s1995-7645(14)60145-0.
Yang X, Zhan N, Jin Y, Ling H, Xiao C, Xie Z, et al. Tofacitinib restores the balance of γδTreg/γδT17 cells in rheumatoid arthritis by inhibiting the NLRP3 inflammasome. Theranostics. 2021;11(3):1446–57. https://doi.org/doi:10.7150/thno.47860.
Guo C, Fu R, Wang S, Huang Y, Li X, Zhou M, et al. NLRP3 inflammasome activation contributes to the pathogenesis of rheumatoid arthritis. Clin Exp Immunol. 2018;194(2):231–43. https://doi.org/doi:10.1111/cei.13167.
Li XF, Shen WW, Sun YY, Li WX, Sun ZH, Liu YH, et al. MicroRNA-20a negatively regulates expression of NLRP3-inflammasome by targeting TXNIP in adjuvant-induced arthritis fibroblast-like synoviocytes. Joint bone spine. 2016;83(6):695–700. https://doi.org/doi:10.1016/j.jbspin.2015.10.007.
Ruscitti P, Cipriani P, Di Benedetto P, Liakouli V, Berardicurti O, Carubbi F, et al. Monocytes from patients with rheumatoid arthritis and type 2 diabetes mellitus display an increased production of interleukin (IL)-1β via the nucleotide-binding domain and leucine-rich repeat containing family pyrin 3(NLRP3)-inflammasome activation: a possible implication for therapeutic decision in these patients. Clin Exp Immunol. 2015;182(1):35–44. https://doi.org/doi:10.1111/cei.12667.
Choulaki C, Papadaki G, Repa A, Kampouraki E, Kambas K, Ritis K, et al. Enhanced activity of NLRP3 inflammasome in peripheral blood cells of patients with active rheumatoid arthritis. Arthritis Res therapy. 2015;17(1):257. https://doi.org/doi:10.1186/s13075-015-0775-2.
Afroz S, Giddaluru J, Vishwakarma S, Naz S, Khan AA, Khan N. A Comprehensive Gene Expression Meta-analysis Identifies Novel Immune Signatures in Rheumatoid Arthritis Patients. Front Immunol. 2017;8:74. https://doi.org/doi:10.3389/fimmu.2017.00074.
Baum R, Sharma S, Carpenter S, Li QZ, Busto P, Fitzgerald KA et al. Cutting edge: AIM2 and endosomal TLRs differentially regulate arthritis and autoantibody production in DNase II-deficient mice. Journal of immunology (Baltimore, Md: 1950). (2015)194(3):873-7. https://doi.org/doi:10.4049/jimmunol.1402573.
Jakobs C, Perner S, Hornung V. AIM2 Drives Joint Inflammation in a Self-DNA Triggered Model of Chronic Polyarthritis. PLoS ONE. 2015;10(6):e0131702. https://doi.org/doi:10.1371/journal.pone.0131702.
Chen Y, Fujuan Q, Chen E, Yu B, Zuo F, Yuan Y, et al. Expression of AIM2 in Rheumatoid Arthritis and Its Role on Fibroblast-Like Synoviocytes. Mediat Inflamm. 2020;2020:1693730. https://doi.org/doi:10.1155/2020/1693730.
Addobbati C, da Cruz HLA, Adelino JE, Melo Tavares Ramos AL, Fragoso TS, Domingues A, et al. Polymorphisms and expression of inflammasome genes are associated with the development and severity of rheumatoid arthritis in Brazilian patients. Inflamm research: official J Eur Histamine Res Soc [et al]. 2018;67(3):255–64. https://doi.org/doi:10.1007/s00011-017-1119-2.
Yang XL, Hu ZD, Wu Q, Liu X, Liu QJ, Zhang YC, et al. Association of polymorphisms in SPARC and NLRP2 genes with rheumatoid arthritis in a Chinese Han population. Mod Rheumatol. 2015;25(1):67–71. https://doi.org/doi:10.3109/14397595.2014.903595.
Sui J, Li H, Fang Y, Liu Y, Li M, Zhong B, et al. NLRP1 gene polymorphism influences gene transcription and is a risk factor for rheumatoid arthritis in han chinese. Arthritis Rheum. 2012;64(3):647–54. https://doi.org/doi:10.1002/art.33370.
Goh LL, Yong MY, See WQ, Chee EYW, Lim PQ, Koh ET, et al. NLRP1, PTPN22 and PADI4 gene polymorphisms and rheumatoid arthritis in ACPA-positive Singaporean Chinese. Rheumatol Int. 2017;37(8):1295–302. https://doi.org/doi:10.1007/s00296-017-3762-x.
Zhang L, Dong Y, Zou F, Wu M, Fan C, Ding Y. 11β-Hydroxysteroid dehydrogenase 1 inhibition attenuates collagen-induced arthritis. Int Immunopharmacol. 2013;17(3):489–94. https://doi.org/doi:10.1016/j.intimp.2013.07.015.
Liu YR, Yang L, Xu QQ, Lu XY, Ma TT, Huang C, et al. Long noncoding RNA MEG3 regulates rheumatoid arthritis by targeting NLRC5. J Cell Physiol. 2019;234(8):14270–84. https://doi.org/doi:10.1002/jcp.28126.
Yu H, Ding C, Dai S, Sun J, Wang S, Zhang Z. Long noncoding RNA FER1L4 regulates rheumatoid arthritis via targeting NLRC5. Clin Exp Rheumatol. 2020;38(4):713–23.
Ji YR, Chen Y, Chen YN, Qiu GL, Wen JG, Zheng Y, et al. Dexmedetomidine inhibits the invasion, migration, and inflammation of rheumatoid arthritis fibroblast-like synoviocytes by reducing the expression of NLRC5. Int Immunopharmacol. 2020;82:106374. https://doi.org/doi:10.1016/j.intimp.2020.106374.
Sode J, Vogel U, Bank S, Andersen PS, Hetland ML, Locht H, et al. Genetic Variations in Pattern Recognition Receptor Loci Are Associated with Anti-TNF Response in Patients with Rheumatoid Arthritis. PLoS ONE. 2015;10(10):e0139781. https://doi.org/doi:10.1371/journal.pone.0139781.
Rui H, Yan T, Hu Z, Liu R, Wang L. The association between caspase-5 gene polymorphisms and rheumatoid arthritis in a Chinese population. Gene. (2018)642:307 – 12. https://doi.org/doi:10.1016/j.gene.2017.11.032.
Prado DS, Veras FP, Ferreira RG, Damasceno LEA, Melo PH, Zamboni DS, et al. NLRP12 controls arthritis severity by acting as a checkpoint inhibitor of Th17 cell differentiation. FASEB journal: official publication of the Federation of American Societies for Experimental Biology. 2020;34(8):10907–19. https://doi.org/doi:10.1096/fj.202000795R.
Zhang X, Nan H, Guo J, Liu J. NLRP12 reduces proliferation and inflammation of rheumatoid arthritis fibroblast-like synoviocytes by regulating the NF-κB and MAPK pathways. Eur Cytokine Netw. 2021;32(2):15–22. https://doi.org/doi:10.1684/ecn.2021.0465.
Gualberto Cardoso PR, Diniz Lopes Marques C, de Melo Vilar K, Dantas AT, Branco Pinto Duarte AL, Pitta IDR et al. Interleukin-18 in Brazilian Rheumatoid Arthritis Patients: Can Leflunomide Reduce It? Autoimmune diseases. (2021)2021:6672987. https://doi.org/doi:10.1155/2021/6672987.
Vasilev G, Manolova I, Ivanova M, Stanilov I, Miteva L, Stanilova S. The role of IL-18 in addition to Th17 cytokines in rheumatoid arthritis development and treatment in women. Sci Rep. 2021;11(1):15391. https://doi.org/doi:10.1038/s41598-021-94841-x.
Wannamaker W, Davies R, Namchuk M, Pollard J, Ford P, Ku G, et al. (S)-1-((S)-2-{[1-(4-amino-3-chloro-phenyl)-methanoyl]-amino}-3,3-dimethyl-butanoyl)-pyrrolidine-2-carboxylic acid ((2R,3S)-2-ethoxy-5-oxo-tetrahydro-furan-3-yl)-amide (VX-765), an orally available selective interleukin (IL)-converting enzyme/caspase-1 inhibitor, exhibits potent anti-inflammatory activities by inhibiting the release of IL-1beta and IL-18. J Pharmacol Exp Ther. 2007;321(2):509–16. https://doi.org/doi:10.1124/jpet.106.111344.
Rudolphi K, Gerwin N, Verzijl N, van der Kraan P, van den Berg W. Pralnacasan, an inhibitor of interleukin-1beta converting enzyme, reduces joint damage in two murine models of osteoarthritis. Osteoarthr Cartil. 2003;11(10):738–46. https://doi.org/doi:10.1016/s1063-4584(03)00153-5.
Coll RC, Hill JR, Day CJ, Zamoshnikova A, Boucher D, Massey NL, et al. MCC950 directly targets the NLRP3 ATP-hydrolysis motif for inflammasome inhibition. Nat Chem Biol. 2019;15(6):556–9. https://doi.org/doi:10.1038/s41589-019-0277-7.
Huang Y, Jiang H, Chen Y, Wang X, Yang Y, Tao J, et al. Tranilast directly targets NLRP3 to treat inflammasome-driven diseases. EMBO Mol Med. 2018;10(4). https://doi.org/doi:10.15252/emmm.201708689.
Calabrese LH. Anakinra treatment of patients with rheumatoid arthritis. The Annals of pharmacotherapy. 2002;36(7–8):1204–9. https://doi.org/doi:10.1345/aph.1A396.
Alten R, Gomez-Reino J, Durez P, Beaulieu A, Sebba A, Krammer G, et al. Efficacy and safety of the human anti-IL-1β monoclonal antibody canakinumab in rheumatoid arthritis: results of a 12-week, Phase II, dose-finding study. BMC Musculoskelet Disord. 2011;12:153. https://doi.org/doi:10.1186/1471-2474-12-153.

No competing interests reported.

SupplementarymaterialTableS1.docx

Download PDF

Journal Publication

published 30 Oct, 2023

Read the published version in BMC Rheumatology →

Editorial decision: Major revision
24 Jul, 2023
Reviews received at journal
22 Jul, 2023
Reviewers agreed at journal
14 Jul, 2023
Reviewers invited by journal
13 Jul, 2023
Editor invited by journal
12 Jul, 2023
Editor assigned by journal
12 Jul, 2023
Submission checks completed at journal
11 Jul, 2023
First submitted to journal
03 Jul, 2023

You are reading this latest preprint version

Inflammasomes in Rheumatoid Arthritis: A Pilot Study

Status:

Journal Publication

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

1. Background

2. Materials and methods

2.1. Objective

2.2 Study design and participants

2.3 Human PBMCs separation and total RNA extraction.

2.4 qRT-PCR Analysis

2.5 Enzyme-linked immunosorbent assay (ELISA)

2.6 Statistical analysis

3. Results

3.1 Characteristics of study subjects

3.2 The mRNA expression levels between RA and HC group

3.3 Inflammasomes and DAS28-CRP in RA patients

3.4 Measure of plasma IL-1beta and IL-18

3.5 Correlation of mRNA expression level and clinical features of RA patients

4. Discussion

5. Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1