Characterization and transcriptome analysis of triadimefon-degrading strain Enterobacter hormaechei TY18

doi:10.21203/rs.3.rs-3140996/v1

Download PDF

Research Article

Characterization and transcriptome analysis of triadimefon-degrading strain Enterobacter hormaechei TY18

https://doi.org/10.21203/rs.3.rs-3140996/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 26 Mar, 2024

Read the published version in Biodegradation →

You are reading this latest preprint version

Triadimefon, a type of triazole systemic fungicide, has been extensively used to control various fungal diseases. However, extensive application of triadimefon contributes to austere environmental pollution, and even threatens human health. In our study, Enterobacter hormaechei strain TY18 could grew well in carbon salt medium (CSM) with triadimefon as sole nitrogen source, and could significantlydegrade triadimefon. Under triadimefon stress, a total of 430 differentially expressed genes (DEGs), including 197 up-regulated and 233 down-regulated DEGs, were found in strain TY18 from transcriptome sequencing (RNA-Seq). Functional classification and enrichment analysis revealed that these DEGs were mainly related to amino acid transport and metabolism, carbohydrate transport and metabolism, small molecule and pyrimidine metabolism. Interestingly, the DEGs encoding monooxygenase and hydrolase activity acting on carbon-nitrogen were highly up-regulated, might be mainly responsible for the metabolism in triadimefon. The finding in this work suggested that the novel strain E. hormaechei TY18 could degrade efficiently triadimefon for the first time, and contribute to further understanding of the degradation mechanism related to triadimefon in strain TY18.

Triadimefon

Biodegradation

Enterobacter hormaechei TY18

Transcriptome sequencing

Differentially expressed gene

Triadimefon, named as [1-(4-chlorophenoxy)-3, 3-dimethyl-1-(1H-1, 2, 4-triazol-1-yl) -2-butanone, CAS No.: 43121-43-3], is a type of 1, 2, 4-triazole systemic fungicide with high efficiency and broad spectrum (Liu et al. 2018; Kong et al. 2020). Triadimefon, developed by Bayer in the 1970s, has been extensively commercialized as racemate agrochemical for the control of various diseases such as leaf spot and anthracnose on chill (Ganeshan et al. 2011), white rust on chrysanthemum (Dickens 2007) and powdery mildews on Astragalus membranaceus and Anacardium occidentale (Chen et al. 2013; Olotu et al. 2013). Furthermore, triadimefon is already known as plant growth regulators, has growth regulating effect on bean and sweet potato, and thus effectively relieves plant stress (Jaleel et al. 2008; Sundaramanickam and Panneerselvam 2009; Wang et al. 2018).

Although triadimefon has great potential for extensive application because of its excellent fungicidal activity and growth regulating effect, triadimefon and its main metabolite triadimenol have potential to exert an adverse effect on wildlife, humans and environment (Li et al. 2014; Zhang et al. 2018). Due to its high solubility, photochemical stability and low biodegradability, the residues of triadimefon may stay in soil and water for a long term, and bring a serious threat to ecological equilibrium and human health (Wang et al. 2018; Mai et al. 2019). In addition, triadimefon is rated as an acute basis as moderately toxic to freshwater fish and invertebrates, considered as a high-dose carcinogen and reproductive toxicant in rodent models and regarded as potential human carcinogen (U. S. Environmental Protection Agency, 2006). Therefore, it is now urgent to develop effective way to remove triadimefon from polluted environment.

Microbial degradation is an effective way to remove the residues of pollutants (Wang et al. 2019). Recently, several micrograms, such as Arthrobacter and Halomonas genus, have been reported to efficiently degrade triadimefon in soil (Singh 2005; Talab et al. 2018). However, this is the first report that the novel strain Enterobacter hormaechei strain TY18 could degrade efficiently triadimefon. The degradation process of E. hormaechei strain TY18 to triadimefon still remains unclear.

E. hormaechei TY18, a novel degrading strain, could grow well in carbon salt medium (CSM) with triadimefon, and has the potential to degrade triadimefon. Herein, the major aims of this work are to investigate the degradation characteristics, and reveal the differentially expressed genes (DEGs) related to triadimefon degradation through transcriptomics sequencing analysis. The results will provide a new sight into the effective method of triadimefon removal in contaminated environment.

Chemicals and culture media

Triadimefon (99.8% purity) was purchased from Agro-Environmental Protection Institute Ministry of Agriculture (Tianjin, China). PCR primer pairs used in this study were synthesized by Sangon Biotech Co., Ltd (Shanghai, China). TaKaRa Taq^™ Premix PCR solution (Version 2.0 plus dye) was obtained from Takara Biomedical Technology (Beijing) Co., Ltd (Beijing, China).

Carbon salt medium (CSM) medium was compose of (g/L) glucose 1.0, KH₂PO₄ 0.5, K₂HPO₄ 1.5, NaCl 0.5 and MgSO₄·7H₂O 0.5 at pH 7.0. Luria-bertani (LB) and nutrient agar (NA) medium were prepared for isolation and culture of bacteria (Wu et al., 2011; Zhang et al., 2012).

Enrichment and isolation of triadimefon-degrading bacteria

Triadimefon-degrading bacteria were isolated by enrichment culture. The enrichment and isolation protocols were modified from the reference described by Wang et al. (2015). 10 g soil sample, collected from long-term triadimefon-polluted site, was added aseptically to 100 ml of CSM with 10 mg/L triadimefon, and incubated in rotary shaker at 28°C and 160 r/min for 7 days. 10 mL of enrichment culture was transferred to 90 mL of fresh CSM with 100 mg/L triadimefon, and incubated in rotary shaker at 28°C and 160 r/min for 7 days. After five times subculture, the triadimefon concentration of the enrichment culture broth increased gradually to 400 mg/L. Finally, the triadimefon-degrading strains were isolated by serial dilution from enrichment culture broth and cultured on CSM agar plates with 100 mg/L triadimefon at 28°C for 4 days. Individual colonies with clear triadimefon-dissolving circle were selected and purified on NA plates for 24 hours, and stored at 4°C prior to use.

Degradation capacity of strain TY18 to triadimefon

Strain TY18 from a single colony was transferred into LB, and shaken (160 r/min) at 28°C for 16 hours. 1 mL of the bacterial culture broth (OD₆₀₀ = 1.0) was transferred into 100 mL CSM with 100 mg/L triadimefon. After 1, 2, 3, 4, 5, 6 and 7 days of incubation at 28°C, 1 mL of the CSM culture broth was prepared for high performance liquid chromatography coupled with tandem mass spectrometry (HPLC-MS/MS) analysis.

HPLC-MS/MS analysis

Shimadzu LC-40D high-performance liquid chromatography (Shimadzu, Japan) coupled to AB SCIEX Triple Quad™ 4500 system equipped with an electrospray ionization interface (Applied Biosystems Sciex, Singapore) was achieved to detect triadimefon concentration. Acquity UPLC BEH C18 (2.1 mm×100 mm i.d., 1.7 µm particle size) column was used for analyte separation at 40 ℃. The mobile phase was comprised of 2 mM ammonium formate plus 0.01% aqueous formic acid (A), and methyl alcohol (B) (50: 50, v/v) at a flow rate of 0.10 mL/min. The injection volume was 10 µL. The mass spectrometer was operating with electrospray ionization (ESI) in positive ion mode. Desolvation gas temperature was 500 ℃ with the flow rate 8.0 L min^− 1. Nebulizing gas pressure was 20.0 psi, and ionspray voltage (IS) was 5500 V. Entrance potential (EP) was 23 V; focusing potential (FP) was 300 V; ion source gas 50 V; Declustering potential (DP) was 65 V; Collision energy (CE) was 23 eV; Collision cell exit potential (CXP) was 10 V; collision cell entrance (CEP) was 23 V. The protonated molecules [M + H]⁺ for triadimefon was identified at m/z 294.1. The transitions m/z 294.1 > 197.1 and m/z 294.1 > 143.1 were used for quantification and qualification analysis, respectively.

Identification of strain TY18

The isolate with triadimefon degrading capacity was subjected to identify according to its physiological and biochemical characteristics, and phylogenetic relationships based on 16S rRNA sequence and gyrB gene. Physiological and biochemical identification was tested based on Bergey’s Manual of Determinative Bacteriology (Holt et al. 1994). Genomic DNA was extracted from fresh bacterial culture in LB for 14–16 hours using the Biospin Bacteria Genomic DNA Extraction Kit (Bioer Technology Co., Ltd., Hangzhou City, China). 16S rRNA and gyrB gene sequences were amplified by polymerase chain reaction (PCR) using primer pairs of 27f (5’- AGAGTTTGATCCTGGCTCAG-3’)/1492r (5’-GGTTACCTTGTTACGACTT-3’), and UP1 (5’-GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA-3’) /UP2 (5’- AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT-3’), respectively (Zhang et al., 2010; Yamamoto and Harayama, 1995). The products were purified and sequenced by Sangon Biotech Co., Ltd (Shanghai, China). Phylogenetic trees were conducted based on 16S rRNA and gyrB gene sequences using Molecular Evolutionary Genetics Analysis (MEGA 5.0) software with the Kimura 2-parameter distance model and the neighbor joining (NJ) method. The bootstrap values of the branch strength were assessed using 1,000 replicates.

RNA isolation, transcriptome library construction and RNA-seq

Strain TY18 was cultured in LB medium at 28°C for 14 h for activation. 1 mL of bacterial suspension (OD_600nm = 1.0) was added to 100 mL CSM with triadimefon (CSM + 1% triadimefon) as treated sample and CSM with urea (CSM + 1% urea) as control sample, respectively. After 72 h of incubation at 28°C, the bacterial suspensions of treated and control samples were centrifuged (8000 r/min, 10 min) at 4°C. The harvested cells were stored at -80°C before use. The total RNA was extracted from three independent biological replicates by using TRIzol® Reagent (Invitrogen Technologies, USA). The RNA quality was determined by 2100 Bioanalyser (Agilent) and quantified using the ND-2000 (NanoDrop Technologies). After DNase treatment, RNA-seq library was prepared by using TruSeq™ RNA sample preparation Kit (San Diego, CA), and further sequenced using Illumina HiSeq×TEN (2 × 150 bp read length). Then, the RNA data generated from Illumina sequencing platform were performed for bioinformatic analysis by using the free online platform of Majorbio Cloud Platform (Shanghai Majorbio Bio-pharm Technology Co., Ltd).

Bioinformatics analysis of the RNA-seq data

High quality reads from RNA-seq were mapped to the reference genome by using Bowtie 2 software (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml). Then, gene expression level was calculated by using FPKM (fragments per kilpbase per million mapped reads) and TPM (transcript per million mapped reads) method (Wang et al. 2022). Subsequently, differentially expressed genes (DEGs) were identified by using the DESeq2 software (http://bioconductor.org/packages/release/bioc/html/DESeq2.html) (Shang et al. 2021). Genes with p-adjust < 0.05 and |log2 fold change|≥1 were considered as DEGs (Liu et al. 2021; Zhang et al. 2022). Based on their homology to protein families, functional categories and annotation of all the DEGs were processed to reveal the basic function using NR (Non-Redundant Protein Database), Swiss-Prot, Protein family (Pfam), Clusters of Orthologous Groups (COG), Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases (Cheng et al. 2018; Ma et al. 2018; Peng et al. 2022; Yang et al. 2022). For functional annotation and enrichment analysis, KEGG pathway enrichments and GO terms were annotated using Blast2GO program and KEGG Automatic Annotation Server (KOBAS) software, respectively (Meng et al. 2019; Yang et al. 2022).

RT-qPCR validation

To validate the gene expression levels from RNA-seq, eighteen candidate genes were detected by RT-qPCR, and the 16S rRNA gene was used as internal reference. The primer pairs of candidate gene were listed in Table 1. The total RNA extracted above (in the section of RNA isolation, transcriptome library construction, and RNA-seq) was also used in this experiment. After gDNA, cDNA templates were synthesized employing the total RNA using Evo M-MLV Mix Kit with gDNA Clean for qPCR (AG11728, Accurate Biology, Changsha, China). Next, real-time PCR was conducted using ChamQ Universal SYBR qPCR Master Mix (Q711-03, Vazyme Biotech., Nanjing, China). The relative expression levels of candidate genes were detected using the 2^−ΔΔCT method (Schmittgen and Livak 2008).

Table 1

Primer pairs of candidate genes used for the validation by RT-qPCR
Genes	Forward primer sequences (5’-3’)	Reverse primer sequences (5’-3’)
16SrRNA	GCGTAGGCGTATCCGTAGTA	GCTGGTAGATCTGACGGTGA
rutA	ACGCCGACTTCAACTTCTGCTTC	TCCTTCTGGCTCTGCTCGGTAAG
rutB	AAGGCGGGTATCTGGATCTG	TTCAGGGCGTTGGATTTGTG
rutC	CACGCTGCCGTTTGATAAAG	ATGCTGTTGAAGGTCACGTC
rutD	GCACAGCCGTTGTTCCTCTACC	CAGATCGTCGGTGGAGCAGATAATC
rutE	CCATAACGGCTGGCTGGATATACC	TGTTGCGAAAGGCGGTCTCTTC
rutF	CGGACAGGAGCCTTTATCCA	CAGAATGTCGTGAGTGCCAA
Cmm	CCGCTATCTGCAACTGGATG	GGCAAGTTCGTCTGCATCAT
dapB	TGAGGCGGTGAAAGAAGACT	TCAGTGGACGCATCCTGAAT
nfsB	GCACTGAAGAGGGTAAAGCG	TCAGCCTCTTCCTGATCGAC
aroH	GGATATGGTGACCGGACAGT	ATGGCATCTACGGCAATTCG
Nd	CTGCTGCATCAGTTCCTGTC	CGTTGTCGACGTTCTGGAAA
PmA	GCCTCTTCCGACACCTTCTA	CGTAGTTCATGACGCCCATC
deoA	GGCGATGCGAGATTCAGGAACC	ATCAGCGGGATGGAGTCTACGG
srlE	ATTCACTCCACGGGCAAATC	GCGTGATGTTGTCCTCCTTC
PmB	AACAGCGGTCTTGAACTGCGTATC	TCGGGTTAAATGCGGCGTTCTC
pka	TGCGGCAGAACGGCTATTGATG	CAGGCACAGCGGATGGTCATTG
hutU	CCGCCTATATTCGTCCGCTGTTC	ATGGCTTCGGTTTCACGGTTCG
ychH	GGGTTGGGACTGTTCGTGATGG	GCGGCATCGTTTATCGTAATGGC

Isolation and identification of triadimefon-degrading bacterium

According to enrichment culture, the triadimefon-degrading bacterial strain was isolated from a long-term triadimefon-polluted soil using CSM with triadimefon as sole nitrogen source. The strain with clear dissolving circle (circle diameter of 3.2 cm) was selected and designated as TY18 (Fig. 1B). This strain was deposited in China General Microbiological Culture Collection Center (accession number: CGMCC 2022258). Strain TY18 is a Gram-negative, anaerobic, and straight rod-shaped. Its colony is circular, convex, smooth and opaque on NA plate (Fig. 1A). The colour of the colony changed from ivory white to yellowish gradually during 48 hours. The physiological and biochemical characteristics of strain TY18 were shown in Table 2. The results were consistent with the description of Enterobacter hormaechei (Holt et al. 1994). In the phylogenetic tree based on 16S rRNA sequence and gyrB gene, strain TY18 formed unique clade with the isolates of Enterobacter hormaechei, and was distantly separated from other Enterobacter species (Fig. 2). Thus, strain TY18 was identified as Enterobacter hormaechei based on morphological, physiological and biochemical characteristics, and phylogenetic analysis of 16S rRNA sequence and gyrB gene.

Table 2

Physiological and biochemical characteristics of strain TY18
Test	Strain TY18	Test	Strain TY18
Voges-Proskauer	+	Acid production:
Malonate utilization	+	D-Glucose	+
Arginine dihydrolase	+	Dulcitol	+
Indole production	-	L-rhamnose	+
Gelatin hydrolysis	-	Sucrose	+
Nitrate reduction	+	Lactose	-
Ornithine decarboxylase	+	Dulcitol	+
Cirate (Simmons)	+	D-Mannose	+
Hydrogen sulfide production	-	D-Sorbitol	-
Gelatin hydrolysis	-	Glycerol	-
Phenylalanine deaminase	-	Raffinose	-
Lysine decarboxylase	-

Recently, only a little information about degrading bacteria has been reported with the potential to degrade efficiently triazole compounds. Wu et al. (2018) reported a newly isolated strain Sphingomonas sp. NJUST37 with excellent bioaugmentation potential for tricyclazole removal. Woo et al. (2010) investigated fungal degradation using a wood matrix, and found that Trametes versicolor and Fomitopsis palustris have the ability to degrade tebuconazole and propiconazole. Wang et al. (2018) reported that Serratia marcescens strain B1 could reduce effectively the tebuconazole residues in contaminated soil and Chinese cabbage. Satapute and Kaliwal (2016) presented the strain Pseudomonas aeruginosa PS-4 and Burkholderia sp. BBK_9, isolated from contaminated paddy soil, found to be an efficient way to reduce propiconazole. However, Enterobacter hormaechei capable of degrading triadimefon has, to our knowledge, not been reported so far.

Biodegradation characteristics of strain TY18 to triadimefon

The degradation pattern and growth curve of strain TY18 were investigated in CSM with 50 mg/L triadimefon. As shown in Fig. 3, the residue of triadimefon was reduced gradually after inoculation of strain TY18. Within 7 days, the concentration of the treatment with strain TY18 was 10.87 mg/L, whereas that of the control without strain TY18 was 41.20 mg/L, probably because strain TY18 could derive triadimefon as sole nitrogen source. Meanwhile, with the decline of the degradation pattern, the growth curve of strain TY18 in cell density (OD₆₀₀) was found to be increasing gradually from the initial OD₆₀₀ of 0.053 to final OD₆₀₀ of 1.808 within 7 days, indicating that strain TY18 could grow well in CSM with triadimefon.

Microorganisms play a major role in the degradation of multiple pollutants (Meng et al. 2014; Zhou et al. 2021; Vera et al. 2022). Singh (2005) reported the important factors affecting triadimefon degradation by the microorganisms in soils. Triadimefon, composed of nitrogen-containing heterocyclic ring, could be degraded photocatalytically in the environment (Reddy et al. 1999; Sun et al. 2008). However, the triazole moiety of triadimefon was degraded slowly (Reddy et al. 1999). The results support that strain TY18 could not only utilize triadimefon as sole nitrogen source, but degrade significantly triadimefon in the inoculated vials. It is noticed that the degradation of strain TY18 to triadimefon was very slow after incubation. Subsequently, with the exponential growth of strain TY18, the degradation rates escalated. After 5 days of incubation, the degradation rates declined gradually when strain TY18 grew to the plateau phase, which is in better agreement with the degradation characteristics of bacterial strain to pollutants (Wang et al. 2015; Zhang et al. 2016; Wang et al. 2018). This phenomenon might be attributed to two possible reasons. Firstly, it is necessary for the strain to survive and adapt to the environment when it was reintroduced to culture substrate containing triadimefon. Another possible reason may be the fact that the strain could utilize the pollutants as sole nitrogen source for growth, and remove effectively the pollutants from the environment under the suitable conditions. The finding also demonstrates that CSM with triadimefon could provide sufficient nutriment and energy for strain growth and contribute to degradation efficiency.

Transcriptome profiles in strain TY18 under triadimefon stress

The response of the transcriptome in strain TY18 to triadimefon were investigated to reveal the variations in gene expression profiles between the treated and control samples (with and without triadimefon) through RNA-seq analysis. As shown in Table 3, the results of RNA-seq for strain TY18 showed that a mean of 27091078 and 27857607 reads were obtained in the control and the treated samples, respectively. The quality scores at the levels of clean Q20 and Q30 for the control and treated samples ranged from 96.31–99.05%, indicating good quality of the RNA-seq data. As shown in Fig. 4a, 6028 and 5073 unigenes remained for the control and treated samples, respectively. Among these genes, 4993 unigenes were simultaneously obversed in the control and the treated samples. Violin plot represented the changes of gene expression levels for DEGs between the treated and control samples. In Fig. 4b, the enlarged part represented the region with high gene expression level in the whole sample. In response to triadimefon stress, a total of 430 DEGs, including 197 up-regulated and 233 down-regulated DEGs, were obtained in the treated and control samples (Fig. 4c). Furthermore, heatmap was used to visually present expression levels of DEGs based on different colors. Red and blue color indicated high and low gene expression level, respectively. DEGs with similar expression levels were identified by cluster analysis. The expression levels of three treated samples formed a clade, and were distantly separated from three control samples (Fig. 4d). Transcriptomics sequencing are commonly used to reveal the alterations in gene transcription level in response to environmental stress (Tang et al. 2021), and would be useful to understand the degradation mechanism of triadimefon by degrading bacterium.

Table 3

Distribution of base mass and quality control in RNA-seq data
Sample Name	Raw reads	Raw Bases (bp)	Raw Error Rate (%)	Raw Q20 (%)	Raw Q30 (%)	Clean Reads	Clean Bases (bp)	Clean Error Rate (%)	Clean Q20(%)	Clean Q30(%)
CONTROL_1	29893754	4513956854	0.0251	97.69	94.46	29537554	3758000221	0.0227	98.99	96.56
CONTROL_2	25651156	3873324556	0.0252	97.55	94.34	25307710	3162603514	0.0225	99.05	96.71
CONTROL_3	25728324	3884976924	0.0249	97.69	94.61	25482786	3364408872	0.0229	98.89	96.31
TEST_1	29933848	4520011048	0.0248	97.84	94.61	29505170	3528077561	0.0225	99.04	96.72
TEST_2	26571800	4012341800	0.0247	97.84	94.80	26311756	3445546455	0.0227	98.99	96.56
TEST_3	27067174	4087143274	0.0242	98.17	95.10	26841622	3514892829	0.0227	98.98	96.50

Function classification, annotation and enrichment analysis of DEGs

Under triadimefon stress, 430 unigenes was found to be differentially expressed compared with the control samples (without triadimefon). COG function classification was used to predict the possible unigene functions (Meng et al. 2019). The results showed that a total of 403 DEGs were functionally classified into 18 categories of COG database. The category of “Amino acid transport and metabolism” was the largest group (40 unigenes), followed by “Carbohydrate transport and metabolism” (33 unigenes), and “Transcription” (32 unigenes) (Fig. S1). It should be noted that 115 DEGs with unknown-function were found based on COG function classification, and deserved further work. GO annotation analysis was used to analyze the biological functions of unigenes (Shang et al. 2021). As shown in Fig. S2a, a total of 300 DEGs were successfully classified into three main GO categories, with 35.17% for biological process, 24.74% for cellular component and 40.08% for molecular function. In addition, the three GO categories divided into 20 subcategories. In the biological process, metabolic process and cellular process accounted for a large percent (72.97%). Cell part and membrane part had the most abundant among cellular component terms. It is highlighted that catalytic activity and binding had the largest percent of proteins terms in molecular function. Based on the KEGG database, 103 DEGs were involved in 6 branches with 17 pathways. Among these KEGG annotated sequences, “Carbohydrate metabolism” and “Membrane transport” were the main pathways with the percentages of 31.07% and 25.24%, respectively (Fig. S2b). COG function classification, GO and KEGG annotation and enrichment analysis indicated that most of DEGs could be related to the transport and metabolism processes of amino acid, carbohydrate, small molecule, pyrimidine, histidine, fructose and mannose, and tyrosine and pyrimidine-containing compound. Moreover, these DEGs could participate in membrane transport, catalytic activity, phenylalanine, tyrosine and tryptophan biosynthesis and nitrogen utilization. Carbohydrate metabolisms could provide the primary energy and substrate source, and are the most important metabolic pathways for biodegradation of organic pollutants in organism (Meng et al. 2019; Liu et al. 2021). Additionally, the processes of amino acid transport and metabolism, secondary metabolisms, membrane transport might also play an important role in the biodegradation behavior (Yang et al. 2022). This finding is in agreement with the biodegradation of Pseudomonas brassicacearum strain MPDS to polycyclic aromatic hydrocarbons (Liu et al. 2021) and chlorantraniliprole detoxification in Chilo suppressalis (Meng et al. 2019). Interestingly, some DEGs were found to be involved in nitrogen utilization and metabolism, nitrogen compound metabolic process (shown in Table S1), which suggests that strain TY18 might have novel functional genes for utilizing triadimefon as sole nitrogen source and were conducive to triadimefon degradation.

To further reveal the response of strain TY18 to triadimefon, GO and KEGG enrichment analysis of these 430 DEGs were performed. Among these DEGs, 317 of them were classified into 170 GO terms, of which 47 GO terms were significantly enriched (Q-value < 0.01). The top 25 GO terms were analyzed in Fig. 5a. The results showed that the five most enriched terms were “aromatic amino acid family metabolic process”, “small molecule metabolic process”, “uracil metabolic process”, “pyrimidine-containing compound catabolic process” and “nitrogen utilization”. Interestingly, gene cluster rutABCDEF, including six genes (rutA to -F), could be classified into these four most enriched terms (except “aromatic amino acid family metabolic process”). As shown in Fig. 5b, 336 DEGs could be grouped into 103 predicted metabolic pathways. According to the analysis of the top 25 KEGG pathways, “Phenylalanine, tyrosine and tryptophan biosynthesis”, “Pyrimidine metabolism”, “Histidine metabolism”, “Fructose and mannose metabolism” and “Tyrosine metabolism” were found to be significantly enriched (Q-value < 0.01). It is obvious that gene cluster rutABCDEF could be mapped to the enrichment pathway of “Pyrimidine metabolism”. In this study, 41 DEGs might be participate triadimefon metabolism, including eight for nitrogen utilization, nineteen for nitrogen compound metabolic process, one for nitrogen metabolism, ten for xenobiotics biodegradation metabolism and three for catalytic activity, were also screened from the transcriptome data (Table S1). The gene cluster rutABCDEF were highly up-regulated with the log2 fold change of 5.18–7.43, and might be essential to triadimefon degradation. Specially, rutA encoding the enzyme of monooxygenase was the most up-regulated gene, followed by rutB and rutD encoding hydrolase, acting on carbon-nitrogen activity, and rutC encoding hydrolase, acting on oxidoreductase activity. Several DEGs, encoding oxidoreductase (dapB, nfsB, feaB, hpaB and Nd), 2-oxopent-4-enoate hydratase (hpaH), S-methyltransferase (gene id: FR772_11625), 3-deoxy-7-phosphoheptulonate synthase (aroH) and 3-dehydroquinate dehydratase (aroQ), might be also responsible for triadimefon metabolism process.

Previous studies demonstrated that triazole compounds could be degraded via oxidation, hydrolysis and hydroxylation processes (Trivedi et al. 2016; Satapute and Kaliwal 2016). Trivedi et al. (2016) reported that degradation genes encoding hydroxylase, monooxygenase, dioxygenase and hydrolase involved in carbaryl metabolism in Pseudomonas sp. C5pp. Zhang et al. (2021) found a novel hydrolase PyzH in Pseudomonas sp. BYT-1 was responsible for the cleavage of C = N double bond of pymetrozine. Several monooxygenases were found to be involved in the degradation of organic compounds such as chlorimuron-ethyl, trichlorfon, lignin, isoprene and BDE-47 (Cheng et al. 2018; Ma et al. 2018; Margesin et al. 2021; Singh et al. 2021; Tang et al. 2021). It is proved for the first time that strain TY18, a novel degrading bacterium isolated in our laboratory, could grow well in CSM with triadimefon as sole nitrogen. The degradation process might be involved in the metabolism of nitrogen element in triadimefon. Gene cluster rutABCDEF in strain TY18 could be involved in nitrogen utilization, and might be associated with triadimefon metabolism. Interestingly, rutB and rutD gene encoding hydrolase activity acting on carbon-nitrogen was highly up-regulated with the log2 fold change of 7.4772 and 5.3548, respectively (Table S1), which were consistent with the action of hydrolase PyzH in Pseudomonas sp. BYT-1 (Zhang et al. 2021). Moreover, rutA gene encoding monooxygenase was also significantly up-regulated. Monooxygenase could participate in the oxidation and mineralization of the benzene ring during the degradation of PAHs (Tang et al. 2021), and complete cleavage of 1, 2, 4-triazole ring in propiconazole (Satapute and Kaliwal 2016). Thus, rutA gene encoding monooxygenase might be usually associated with triazole ring cleavage in triadimefon. Therefore, rutA, rutB and rutD might be crucial triadimefon-degrading enzymes, and could play important roles in the metabolism of triadimefon. However, further studies will be done to confirm the degradation function of these genes, such as gene cloning, degradation pathway deduction and signaling pathway regulation.

RT-qPCR analysis

For validation of the RNA-seq data, eighteen DEGs were selected to perform RT-qPCR analysis. The gene expression levels of RT-qPCR were compared with those of the RNA-seq data. As shown in Fig. 6, the expression patterns of all the tested genes for RT-qPCR were consistent with those of RNA-seq data, incidating highly reliable RNA-Seq data in the response to triadimefon.

A novel degrading strain Enterobacter hormaechei TY18 was isolated from long-term polluted soil, exhibited excellent degradation capacity to triadimefon under the optimal conditions. Transcriptome profiles of strain TY18 were elucidated under triadimefon stress, and the DEGs related to degradation process were annotated and categorized using COG, GO and KEGG databases, and mapped to enrichment pathways based on GO and KEGG enrichment analysis. These findings in this study would be useful for further investigation of degradation mechanism of triadimefon by strain TY18.

Acknowledgements This work was supported by Basic Research Program Project of Shanxi Province (20210302123405), Science and Technology Innovation Projects of Universities in Shanxi Province (2021L102), the Earmarked Fund for Modern Agro-industry Technology Research System (2021-11).

Data availability The raw RNA-seq data were deposited in NCBI Sequence Read Archive database under BioProject accession number PRJNA923466.

Code availability Not applicable.

Conflict of interest The authors declare no competing interests.

Ethical approval Not applicable.

Consent to participate Not applicable.

Consent for publication All the authors agree to publish this article.

Chen TX, Chen XR, Wang Y, Xu PG, Yang XL (2013) Pathogen identification and chemical control of powdery mildew on Astragalus membranaceus. Agrochemicals 52(8):599–601, 623. https://doi.org/10.16820/j.cnki.1006–0413.2013.08.017
Cheng Y, Zang H, Wang H, Li D, Li C (2018) Global transcriptomic analysis of Rhodococcus erythropolis D310-1 in responding to chlorimuron-ethyl. Ecotox Environ Safe 157:111–120. https://doi.org/10.1016/j.ecoenv.2018.03.074
Dickens JSW (2007) Studies on the chemical control of chrysanthemum white rust caused by Puccinia horiana. Plant Pathol 39(3):434–442. https://doi.org/10.1111/j.1365-3059.1990.tb02519.x
Ganeshan G, Chethana BS, Rao AS, Bellishree K (2011) Comparative efficacy of myclobutanil, triadimefon and mancozeb against major fungal diseases of chilli. Pest Manag Hortic Ecosyst 17(1):42–47.
Holt S, Krieg NR, Sneath PHA, Staley JT, Williams ST (1994) Bergey’s Manual of Determinative Bacteriology. 9th edn. Lippincott Williams and Wilkins, Baltimore, MD.
Jaleel CA, Gopi R, Kishorekumar A, Manivannan P, Sankar B, Panneerselvam R (2008) Interactive effects of triadimefon and salt stress on antioxidative status and ajmalicine accumulation in Catharanthus roseus. Acta Physiol Plant 30(3):287–292. https://doi.org/10.1007/s11738-007-0119-1
Kong Z, Quan R, Fan B, Liao Y, Chen J, Li M, Dai X (2020) Stereoselective behaviors of the fungicide triadimefon and its metabolite triadimenol during malt storage and beer brewing. J Hazard Mater 400:123238. https://doi.org/10.1016/j.jhazmat.2020.123238
Li Y, Dong F, Liu X, Xu J, Han Y, Zheng Y (2014) Chiral fungicide triadimefon and triadimenol: stereoselective transformation in greenhouse crops and soil, and toxicity to Daphnia magna. J Hazard Mater 265:115–123. https://doi.org/10.1016/j.jhazmat.2013.11.055
Liu N, Jin X, Zhou J, Wang Y, Yang Q, Wu F, Giesy JP, Johnson AC (2018) Predicted no-effect concentration (PNEC) and assessment of risk for the fungicide, triadimefon based on reproductive fitness of aquatic organisms. Chemosphere 207:682–689. https://doi.org/10.1016/j.chemosphere.2018.05.093
Liu Y, Hu H, Zanaroli G, Xu P, Tang H (2021) A Pseudomonas sp. strain uniquely degrades PAHs and heterocyclic derivatives via lateral dioxygenation pathways. J Hazard Mater 403:123956. https://doi.org/10.1016/j.jhazmat.2020.123956
Ma Y, Li B, Ke Y, Zhang Y, Zhang Y (2018) Transcriptome analysis of Rana chensinensis liver under trichlorfon stress. Ecotox Environ Safe 147:487–493. http://dx.doi.org/10.1016/j.ecoenv.2017.09.016
Mai B, Fan J, Jiang Y, He R, Lai Y, Zhang W (2019) Fast enantioselective determination of triadimefon in different matrices by supercritical fluid chromatography. J Chromatogr B 1126–1127:121740. https://doi.org/10.1016/j.jchromb.2019.121740
Margesin R, Volgger G, Wagner AO, Zhang D, Poyntner C (2021) Biodegradation of lignin monomers and bioconversion of ferulic acid to vanillic acid by Paraburkholderia aromaticivorans AR20-38 isolated from Alpine forest soil. Appl Microbiol Biotechnol 105(4):2967–2977. https://doi.org/10.1007/s00253-021-11215-z
Meng P, Pei H, Hu W, Shao Y, Li Z (2014) How to increase microbial degradation in constructed wetlands: influencing factors and improvement measures. Bioresour Technol 157:316–326. https://doi.org/10.1016/j.biortech.2014.01.095
Meng X, Dong F, Qian K, Miao L, Yang X, Ge H, Wu Z, Wang J (2019) Transcriptome analysis reveals global gene expression changes of Chilo suppressalis in response to sublethal dose of chlorantraniliprole. Chemosphere 234:648–657. https://doi.org/10.1016/j.chemosphere.2019.06.129
Olotu MI, Maniania NK, Ekesi S, Seguni ZS, du Plessis H (2013) Effect of fungicides used for powdery mildew disease management on the African weaver ant, Oecophylla longinoda (Hymenoptera: Formicidae), a biocontrol agent of sap-sucking pests in cashew crops in Tanzania. Int J Trop Insect Sci 33(4):283–290. https://doi.org/10.1017/S1742758413000313
Peng F, Ye M, Liu Y, Liu J, Lan Y, Luo A, Zhang T, Jiang, Song H (2022) Comparative genomics reveals response of Rhodococcus pyridinivorans B403 to phenol after evolution. Appl Microbiol Biotechnol 106(7):2751–2761. https://doi.org/10.1007/s00253-022-11858-6
Reddy KSN, Hisanaga T, Tanaka K (1999) Photodegradation of fungicide triadimefon and pesticide pirimicarb in aqueous TIO₂ suspension. Toxicol Environ Chem 68(3–4):403–412. https://doi.org/10.1080/02772249909358673
Satapute P, Kaliwal B (2016) Biodegradation of the fungicide propiconazole by Pseudomonas aeruginosa PS-4 strain isolated from a paddy soil. Ann Microbiol 66(4):1355–1365. https://doi.org/10.1007/s13213-016-1222-6
Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3:1101–1108. https://doi.org/10.1038/nprot.2008.73>
Shang X, Geng L, Yang J, Zhang Y, Xu W (2021) Transcriptome analysis reveals the mechanism of alkalinity exposure on spleen oxidative stress, inflammation and immune function of Luciobarbus capito. Ecotox Environ Safe 225:112748. https://doi.org/10.1016/j.ecoenv.2021.112748
Singh A, Pandey AK, Dubey SK (2021) Biodegradation of isoprene by Arthrobacter sp. strain BHU FT2: Genomics-proteomics enabled novel insights. Bioresour Technol 340(3):125634. https://doi.org/10.1016/j.biortech.2021.125634
Singh N (2005) Factors affecting triadimefon degradation in soils. J Agr Food Chem. 53(1):70–75. https://doi.org/10.1021/jf048884j
Sun X, Yang G, Cao X, Lin Z (2008) Photochemical degradation of triadimefon in seawater. J Ocean U Chin 7(2):171–176. https://doi.org/10.1007/s11802-008-0171-5
Sundaramanickam TSA, Panneerselvam R (2009) Changes in growth and pigment content in sweet potato by triadimefon and hexaconazole. J Phytology 1(5):333–341.
Talab KMA, Yang ZH, Li JH, Zhao Y, Xiong YB (2018) The influence of microbial communities for triadimefon enantiomerization in soils with different pH values. Chirality 30(11):293–301. https://doi.org/10.1002/chir.22796
Tang S, Yin H, Yu X, Chen S, Dang Z (2021) Transcriptome profiling of Pseudomonas aeruginosa YH reveals mechanisms of 2, 2’, 4, 4’-tetrabrominated diphenyl ether tolerance and biotransformation. J Hazard Mater 403:12408. https://doi.org/10.1016/j.jhazmat.2020.124038
Trivedi VD, Jangir PK, Sharma R, Phale PS (2016) Insights into functional and evolutionary analysis of carbaryl metabolic pathway from Pseudomonas sp. strain C5pp. Scientific Reports 6:38430. https://doi.org/10.1038/srep38430
U.S. Environmental Protection Agency (U.S. EPA) (2006) Triadimefon reregistration eligibility decision (RED) and triadimenol tolerance reassessment and risk management decision (TRED) fact sheet, Washington DC: Offifice of Pesticide Programs, U.S. Environmental Protection Agency.
Vera A, Wilson FP, Cupples AM (2022) Predicted functional genes for the biodegradation of xenobiotics in groundwater and sediment at two contaminated naval sites. Appl Microbiol Biotechnol 106(2):835–853. https://doi.org/10.1007/s00253-021-11756-3
Wang X, Hou X, Liang S, Lu Z, Hou Z, Zhao X, Sun F, Zhang H (2018) Biodegradation of fungicide Tebuconazole by Serratia marcescens strain B1 and its application in bioremediation of contaminated soil. Int Biodeter Biodegr 127:185–191. https://doi.org/10.1016/j.ibiod.2017.12.001
Wang X, Lu H, Li Q, Zhou Y, Zhou J (2022) Comparative genome and transcriptome of Rhodococcus pyridinivorans GF3 for analyzing the detoxification mechanism of anthraquinone compounds. Ecotox Environ Safe 237:113545. https://doi.org/10.1016/j.ecoenv.2022.113545
Wang Y, Wang C, Li A, Gao J (2015) Biodegradation of pentachloronitrobenzene by Arthrobacter nicotianae DH19. Lett Appl Microbiol 61(4):403–410. https://doi.org/10.1111/lam.12476
Wang Y, Zhang X, Wang L, Wang C, Fan W, Wang J (2019) Effective biodegradation of pentachloronitrobenzene by a novel strain Peudomonas putida QTH3 isolated from contaminated soil. Ecotox Environ Safe 182:109463. https://doi.org/10.1016/j.ecoenv.2019.109463
Woo C, Daniels B, Stirling R, Morris P (2010) Tebuconazole and propiconazole tolerance and possible degradation by Basidiomycetes: A wood-based bioassay. Int Biodeter Biodegr 64(5):403–408. https://doi.org/10.1016/j.ibiod.2010.01.009
Wu H, Shen J, Jiang X, Liu X, Sun X, Li J, Han W, Mu Y, Wang L (2018) Bioaugmentation potential of a newly isolated strain Sphingomonas sp. NJUST37 for the treatment of wastewater containing highly toxic and recalcitrant tricyclazole. Bioresour Technol 264:98–105. https://doi.org/10.1016/j.biortech.2018.05.071
Wu Z, Liu Y, Zhang J, Shen W, Lu W, Hong Q, Li S (2011) Isolation of a heavy metal-resistant 4-chloronitrobenzene degrader Cupriavidus sp. D4 and cloning of its cnb genes. Int Biodeter Biodegr 65(6):871–876. https://doi.org/10.1016/j.ibiod.2011.06.007
Yamamoto S, Harayama S (1995) PCR amplification and direct sequencing of gyrB genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl Environ Microb 61(3):1104–1109. https://doi.org/10.1016/j.ijms.2010.08.029
Yang ZK, Huang XL, Peng L (2022) Transcriptome analysis reveals gene expression changes of the basidiomycetous yeast Apiotrichum mycotoxinivorans in response to ochratoxin A exposure. Ecotox Environ Safe 246:114146. https://doi.org/10.1016/j.ecoenv.2022.114146
Zhang C, Jia L, Wang S, Qu J, Li K, Xu L, Shi Y, Yan Y (2010) Biodegradation of beta-cypermethrin by two Serratia spp. with different cell surface hydrophobicity. hydrophobicity. Bioresour Technol 101(10):3423–3429. https://doi.org/10.1016/j.biortech.2009.12.083
Zhang H, Zhang Y, Hou Z, Wang X, Wang J, Lu Z, Zhao X, Sun F, Pan H (2016) Biodegradation potential of deltamethrin by the Bacillus cereus strain Y1 in both culture and contaminated soil. Int Biodeter Biodegr 106:53–59. https://doi.org/10.1016/j.ibiod.2015.10.005
Zhang L, Yang Z, Yang M, Yang F, Wang G, Liu D, Li X, Yang L, Wang Z (2022) Copper-induced oxidative stress, transcriptome changes, intestinal microbiota, and histopathology of common carp (Cyprinus carpio). Ecotox Environ Safe 246:114136. https://doi.org/10.1016/j.ecoenv.2022.114136
Zhang M, Ren Y, Du S, Zhou Y, Jiang W, Ke Z, Jiang M, Qiu J, He J, Hong Q (2021) A novel hydrolase PyzH catalyses the cleavage of C = N double bond for pymetrozine degradation in Pseudomonas sp. BYT-1. Environ Microbiol 23(6):3265–3273. https://doi.org/10.1111/1462-2920.15557
Zhang W, Lu Y, Huang L, Cheng C, Di S, Chen L, Zhou Z, Diao J (2018) Comparison of triadimefon and its metabolite on acute toxicity and chronic effects during the early development of Rana nigromaculata tadpoles. Ecotox Environ Safe 156:247–254. https://doi.org/10.1016/j.ecoenv.2018.03.009
Zhang X, Xu D, Zhu C, Lundaa T, Scherr KE (2012) Isolation and identification of biosurfactant producing and crude oil degrading Pseudomonas aeruginosa strains. Chem Eng J 209:138–146. https://doi.org/10.1016/j.cej.2012.07.110
Zhou Z, Wu X, Lin Z, Pang S, Mishra S, Chen S (2021) Biodegradation of fipronil: current state of mechanisms of biodegradation and future perspectives. Appl Microbiol Biotechnol 105(20):7695–7708. https://doi.org/10.1007/s00253-021-11605-3

No competing interests reported.

TableS1.doc
Table S1 Differentially expressed genes related to metabolism in strain TY18 under triadimefon stress
Fig.S1.jpg
Fig. S1. COG function classification of differentially expressed genes (DEGs) in strain YT18 under triadimefon stress
Fig.S2.jpg
Fig. S2 Histograms of GO categorization (a) and KEGG annotation (b) of differentially expressed genes (DEGs) in strain YT18 under triadimefon stress

Download PDF

Journal Publication

published 26 Mar, 2024

Read the published version in Biodegradation →

Editorial decision: Revision requested
28 Dec, 2023
Reviews received at journal
27 Dec, 2023
Reviewers agreed at journal
19 Dec, 2023
Reviewers agreed at journal
13 Oct, 2023
Reviews received at journal
13 Oct, 2023
Reviewers agreed at journal
03 Oct, 2023
Reviewers invited by journal
03 Oct, 2023
Editor assigned by journal
08 Jul, 2023
Submission checks completed at journal
08 Jul, 2023
First submitted to journal
05 Jul, 2023

You are reading this latest preprint version

Characterization and transcriptome analysis of triadimefon-degrading strain Enterobacter hormaechei TY18

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and methods

Chemicals and culture media

Enrichment and isolation of triadimefon-degrading bacteria

Degradation capacity of strain TY18 to triadimefon

HPLC-MS/MS analysis

Identification of strain TY18

RNA isolation, transcriptome library construction and RNA-seq

Bioinformatics analysis of the RNA-seq data

RT-qPCR validation

Results and discussion

Isolation and identification of triadimefon-degrading bacterium

Biodegradation characteristics of strain TY18 to triadimefon

Transcriptome profiles in strain TY18 under triadimefon stress

Function classification, annotation and enrichment analysis of DEGs

RT-qPCR analysis

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1