Establishment of amygdalin antitumor efficacy against human acute monocytic leukemia cell line (THP‐1) with antimicrobial investigations, in vitro Study

doi:10.21203/rs.3.rs-3146195/v1

Download PDF

Research Article

Establishment of amygdalin antitumor efficacy against human acute monocytic leukemia cell line (THP‐1) with antimicrobial investigations, in vitro Study

https://doi.org/10.21203/rs.3.rs-3146195/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Leukemia is an incurable disease; it exhibits strong resistance to chemotherapy and other therapies, its seriousness is not only in this fact but also, it represents the most common childhood cancer, and mortality. In this study, the cytotoxic of amygdalin (AMG) against the cell line of human monocytic leukemia (THP-1) was recoded in attempting for providing a cure for such monster cancerous type, be siding determining other pharmacological effects as anti-microbial activity. The cells were exposed to Vit b17 for 24 hr at 37°C at different concentrations, the cytotoxic effect was determined via the MTT assay. The cells and the supernatant were collected for analyzing the oxidant/antioxidant status, apoptotic markers, and anti-microbial activity. The results showed a marked anti-proliferative cytotoxic effect of Vit b17 which is concentration and time-dependent, the lipid peroxidation content was significantly decreased while the total thiol was significantly increased in the treated cell line, significant up-regulation of the transcript level of Caspase-3 (Cas-3) and Bcl-2-associated X protein (Bax) and down-regulation of B-cell lymphoma 2 (BCL-2). Furthermore, The bacterial activity was detected via Minimum Inhibitory Concentration (MIC), Minimum Bactericidal Concentration (MBC), and Disc Diffusion assays, while the antifungal evaluation was done by the Minimum Fungicidal Concentration (MFC). Antimicrobial experiments revealed that AMG exerted potent, broad-spectrum antimicrobial effects towards a diversity of dangerously infected pathogens. In conclusion, the prevailing research suggests that AMG is an effective antibacterial substance against a wide range of microbial pathogens that cause disease, in addition to its anticancer activity against human monocytic leukemia.

Human monocytic leukemia

Amygdalin

Cytotoxicity

Oxidative stress

Anti-bacterial

Antifungal

The term "cancer" indicates a cluster of diseases with uncontrolled growth properties and the spreading of malignant cells throughout the body parts (Saleem et al., 2018). Throughout the 20th and 21st centuries, cancer represents a remarkable cause of amortality (Kumar & Srinivasan, 2018). Acute myeloid leukemia (AML) is a heterogeneous cancerous type affecting the bone marrow, especially the myeloid cells, once becomes evident it spreads and leads to hematopoiesis impairment. AML incidence surges with age and is linked to a dismal prognosis. Multiple cytogenetic and genetic abnormalities manifest in myeloid precursors to produce AML, a hematologic heterogeneous disorder (O’Donnell et al., 2017). Poorly differentiated myeloid cells can accumulate at their site of production in the bone marrow (BM) and spread to adjacent blood vessels, resulting in impaired hematopoiesis and a variety of symptoms, such as bleeding, bruising, infections, fatigue, and bone pain (American Cancer Society, 2020).

Multiple strategies have been employed to fight cancer that ranged from targeted biological remedies, chemo and radiotherapy to transplantation of stem cells. The results of these strategies are variable and may be hampered by underlying health conditions, particularly in elderly ones, also, the rates of relapse are extreme (Koenig et al., 2020).

Numerous cancer treatment options have been established, including radiation, chemotherapy, and surgery (Vutakuri & Somara, 2018). On the other hand, using natural plants as cancer therapy is viewed as the upcoming cancer therapy they have low adverse effects and cost with great pharmacological efficiency (El-Masry et al., 2020). Herbal medicine is considered a main resource for the establishment both chemo-preventive and therapeutic drugs (Shanmugam et al., 2016). Approximately 80% of all FDA-approved medications over the past three decades were derived from natural sources (Bishayee & Sethi, 2016). The kernel of apricot seed could be used as a source for botanical remedies (Akhone et al., 2022). Several investigations have demonstrated its effectiveness in cancer remedies. These investigations suggest that the antiproliferative properties of apricot kernels are due to the presence of AMG. AMG triggers apoptosis, which in turn suppresses the growth and survival of the malignant cells (El-Masry et al., 2020). It contains glycosides termed cyanogenic glycoside; under the effect of beta-glucosidase enzyme converted into HCN and benzaldehyde, that cause cellular destruction and eradication for the cancerous cells in a synergistic manner (Enculescu, 2018). Moreover, Its antioxidant properties reducing the oxidative stress of the cancer cells (El-Masry et al., 2019). Multiple researches have recorded the cytotoxic and apoptotic of AMG in cancer cell lines of human origin (Shi et al., 2019). To our knowledge, however, no studies have been done on human leukemic cell lines to demonstrate the AMG efficacy and cytotoxicity.

The apricot (Prunus armeniaca L.) is a globally valuable commercial crop. Numerous flavonoids and carotenoids are believed to confer antioxidant properties to apricots (Ozturk et al., 2009). In several nations, these seeds are used extensively in their diets (Gezer et al., 2011). Due to its putative anti-cancer properties, AMG, is found in the seeds of apricots and other fruits (Salama et al., 2019). The Egyptian papyri used derivatives of the bitter almonds in the treatment of cutaneous tumors around 5000 years ago. They are represented to be one of the finest sources of AMG, Vit b17, and laetrile (Lv et al., 2017).

Public health has great global threats that are represented in developing the resistance towards drugs used as a therapy for cancer and microbial infections, which require urgent development of effective solutions. In accordance with this, we require a more effective natural material with potent antimicrobial and anticancer activity in addition to the evolutionary processes that result in the emergence of adaptive phenotypes as a reply to the selective burden of the therapeutic compounds. Many similarities have been shared between the previously emerged accelerated drug resistances; involving the mode of action and topoisomerase II; the molecules availability with both antineoplastic and antimicrobial activity (e.g., antineoplastic antibiotics); the same resistance mechanism; shared selective causes for resistance; and dual resistance, intrinsic (failure to get a primary response to drugs) and acquired (commitment of the immune system in the progress of resistance) (Lambert et al., 2011).

The purpose of this work is to develop an AMG concentration as an efficient therapy, and an attempt to address the effectiveness and toxicity of AMG as a herbal remedy for cancer in vitro against human leukemic cell lines. Also the purpose of this work was to report the antibacterial and antifungal activities of AMG against a variety of infections that affect human and animal health in addition to their antileukemic activity as a potent anticancer agent.

2.1. Amygdalin (Vit b17)

Was achieved by the Nature’s Only Choice Company (Tbilisi, GA, USA) in the form of pure capsules each of 150mg concentration.

2.2. Cytotoxicity assay

2.2.1. Cell line

THP-1 cell line (VACSERA, Cairo, Egypt) was used for analyzing the anti-proliferative cytotoxic effect of Vit B17, THP-1 cells were cultured in DMEM medium provided with (10%)FBS, (100 mg/mL)streptomycin, and (100 units/mL) penicillin and a humidified atmosphere ( 5% CO₂ & 37°C).

2.2.2. Samples

A stock solution of Vit B17 was pre-solubilized in dimethylsulphoxide (DMSO) at 37°C. Serial two-fold dilutions were made at working concentrations of 100, 50, 25, and 12.5µg/ml.

2.2.3. MTT assay

The THP-1 cells (human leukemia monocytic cells) (Sigma-Aldrich, USA) were seeded in a flat-bottom microtiter plate (96-well) at 1 × 10⁴ cells/well density and permitted to adhere in a CO2 incubator at 37°C for 24 hr, followed by changing of the medium with a fresh one. The cells were exposed to Vitb17 at different concentrations and incubated for 24 hr at 37°C, which was followed by another medium change. Subsequently, 10 µL of MTT working solution (5 mg/mL in PBS) was added to each well followed by another incubation at the same conditions for 4 hrs, after that the medium was aspirated, and 50 µL of DMSO was added for each well and incubated for 30 min for dissolving of the formed intracytoplasmic MTT formazan crystals. ELISA plate reader was used for quantification of the intensity of the previously dissolved formazan crystals (purple color) at 540 nm.

The Inhibitory concentration (IC50) for each conc. was calculated from graphic plots of the dose-response curve via the Graph pad Prism software (San Diego, CA. USA). The THP-1 cells were exposed to the resulting IC50 form Vit B17 for 24hr followed by collection and centrifugation for collecting the pellet and separating the supernatant for further assessments.

2.3. Evaluation of the lipid peroxidation and total thiol content

The content of MDA and total thiols were determined in the supernatant according to the method described by (Yagi, 1987) and (Koster et al., 1986) respectively.

2.4. Anti-microbial activity

The Fungal Research Institute's (Doki, Giza, Cairo) reference collection is the site where the fungal isolates is obtained, while the bacterial specimens were attained from the American Type Culture Collection (ATCC) at the Cairo Microbiology Research Centre. Strains used for phylogenetic reconstruction represented all relevant Mucorales taxa, including clinically significant species such as the CNRMA 03894 Mucor Rhizopus used in this study. The reference standard for doxycycline was supplied by Pharma Swede Pharmaceutical Company, while cycloheximide served as the standard antifungal medication. Antibacterial research (ATCC 35021) utilized Gram + Ve St. pneumonia (ATCC 49619), S. aureus (ATCC 25913), Listeria monocytogenes (ATCC 19115), Gram-Ve E. coli (ATCC 25922), Haemophilus influenza (ATCC 49766), and Bacillus subtilis. Aspergillosis RCMB isolates included Aspergillus Flavus RCMB 02783, Aspergillus Fumigatus RCMB 02564, and Aspergillus Niger RCMB 02588, Candidatures (Candida albicans RCMB 05035), Mucormycosis (Mucor Rhizopus CNRMA 03.894), and Penicillium Notatum (NCPF 2881). The bacterial isolates were incubated at 37°C for 24 hrs in Muller Hinton broth and Muller Hinton Agar for bacterial growth. While using Sabaroud Dextrose Agar and broth for fungal growth at 25°C for five days with the conventional antifungal medication (cycloheximide), the temperature was maintained at 25°C. Before the experiments, each tube was autoclave-sterilized.

2.4.1. Fungal isolates and bacterial inoculum preparations

Recent cultures of the previously mentioned fungal isolates were used to produce suspensions that were mounted on Sabouraud's Dextrose Agar (SDA) in accordance with the method described by (Hadacek & Greger, 2000).

To prepare bacterial inoculum for antibacterial testing, cultures of the over mentioned bacterial species were plated on Muller Hinton agar media and incubated for 24hr at 37°C. Then, after incubation, approximately six colonies were submerged in saline using conventional tube matching to obtain 108 CFU/ml, as described in fungal inoculum preparation.

2.4.2. MIC for bacterial isolates

The microdilution susceptibility test in Muller–Hinton Broth (Oxoid) and Sabouraud's Liquid Medium (Oxoid) were used to estimate the MIC for bacteria and fungi, respectively, to determine antibacterial activity.

2.4.3. MBC

On plate of Muller Hinton Agar, the MIC dilution and at least two of the tested AMG dilutions with a higher concentration are plated and viable CFU/ml is determined.

2.4.4. MIC for fungal isolates (MIC-f)

The MIC of fungi is determined using the broth microdilution method (Hadacek & Greger, 2000).

The U-shaped dishes were incubated for 72 hours at 25 degrees Celsius. Following the necessary incubation period, the presence (or absence) of growth was visually assessed. In the plate wells, the formation of cell colonies or "buttons" was considered. According to the criteria established by Morales et al., the antibacterial activity (considered active or inactive) of the tested AMG was evaluated (Morales et al., 2008): Strong/excellent activity (MIC < 1000 µg/mL).

2.4.5. Sorbitol Assay-Effect AMG on the Cell Wall of different tested fungal strains

Using sorbitol-containing and sorbitol-free (control) media, the effect of AMG on the cell walls of various fungi was investigated according to (Leite et al., 2014)

2.4.6. MFC assay

To evaluate the MFC, 100 L aliquots of MIC, MIC 2, and MIC 4 of AMG, cyclohexamide, and the -ve control for fungal growth were inoculated onto SDA-coated Petri dishes. The MFC was evaluated after 72 hours of incubation at 25°C established on the growth of the control organisms (Espinel-Ingroff et al., 2002). In relation to the papers standardized by the Chemical and Laboratory Standard Institute (CLSI); If the MIC and MFC are identical, the substance is fungicide; if the MFC is greater than the MIC, the substance is a fungistatic (Clinical, 2008)

2.4.7. Disc Diffusion Assay

For the testeted organisms were done according to (Coe De Souza et al., 2004).

2.4.8. Antifungal Assay

Method of Agar Dilution for detecting the Antifungal Activity of AMG was performed According to eff-Agboola et al.'s method.

2.5. Assessment of the transcript levels of Cas-3, BAX and BCL2 in the THP-1 cell line

a. Isolation of the total RNA

The Qiagen mini RNeasy extraction kit is used to extract the total RNA from the THP-1 cell line following the instructions of the manufacturer. The quantity and purity of the isolated RNA were measured by the Nano-drop.

b. Synthesis of the complementary DNA (cDNA)

The Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific) was used to produce the primary strand c-DNA in accordance with the manufacturer's protocol.

c. Quantitative Real-time Polymerase chain reaction (qRT-PCR)

RT-PCR analysis was done using SYBR Green PCR Master Mix. (Thermoscientific Cat number: 4309155) using the Applied Biosystems' ABI Prism Step One Plus Real-Time PCR System following the manufacturer's directions (Khalaf et al., 2019). Primer sets for determining the mRNA amounts of the target genes were designed using the Homo Sapiens sequences present in Gen Bank. (Table 1). The primer3 tool was used to construct the primer sequences (Ko et al., 2009). The qRT-PCR assay was repeated three times for each sample. The housekeeping gene beta-actin was used to normalize the examined genes expression level. The results of the expression levels were calculated according to Livak and Schmittgen (2001).

Table (1): primers used in the current study

Gene	Forward primer	Reverse primer	Product	Accession no
Cas-3	AGCGGATGGGTGCTATTGTG	ACACCCACCGAAAACCAGAG	172	NM_004346.4
BAX	AAGAAGCTGAGCGAGTGTCT	GTTCTGATCAGTTCCGGCAC	458	NM_138761.4
BCL2	CCTCGCTGCACAAATACTCC	TGGAGAGAATGTTGGCGTCT	184	NM_000633.3
ACTB	CATCCGCAAAGACCTGTACG	CCTGCTTGCTGATCCACATC	218	NM_001101

2.6. Statistical analysis

Results are expressed as (mean ± Standard error (SE)) (n = 3). Continuous variables were statistically analyzed with the independent-sample T test (A P value of < 0.001) was considered statistically significant. All data analyses were done via SPSS version 9.0.

3.1. Cytotoxic effect of Amygdalin (Vit b 17)

3.1.1. Anti-proliferative activity

A great anti-proliferative cytotoxic effect was recorded following the treatment of the cancerous cells with different concentrations of Vit b17 in which the viability was significantly inhibited with increasing the concentration as shown in (Fig. 1a), in which the lowest viability % (46%) was recorded at the highest concentration (100 µg/ml) of Vit b17. The IC50 value was determined for the tested substance at about (64 µg/ml) (Fig. 1.b).

3.1.2. Morphological effects

The cells lose their brightness and become opaque shrinked (Fig. 1. c II) following exposure to the highest concentration of Vit b17, while the normal cells are bright, rounded, and floated (Fig. 1. c I).

3.2. Lipid peroxidation and total thiol content

The MDA content was significantly lowered in the exposed cells to Vit b 17 in comparison to the control THP-1 cell line as illustrated in Fig. (2 a), in contrast, the total thiol content was significantly increased in the treated one figure (2 b).

3.3. Anti-microbial investigations

3.3.1. MIC and MBC

MIC and MBC of the examined AMG against the different bacterial isolates are illustrated d in Figs. 3 & 4 respectively. The graph demonstrates that the MIC value of the examined AMG varied considerably between species. the MIC and MBC values recorded for S. aureus, St. Pyogens are comparable, indicating their bactericidal activity; however, they were substantially different for H. influenza and E. coli, as Gram-negative organisms. Maximum MIC values were marginally above 50 µg/mL for H. influenza and E. coli, while the MIC values for Staphylococcus aureus, St. Pyogens, and L. monocytogenes were approximately 1.4, 1.5, and 2.1 µg/mL, respectively. The fact that bactericidal activity of AMG against B. Subtlis was indicated by a concentration of 4 µg/mL, as shown in Fig. 3&4.

Figure 5 depicts plates containing multiple bacterial isolates, including Gram-positive St. pneumonia, S. aureus, Listeria monocytogenes, and Gram-negative E. coli, Haemophilus influenza, and Bacillus subtilis (ATCC 35021). Additionally, the figure depicts the inhibition zone of each strain at various AMG concentrations. In millimeters, the inhibition zone is determined by the Agar diffusion technique. In general, the diameters of various species were distinct. As a result, Figs. 5 & 6a bar graph depicting the computed mean of the inhibition zone (mm) at various concentrations of AMG (1000, 500, 250, 125 µg/mL) versus the various categories of bacteria mentioned previously along the X-axis. The effect of AMG on the examined strains was inconsistent overall. S. aureus and L. monocytogenes had the highest response rates among Gram-positive bacteria, while B. subtilis and E. coli had the lowest. Second, the Gram-negative E. coil had a greater reaction than H. influenza. In addition, the image demonstrates that the inhibition zone was proportional to the AMG concentration in every tested species. S. aureus possessed the largest inhibitory zone, measuring approximately 42 mm, whereas H. influenza had the smallest, measuring approximately 30 mm. Notably, the tested AMG was compared to doxycycline for both Gram-negative and Gram-positive organisms (24 mm), and the results revealed that the AMG was significantly more effective against Gram-positive organisms than the standard drug. From this perspective, the AMG could serve as an effective alternative to conventional antibiotics in the fight against bacterial resistance.

In Antifungal activity, studies were depicted in Fig. 7&8. For determination of the exact mechanism of action, MIC & MFC findings using various media with added sorbitol concentrations revealed lower fungicidal concentrations against Mucor, A. flavus, A. niger, and Penicillium, as shown in 9&10. As shown in the MICs for all tested fungal isolates were identical to the MFCs, confirming the fungicidal activity of AMG. AMG was effective against all fungi, especially Mucor, A. flavus, A. niger, and Penicillium strains (13.3, 31,31.6, and 32 µg/mL, respectively). At higher concentrations, they demonstrated antifungal activity against additional species, including A. fumigatus and Candida albicans (42.6 and 37.3 µg/mL, respectively). Figure 5.

3.3.2. Disc diffusion antifungal assay

The disc diffusion technique is regarded as one of the most accurate methods for measuring antifungal or antibacterial activity. On SDA plates, inhibition zones against a variety of fungal isolates were evaluated, and numerous concentrations are illustrated in Fig. 11. AMG demonstrated a better zone of inhibition against Mucor, A. flavus, A. niger, and A. fumigatus than the conventional antifungal for rapidly growing fungi (cycloheximide) at concentrations of 1000, 500, and 250 µg/mL. Also as illustrated in Fig. 12 AMG demonstrated promising antifungal activity against the other fungal isolates.

3.3.3. Anti-fungal activity

Regarding antifungal activity (percentage of inhibition), Based on the measurement of antifungal activity after the addition of AMG to media, the percentage of fungal inhibition was computed and displayed in Fig. 13; AMG inhibited Mucor at an 89% rate while penicillium was inhibited at an 80% rate.

3.4. The transcript levels of Cas-3, BAX, and BCL2:

Figure (14) was illustrated that the transcript level of Cas-3, and BAX were significantly up-regulated in the cells treated with Vit b17. Contrary, the BCL2 transcript level was downregulated significantly in comparison to the non-treated cells (control).

Disorders of malignant and infectious nature are considered the most prevalent and problematic ones with marked negative impacts on the general population's health. According to the World Health Organization (WHO), cancer is one of the primary causes of death worldwide in 2020, accounting for nearly 10 million deaths. Antimicrobial resistance (AMR) is one of the top ten global hazards, not only to human health but also to the health of the environment, and is a typical example of a One Health issue. The most dangerous bugs display multiple-drug resistance (MDR), extended-drug resistance, and even pan-drug resistance phenotypes (Peterson, 2009) . The antimicrobials crisis would jeopardize modern medicine achievement, including invasive diagnostic procedures (e.g., biopsies), cancer radio- and chemotherapies, and surgery, in addition to the direct effects of increasing the rates of morbidity and mortality due to disorders of infectious nature and enormous economic hurts. Irrespective of the extent of the surgery, the possibility of emerging healthcare-related infections initiated by resistant strains is extremely great, making it difficult to determine the most effective therapeutic approach. Additionally, chemo- and radiotherapy may provoke a transient immunodeficiency, thereby increasing the oncologic patient's susceptibility to infections, involving those caused by MDR bacteria (Ariza-Heredia & Chemaly, 2018) . Enteric bacteria are frequently the cause of Nosocomial outbreaks of G-negative sepsis on cancer districts, resulting in 60% to 84% mortality (Papanicolas et al., 2018) .

AMG or its modified form Vit b17 or laetrile represented as cancer therapy (Halenár et al., 2013) . They inhibit cancerous cells without any systemic adverse effects (Zhou et al., 2012) . It could regulate immune function and induce apoptosis (Shi et al., 2019) . The reported capability of Vit b17 cytotoxicity was documented due to the liberation of hydrocyanic acid and benzaldehyde (Halenár et al., 2013) , below the analytical effect of enzyme ß-D-glucosidase that is present in cancerous cells only (Isozaki et al., 2001) .

HCN causes cellular energy deprivation through suppression of oxidative metabolism and the associated oxidative phosphorylation process because of inhibition of the cytochrome C oxidase in the respiratory electron transport chain of the mitochondria (Cox & Nelson, 2000) . Furthermore, hydrocyanic acid prevents the nutrient source of the tumor cells resulting in the inhibition and killing of the cancerous cells (Song & Xu, 2014) . The cytotoxic effect of amygdalin is concentration and time-dependent as reported in different research (Chang et al., 2006; Halenár et al., 2013) . Lately, the antitumor mechanism of AMG anti-cancer mechanism was investigated in variable types of cancer. Kwon et al. noted that AMG could stimulate apoptosis in human promyelocytic leukemia‑60 cells (Kwon et al., 2003) . These findings come accordance with the results of the current study in which Vit b17 exerts a marked cytotoxic effect against the THP-1 cells and is time and concentration dependent. AMG also demonstrates concentration-dependent effect on the suppression of human carcinoma cell proliferation withthe acceleration of the cellular growth of the skeletal muscle through the robust expression of the muscle growth regulator mRNA follistatin (Yang et al., 2014) .

The exact mechanism of AMG's anti-cancer activity was previously described as an increase in the expression rate of the p19 protein, that inhibits cell displacement from G1- to S-phase and, consequently, proliferation of the cell (Liczbiński & Bukowska, 2018) . AMG inhibits Bcl-2, enhances Bax expression, stimulates caspase-3, and cleaves poly ADP-ribose polymerase (PARP). In Hs578T cells, moreover, it enhances p38 mitogen-activated protein kinases (p38 MAPK), a pro-apoptotic signaling molecule(Lee & Moon, 2016) . Moreover, AMG modifies the progression of the cell cycle in the tumor cells through cyclin-dependent kinase 2 (CDK2) and cyclin A downregulation. AMG-induced CDK2 inhibition, which is a key regulator of G1-S transition and modulator of G2 progression, stimulates the cycle arrest in the G0/G1 phase (Makarević et al., 2016) .

Several other experimental works have studied the anti-cancer properties of Vit b17 against various types of cancer, including leukemia. For instance, a study by Lee & Moon (2016) found that Vit b17 inhibited the proliferation of the leukemic cells with apoptosis induction via regulating the expression rate of BAX and BCL2. Also Alwan et al. (2023) reported the same effect of Vit b17 via regulating the expression of caspase-3 and PARP.

Studies have shown that Vit b17 t can induce apoptosis (programmed cell death) in tumor cells, potentially via the activation of caspase enzymes (McIlwain et al., 2013; Carneiro & El-Deiry, 2020) . Caspases are a group of cysteine proteases that have a critical role in apoptosis by cleaving specific substrates and initiating a cascade of actions that eventually lead to cell death. Caspase 3 is one of the key effectors of apoptosis and is often used as a marker of apoptotic activity (Opdenbosch & Lamkanfi, 2019) . The BAX and BCL2 genes are also incorporated in the regulation of apoptosis. Vit b 17 induced apoptosis in THP-1 cells by up-regulating the expression of BAX and down-regulating the expression of BCL2 these findings are similar to that reported via (Liczbiński & Bukowska, 2018) . This suggests that vitamin B17 has pro-apoptotic effects on THP-1 cells (Wu et al., 2018) .

The plasma levels of MDA are used as indicators for detecting and prognoses the state of leukemia disease (Ahmad et al., 2008) , as the generation of reactive oxygen species from the cancerous cells causes resistance to the chemotherapy, that hinder its effect (Mendivil-Perez et al., 2012) . Besides the anti-cancer, antimicrobial activities, and immune-regulating properties of amygdalin it’s reported to have antioxidant activity (Alwan & Afshari, 2022) . It might be a source of the natural antioxidant in vivo and in vitro (Sokkar et al., 2013) (Felemban et al., 2020) .

AMG can disrupt oxidative equilibrium. As a consequence of its antioxidant property (Duracka et al., 2016) , it decreases ROS production, protein carbonyl levels, and MDA levels in testicular tissue. Other research have demonstrated that AMG inhibits the nuclear factor k (NF-k) and NLRP3 signaling pathways, thereby down-regulating the expression of pro-inflammatory cytokines expression such as pro-interleukin (IL)-1 and exerting an anti-inflammatory effect. In addition, AMG inhibits the proliferation and fibrosis of hepatic stellate cells (HSC-T6) by inhibiting the expression of TGF-, a key mediator of liver fibrosis. Additionally, the connective tissue growth factor (CTGF), which is regulated by TGF-, is indirectly affected by AMG; consequently, the anti-fibrotic effect of AMG may be mediated by inhibiting the TGF-/CTGF signaling pathway (Luo et al., 2016) . From the previous and the current findings, we can conclude that AMG has a potent influence on a variety of the cellular process; initially may modulate the oxidative status and may continue to signal pathways intracellular and eventually resulting in suppression of cellular growth and proliferation and apoptosis induction that reflect on the cellular viability, growth, and death and controlling of the cell cycle. Thus, the exact mechanism of action of AMG in this study against leukemia cancer cells could be attributed to any of the previously mentioned anticancer mechanisms of action.

On the other hand; the effect of AMG on fungi and bacteria together was investigated in some works, due to the comparative simplicity of their systems (Aguilar-Méndez et al., 2011) , so both varieties were examined in this study.

From the findings of the current study, we noted that AMG has a potent effect on Mucor among other fungi species. Mucor species is a contagious one that causes immunosuppression and predisposes to Mucormycosis (Petrikkos et al., 2012) . Since a lower effective MIC is suggestive of an effect on the fungal cell wall, the obtained data of MIC was repeated on numerous sorbitol media to elucidate the precise mode of action of AMG as an antifungal agent. It was found to be more effective against Mucor A. flavus, A. niger, and Penicillium at concentrations of 6, 16 µg/mL, as contrasting to the previously testified higher concentrations in the existing normal MIC (13, 31 & 31.6 µg/mL) for each organism. In sorbitol-containing media, some of the fungal cell wall inhibitors could nullify their antifungal activity (Frost et al., 1995) .

The fungal cell wall inhibitors may not have any effect on cell proliferation in the presence of sorbitol, while cellular growth suppressed in its absence. This is recorded by the lower MIC reported in media containing sorbitol in comparison to media without sorbitol (standard medium) (Svetaz et al., 2007) . Agents that cause osmotic destabilization and cell wall disruption leading to cell wall reorganization, give the chance for the fungal cells to survive (Wayne, 2002) . AMG appeared to act on the fungal cell wall, through alteration of its structure and production, and may induce cellular death, furthermore inhibiting the germination and proliferation of spores and cellular respiration.

In this investigation, AMG was efficacious as both an antimicrobial and antifungal agent against Gram + Ve and – Ve bacteria. Regarding the mechanism of action of AMG as a natural antimicrobial agent, these results demonstrate the antibacterial activity of AMG, as stated previously (Abtahi et al., 2008) . AMG's antibacterial activity may be induced by -glucosidase hydrolysis into d-glucose, prussic acid (HCN), and benzaldehyde (Abtahi et al., 2008) . Also, a previous study suggested that the examined microorganisms may utilize AMG as a source of sugar, (Walker & Krieble, 1990) . HCN, one of the amygdalin breakdown products, appears to have a significant role in the inhibition of the tested bacterial growth; the toxicity of hydrogen cyanide is caused by cyanide ion, which is the consequence of hydrogen cyanide's partial ionization (Organisation for the Prohibition of Chemical Weapons., 2009) . Cyanide ion halts cellular respiration (electron transport chain) by inhibiting the bacterial membrane enzyme cytochrome C oxidase (Organisation for the Prohibition of Chemical Weapons., 2009) . Numerous scientists have demonstrated that microorganisms cannot metabolize or adapt to HCN. In contrast to some fungi that have an HCN-inducible enzyme, formamide hydrolyses (FHL), which converts cyanide to formamide, is a cyanide detoxification enzyme (Rust et al., 1980) .

Benzaldehyde, another byproduct of amygdalin decomposition, is expected to inhibit the growth of the tested microorganisms by reacting with phenolic compounds in the extract to form the toxic phenolic benzaldehyde (Friedman et al., 2003). It appears that amygdalin possesses antibacterial properties. The antibacterial activity may have resulted from the decomposition of amygdalin by bacterial enzymes into hydrogen cyanide and benzaldehyde, which killed the bacteria. Amygdalin, alkaloids, flavonoids, tannins, and phenolic compounds may contribute to the antibacterial activity of AMG towards many bacterial strains (Abtahi et al., 2008).

Overall, the anti-proliferative cytotoxic effect of Vit B17 against THP-1 cells appears to be mediated by the modulation of the expression rates of the genes involved in the regulation of cellular proliferation, metastasis, and apoptosis. Moreover, it’s anti-oxidant and anti-microbial effects.

AMG

Amygdalin

AMR

Antimicrobial resistance

Bax

Bcl-2-associated X protein

BCL-2

B-cell lymphoma 2

Cas-3

Caspase-3

cDNA

complementary DNA

CDK2

Cyclin-dependent kinase 2

FHL

Formamide hydrolyses

HCN

Hydrogen cyanide

MBC

Minimum bactericidal concentration

MDA

Malondialdehyde

MDR

Multiple drug resistance

MFC

Minimum Fungicidal Concentration

MIC

Minimum inhibitory concentration

NF-k

Nuclear factor k

Interleukin

HSC-T6

Hepatic stellate cells

CTGF

Connective tissue growth factor

PARP

Poly ADP-ribose polymerase

p 38 MAPK

p38 mitogen-activated protein kinases

q RT-PCR

Quantitative Real-time Polymerase chain reaction

SDA

Sabouraud's Dextrose Agar

SDB

Sabouraud's Dextrose broth medium

THP-1

Human monocytic leukemia cell line

WHO

World Health Organization

Vit b17

Vitamin b 17

Ethical approval

The standards set forth guidelines for the care and use of experimental animals by the Institutional Animal Care and Use Committee of Vet. CU. IACUC, Cairo University was followed in the present study (Vet CU 03162023695).

Competing of interest

The authors declare that they have no competing of interests.

Authors contributions:

F.I.A., W.H.H., and H.E.,original draft preparation. D. A., and M. I. reviewing and editing all figures and manuscript submission. All figure preparation. All authors contributed to the article and approved the submitted version.

Funding

None

Availability of data and materials

They are available only to be submitted and published in Cell Biology and Toxicology journal

Abtahi, H., Ghazavi, A., Karimi, M., Mollaghasemi, S., & Mosayebi, G. (2008). Antimicrobial activities of water and methanol extracts of bitter apricot seeds. Journal of Medical Sciences, 8(4), 433–436. https://doi.org/10.3923/jms.2008.433.436
Aguilar-Méndez, M. A., Martín-Martínez, E. S., Ortega-Arroyo, L., Cobián-Portillo, G., & Sánchez-Espíndola, E. (2011). Synthesis and characterization of silver nanoparticles: Effect on phytopathogen Colletotrichum gloesporioides. Journal of Nanoparticle Research, 13(6), 2525–2532. https://doi.org/10.1007/s11051-010-0145-6
Ahmad, R., Tripathi, A. K., Tripathi, P., Singh, R., Singh, S., & Singh, R. K. (2008). Oxidative stress and antioxidant status in patients with chronic myeloid leukemia. Indian Journal of Clinical Biochemistry, 23(4), 328–333. https://doi.org/10.1007/s12291-008-0072-9
Akhone, M. A., Bains, A., Tosif, M. M., Chawla, P., Fogarasi, M., & Fogarasi, S. (2022). Apricot Kernel: Bioactivity, Characterization, Applications, and Health Attributes. Foods, 11(15), 1–15. https://doi.org/10.3390/foods11152184
Alwan, A. M., & Afshari, J. T. (2022). In Vivo Growth Inhibition of Human Caucasian Prostate Adenocarcinoma in Nude Mice Induced by Amygdalin with Metabolic Enzyme Combinations. BioMed Research International, 2022. https://doi.org/10.1155/2022/4767621
Alwan, A. M., Rokaya, D., Kathayat, G., & Afshari, J. T. (2023). Onco-immunity and therapeutic application of amygdalin: A review. Journal of Oral Biology and Craniofacial Research, 13(2), 155–163. https://doi.org/10.1016/j.jobcr.2022.12.010
American CancerSociety. (2020). Key Statistics for Acute Myeloid Leukemia (AML). https://www.cancer.org/cancer/acute-myeloid-leukemia/about/key-statistics.html. Accessed 12 Jan 2020.
Ariza-Heredia, E. J., & Chemaly, R. F. (2018). Update on infection control practices in cancer hospitals. CA: A Cancer Journal for Clinicians, 68(5), 340–355. https://doi.org/10.3322/caac.21462
Bishayee, A., & Sethi, G. (2016). Bioactive natural products in cancer prevention and therapy: Progress and promise. Seminars in Cancer Biology, 40–41, 1–3. https://doi.org/10.1016/J.SEMCANCER.2016.08.006
Carneiro, B. A., & E.-D. W. S. (2020). Targeting apoptosis in cancer therapy. Nature Reviews. Clinical Oncology., 17((7)), 395–417.
Chang, H. K., Shin, M. S., Yang, H. Y., Lee, J. W., Kim, Y. S., Lee, M. H., Kim, J., Kim, K. H., & Kim, C. J. (2006). Amygdalin induces apoptosis through regulation of Bax and Bcl-2 expressions in human DU145 and LNCaP prostate cancer cells. Biological and Pharmaceutical Bulletin, 29(8), 1597–1602. https://doi.org/10.1248/bpb.29.1597
Clinical, I. L. (2008). Reference method for broth dilution antifungal susceptibility testing of yeasts. Clinical and Laboratory Standards Institute Wayne, PA,.
Coelho De Souza, G., Haas, A. P. S., Von Poser, G. L., Schapoval, E. E. S., & Elisabetsky, E. (2004). Ethnopharmacological studies of antimicrobial remedies in the south of Brazil. Journal of Ethnopharmacology, 90(1), 135–143. https://doi.org/10.1016/J.JEP.2003.09.039
Cox, M. M., & Nelson, D. L. (2000). Fifth Edition CHAPTER 19 Oxidative Phosphorylation (Issue January). https://doi.org/10.1007/978-3-662-08289-8
Duracka, M., Tvrda, E., Halenar, M., Zbynovska, K., Kolesar, E., Lukac, N., & Kolesarova, A. (2016). the Impact of Amygdalin on the Oxidative Profile of Rabbit Testicular Tissue. 23rd International PhD Students Conference (MendelNet), January 2017, 770–775.
El-Masry, T. A., Al-Shaalan, N. H., Tousson, E., Buabeid, M., & Alyousef, A. M. (2019). The therapeutic and antineoplastic effects of vitamin B17 against the growth of solid-form Ehrlich tumours and the associated changes in oxidative stress, DNA damage, apoptosis and proliferation in mice. Pakistan Journal of Pharmaceutical Sciences, 32(6), 2801–2810.
El-Masry, T., Al-Shaalan, N., Tousson, E., Buabeid, M., & Al-Ghadeer, A. (2020). Potential therapy of vitamin B17 against ehrlich solid tumor induced changes in interferon gamma, nuclear factor kappa b, DNA fragmentation, p53, Bcl2, survivin, VEGF and TNF-α expressions in mice. Pakistan Journal of Pharmaceutical Sciences, 33(1), 393–401. https://doi.org/10.36721/PJPS.2020.33.1.SUP.393-401.1
Enculescu, M. (2018). Vitamin B17 / Laetrile / Amygdalin ( a Review ) Vitamin B 17 / Laetrile / Amygdalin ( a Review ). May, 1–2. https://doi.org/10.15835/buasvmcn-asb
Espinel-Ingroff, A., Chaturvedi, V., Fothergill, A., & Rinaldi, M. G. (2002). Optimal testing conditions for determining MICs and minimum fungicidal concentrations of new and established antifungal agents for uncommon molds: NCCLS collaborative study. Journal of Clinical Microbiology, 40(10), 3776–3781. https://doi.org/10.1128/JCM.40.10.3776-3781.2002
Felemban, S. G., Aldubayan, M. A., Alhowail, A. H., & Almami, I. S. (2020). Vitamin B17 Ameliorates Methotrexate-Induced Reproductive Toxicity, Oxidative Stress, and Testicular Injury in Male Rats. Oxidative Medicine and Cellular Longevity, 2020. https://doi.org/10.1155/2020/4372719
Friedman, M., Henika, P. R., & Mandrell, R. E. (2003). Antibacterial Activities of Phenolic Benzaldehydes and Benzoic Acids against Campylobacter jejuni, Escherichia coli, Listeria monocytogenes, and Salmonella enterica. Journal of Food Protection, 66(10), 1811–1821. https://doi.org/10.4315/0362-028X-66.10.1811
Frost, D. J., Brandt, K. D., Cugier, D., & Goldman, R. (1995). A Whole-Cell Candida albicans Assay for the Detection of Inhibitors towards Fungal Cell Wall Synthesis and Assembly. The Journal of Antibiotics, 48(4), 306–310. https://doi.org/10.7164/antibiotics.48.306
Gezer, İ., Haciseferoğullari, H., Musa Özcan, M., Arslan, D., Asma, B. M., & Ünver, A. (2011). Physico-chemical Properties of Apricot (Prunus armeniaca L) Kernels. South Western Journal, 2(1), 1–13. http://anucraiova.3x.ro/swjhbe/index.html2011
Hadacek, F. and Greger, H. (2000). Testing of Antifungal Natural Products: Methodologies, Comparability of Results and Assay Choice. Phytochemical Analysis, 11, 137-147.
Halenár, M., Medveďová, M., Maruniaková, N., & Kolesárová, A. (2013). Amygdalin and its Effects on Animal Cells. Journal of Microbiology, Biotechnology and Food Sciences, 2(Special issue 1), 1414–1423.
Isozaki, T., Matano, Y., Yamamoto, K., Kosaka, N., & Tani, T. (2001). Quantitative determination of amygdalin epimers by cyclodextrin-modified micellar electrokinetic chromatography. Journal of Chromatography A, 923(1–2), 249–254. https://doi.org/10.1016/S0021-9673(01)00969-4
Khalaf, A. A., Hassanen, E. I., Zaki, A. R., Tohamy, A. F., & Ibrahim, M. A. (2019). Histopathological, immunohistochemical, and molecular studies for determination of wound age and vitality in rats. International Wound Journal, 16(6), 1416–1425. https://doi.org/10.1111/iwj.13206
Ko, J. H., Ibrahim, M. A., Park, W. S., Ko, E. A., Kim, N., Warda, M., Lim, I., Bang, H., & Han, J. (2009). Cloning of large-conductance Ca2+-activated K+ channel α-subunits in mouse cardiomyocytes. Biochemical and Biophysical Research Communications, 389(1), 74–79. https://doi.org/10.1016/J.BBRC.2009.08.087
Koenig KL, Sahasrabudhe KD, Sigmund AM, B. B. (2020). AML with Myelodysplasia-Related Changes: Development, Challenges, and Treatment Advances. Genes (Basel). 11.((8)), :845.
Koster, J. F.; Biemond, P. and Swaak, A. J. (1986). Intra-cellular and extracellular sulphydryl levels in rheumatoid arthritis. Ann. Rheum. Dis., 45((1)), 44–46.
Kumar S, Srinivasan A, N. F. (2018). Role of Infrared Spectroscopy and Imaging in Cancer Diagnosis. Curr Med Chem, 25((9)), 1055-1072.
Kwon HY, Hong SP, Hahn DH, K. J. (2003). Apoptosis induction of Persicae Semen extract in human promyelocytic leukemia (HL‑60) cells. Arch Pharm Res, 26(2), 157–161.
Lambert, G., Estévez-Salmeron, L., Oh, S., Liao, D., Emerson, B. M., Tlsty, T. D., & Austin, R. H. (2011). An analogy between the evolution of drug resistance in bacterial communities and malignant tissues. Nature Reviews Cancer, 11(5), 375–382. https://doi.org/10.1038/nrc3039
Lee, H. M., & Moon, A. (2016). Amygdalin regulates apoptosis and adhesion in Hs578T triple-negative breast cancer cells. Biomolecules and Therapeutics, 24(1), 62–66. https://doi.org/10.4062/biomolther.2015.172
Leite, M. C. A., De Brito Bezerra, A. P., De Sousa, J. P., Guerra, F. Q. S., & De Oliveira Lima, E. (2014). Evaluation of antifungal activity and mechanism of action of citral against Candida albicans. Evidence-Based Complementary and Alternative Medicine, 2014. https://doi.org/10.1155/2014/378280
Liczbiński P, B. B. (2018). Molecular mechanism of amygdalin action in vitro: review of the latest research. Immunopharmacol Immunotoxicol, 40((3)), 212–218.
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods, 25(4), 402–408. https://doi.org/10.1006/METH.2001.1262
Luo, H., Li, L., Tang, J., Zhang, F., Zhao, F., Sun, D., Zheng, F., & Wang, X. (2016). Amygdalin inhibits HSC-T6 cell proliferation and fibrosis through the regulation of TGF-β/CTGF. Molecular and Cellular Toxicology, 12(3), 265–271. https://doi.org/10.1007/s13273-016-0031-0
Lv, J., Xiong, W., Lei, T., Wang, H., Sun, M., Hao, E., Wang, Z., Huang, X., Deng, S., Deng, J., & Wang, Y. (2017). Amygdalin ameliorates the progression of atherosclerosis in LDL receptor-deficient mice. Molecular Medicine Reports, 16(6), 8171–8179. https://doi.org/10.3892/mmr.2017.7609
Makarević, J., Tsaur, I., Juengel, E., Borgmann, H., Nelson, K., Thomas, C., Bartsch, G., Haferkamp, A., & Blaheta, R. A. (2016). Amygdalin delays cell cycle progression and blocks growth of prostate cancer cells in vitro. Life Sciences, 147, 137–142. https://doi.org/10.1016/J.LFS.2016.01.039
McIlwain, D. R., Berger, T., & Mak, T. W. (2013). Caspase functions in cell death and disease. Cold Spring Harbor Perspectives in Biology, 5(4), 1–28. https://doi.org/10.1101/cshperspect.a008656
Mendivil-Perez, M., Velez-Pardo, C., & Jimenez-Del-Rio, M. (2012). TPEN induces apoptosis independently of zinc chelator activity in a model of acute lymphoblastic leukemia and Ex vivo acute leukemia cells through oxidative stress and mitochondria caspase-3- and AIF-dependent pathways. Oxidative Medicine and Cellular Longevity, 2012. https://doi.org/10.1155/2012/313275
Morales, G., Paredes, A., Sierra, P., & Loyola, L. A. (2008). Antimicrobial activity of three baccharis species used in the traditional medicine of Northern Chile. Molecules, 13(4), 790–794. https://doi.org/10.3390/molecules13040790
O’Donnell MR, Tallman MS, Abboud CN, Altman JK, Appelbaum FR, Arber DA, Bhatt V, Bixby D, Blum W, Coutre SE, De Lima M, Fathi AT, Fiorella M, Foran JM, Gore SD, Hall AC, Kropf P, Lancet J, Maness LJ, Marcucci G, Martin MG, Moore JO, Olin R, Peker D, Polly, O. N. (2017). Acute Myeloid Leukemia, Version 3.2017, NCCN Clinical Practice Guidelines in Oncology. J Natl Compr Canc Netw., 15((7)), 926–957.
Opdenbosch, N. Van, & Lamkanfi, M. (2019). Europe PMC Funders Group Caspases in cell death , inflammation and disease. Immunity, 50(6), 1352–1364. https://doi.org/10.1016/j.immuni.2019.05.020.Caspases
Organisation for the Prohibition of Chemical Weapons. (2009). “Hydrogen Cyanide”. Organisation for the Prohibition of Chemical Weapons”.http://www.opcw.org/ about-chemical-weapons/types-of-chemical-agent/blood-agents/hydrogen-cyanide/.
Ozturk, F., Gul, M., Ates, B., Ozturk, I. C., Cetin, A., Vardi, N., Otlu, A., & Yilmaz, I. (2009). Protective effect of apricot (Prunus armeniaca L.) on hepatic steatosis and damage induced by carbon tetrachloride in Wistar rats. British Journal of Nutrition, 102(12), 1767–1775. https://doi.org/10.1017/S0007114509991322
Papanicolas LE, Gordon DL, Wesselingh SL, R. G. (2018). Not Just Antibiotics: Is Cancer Chemotherapy Driving Antimicrobial Resistance? Trends Microbiol. 26((5)), 393–400.
Peterson, L. R. (2009). Bad bugs, no drugs: no ESCAPE revisited. Clin. Infect. Dis., 49, 992–993.
Petrikkos, G., Skiada, A., Lortholary, O., Roilides, E., Walsh, T. J., & Kontoyiannis, D. P. (2012). Epidemiology and clinical manifestations of mucormycosis. Clinical Infectious Diseases, 54(SUPPL. 1), 23–34. https://doi.org/10.1093/cid/cir866
Rust, L. A. Fry, W. E. and Beer, S. V. (1980). Hydrogen Cyanide Sensitivity in Bacterial Pathogens of Cyanogenic and Non-Cyanogenic Plants. Phytopathology, 70(10), 1005. https://doi.org/10.1094/phyto-70-1005
Salama, R. H., Ramadan, A. E. R. G., Alsanory, T. A., Herdan, M. O., Fathallah, O. M., & Alsanory, A. A. (2019). Experimental and Therapeutic Trials of Amygdalin. International Journal of Biochemistry and Pharmacology, 1(1), 21–26. https://doi.org/10.18689/ijbp-1000105
Saleem, M.; Asif, J.; Asif, M.; Saleem, U. (2018). Amygdalin from apricot kernels induces apoptosis and causes cell cycle arrest in cancer cells: An updated review. Chem. Anti Cancer Agents Med, 18, 1650–1655.
Shanmugam, M. K., Lee, J. H., Chai, E. Z. P., Kanchi, M. M., Kar, S., Arfuso, F., Dharmarajan, A., Kumar, A. P., Ramar, P. S., Looi, C. Y., Mustafa, M. R., Tergaonkar, V., Bishayee, A., Ahn, K. S., & Sethi, G. (2016). Cancer prevention and therapy through the modulation of transcription factors by bioactive natural compounds. Seminars in Cancer Biology, 40–41, 35–47. https://doi.org/10.1016/J.SEMCANCER.2016.03.005
Shi, J., Chen, Q., Xu, M., Xia, Q., Zheng, T., Teng, J., Li, M., & Fan, L. (2019). Recent updates and future perspectives about amygdalin as a potential anticancer agent: A review. Cancer Medicine, 8(6), 3004–3011. https://doi.org/10.1002/cam4.2197
Sokkar, N., El-Gindi, O., Sayed, S., Mohamed, S., Ali, Z., & Alfishawy, I. (2013). Antioxidant, anticancer and hepatoprotective activities of Cotoneaster horizontalis Decne extract as well as α-tocopherol and amygdalin production from in vitro culture. Acta Physiologiae Plantarum, 35(8), 2421–2428. https://doi.org/10.1007/s11738-013-1276-z
Song, Z., & Xu, X. (2014). Advanced research on anti-tumor effects of amygdalin. Journal of Cancer Research and Therapeutics, 10(5), C3–C7. https://doi.org/10.4103/0973-1482.139743
Svetaz, L., Agüero, M. B., Alvarez, S., Luna, L., Feresin, G., Derita, M., Tapia, A., & Zacchino, S. (2007). Antifungal activity of Zuccagnia punctata Cav.: Evidence for the mechanism of action. Planta Medica, 73(10), 1074–1080. https://doi.org/10.1055/s-2007-981561
Vutakuri, N., & Somara, S. (2018). Natural and herbal medicine for breast cancer using Elettaria cardamomum (L.) Maton. International Journal of Herbal Medicine, 6(2), 91–96. https://www.florajournal.com/archives/2018/vol6issue2/PartB/7-1-27-280.pdf
Walker, J. W. and Krieble, V. K. (1990). The hydrolysis of amygdalin by acids. Part I. Journal of the Chemical Society., 95((11)), 1369–1377.
Wayne P. (2002). Reference method for broth dilution antifungal susceptibility testing of yeasts, approved standard. CLSI document M27-A2.
Wu, C. L., Chen, C. L., Huang, H. S., & Yu, D. S. (2018). A new niclosamide derivatives-B17 can inhibit urological cancers growth through apoptosis-related pathway. Cancer Medicine, 7(8), 3945–3954. https://doi.org/10.1002/cam4.1635
Yagi, K. (1987). Lipid peroxides and human disease. Chem. Phys. Lipids, 45:, 337-351.
Yang, C., Li, X., & Rong, J. (2014). Amygdalin isolated from Semen Persicae (Tao Ren) extracts induces the expression of follistatin in HepG2 and C2C12 cell lines. Chinese Medicine (United Kingdom), 9(1), 1–8. https://doi.org/10.1186/1749-8546-9-23
Zhou, C., Qian, L., Ma, H., Yu, X., Zhang, Y., Qu, W., Zhang, X., & Xia, W. (2012). Enhancement of amygdalin activated with β-d-glucosidase on HepG2 cells proliferation and apoptosis. Carbohydrate Polymers, 90(1), 516–523. https://doi.org/10.1016/J.CARBPOL.2012.05.073

No competing interests reported.

Supplementarymaterial.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Establishment of amygdalin antitumor efficacy against human acute monocytic leukemia cell line (THP‐1) with antimicrobial investigations, in vitro Study

Status:

Version 1

Abstract

Figures

Introduction

Material and methods

2.1. Amygdalin (Vit b17)

2.2. Cytotoxicity assay

2.2.1. Cell line

2.2.2. Samples

2.2.3. MTT assay

2.3. Evaluation of the lipid peroxidation and total thiol content

2.4. Anti-microbial activity

2.4.1. Fungal isolates and bacterial inoculum preparations

2.4.2. MIC for bacterial isolates

2.4.3. MBC

2.4.4. MIC for fungal isolates (MIC-f)

2.4.5. Sorbitol Assay-Effect AMG on the Cell Wall of different tested fungal strains

2.4.6. MFC assay

2.4.7. Disc Diffusion Assay

2.4.8. Antifungal Assay

a. Isolation of the total RNA

b. Synthesis of the complementary DNA (cDNA)

2.6. Statistical analysis

Results

3.1. Cytotoxic effect of Amygdalin (Vit b 17)

3.1.1. Anti-proliferative activity

3.1.2. Morphological effects

3.2. Lipid peroxidation and total thiol content

3.3. Anti-microbial investigations

3.3.1. MIC and MBC

3.3.2. Disc diffusion antifungal assay

3.3.3. Anti-fungal activity

Discussion

Conclusion

List Of Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1