TRAP1 controls the crosstalk between SDHA/HIF-1α, HIF/ERK1/2/Twist, and HIF/FoxC/Twist pathways via HIF-1α during EMT in colorectal cancer

doi:10.21203/rs.3.rs-3148879/v1

Download PDF

Research Article

TRAP1 controls the crosstalk between SDHA/HIF-1α, HIF/ERK1/2/Twist, and HIF/FoxC/Twist pathways via HIF-1α during EMT in colorectal cancer

https://doi.org/10.21203/rs.3.rs-3148879/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Tumor necrosis factor receptor-associated protein 1 (TRAP1) is highly-expressed during epithelial-mesenchymal transition (EMT) in colorectal cancer (CRC). Here, we investigated the mechanism underlying the high expression of TRAP1 during EMT and evaluated the potential of TRAP1 as a therapeutic target for metastatic CRC treatment. Moreover, we discussed ways to improve the clinical effectiveness of CRC treatments.

Methods

HCT116 colon cancer cell lines (either over-expressing or lacking TRAP1), nude mouse tumor experiments, and human CRC tissue were used. The effect of TRAP1 gene expression on the migration of CRC cells was studied using methods characterizing cellular function. The mechanism of the effect of TRAP1 expression on EMT in CRC was studied using immunohistochemistry, immunofluorescence, and western blotting methods.

Results

High TRAP1 expression was found to increase the migration of CRC cells, reduce apoptosis rates, regulate the E-cadherin and vimentin expression in opposite directions, as well as increase expression levels of hypoxia inducible factor 1α (HIF-1α), extracellular signal-regulated kinase 1/2 (ERK1/2), Twist, forkhead box protein C2 (FoxC2), and reduce the expression of succinate dehydrogenase complex flavoprotein subunit A (SDHA) proteins. These results indicate that TRAP1 regulates EMT in CRC by affecting the crosstalk between SDHA/HIF-1α, HIF/ERK1/2/Twist, and HIF/FOXC/Twist pathways.

Conclusion

High TRAP1 expression was found to promote EMT in CRC. TRAP1 activates expression of genes encoding proteins involved in SDHA/HIF-1α, HIF-1α/ERK1/2/Twist/Snail, and HIF-1α/FoxC/Twist/Snail pathways via HIF-1α. TRAP1 also regulates the expression of E-cadherin, the downstream protein of EMT.

Trap1

EMT

Crosstalk

Colorectal cancer (CRC) has ranked second leading cause of cancer worldwide, and associated with a poor prognosis among patients with advanced disease. Statistics indicate that 20–30% of patients are clinically-diagnosed with stage IV CRC, which cannot be cured with surgery alone. Moreover, 20% and 50% of stage II and stage III CRC patients eventually relapse with metastasis, respectively [1, 2]. Therefore, clinically-effective CRC treatments based on new therapeutic targets are urgently needed.

Tumor necrosis factor receptor-associated protein 1 (TRAP1) is a member of the Hsp90 family and has a molecular weight of 75 kDa with 645 amino acids. TRAP1 structure is also highly similar to that of Hsp90 [3, 4]. TRAP1 protein is involved in pathways of the central nervous, reproductive, and digestive systems. TRAP1 is also widely-expressed in tissues of the intestines, skeletal muscle, liver, heart, and kidney, among others [5]. It plays important roles in inhibiting oxidative stress-induced apoptosis and in maintaining mitochondrial integrity and cell homeostasis. TRAP1 protein is mainly found in the inner membrane of mitochondria and comprises an ATP-binding region [6].

TRAP1 has attracted considerable attention as a target molecule for cancer treatment. However, to date, many studies on TRAP1 have focused on specific cancer types such as prostate cancer, with only few studies investigating the role of TRAP1 in the progression and metastasis of CRC [7]. In prostate cancer cells, TRAP1 affects the expression of E-cadherin, an epithelial-mesenchymal transition (EMT) marker protein. EMT is the basic mechanism by which tumor cells acquire tissue invasive and metastatic abilities [8]. However, the role of TRAP1 during EMT in cancer is still controversial [9]. For instance, the expression profile of TRAP1 differs according to the type of cancer. TRAP1 is highly expressed in some malignant tumors, including glioblastoma, breast, prostate, and lung tumors, yet its expression level is low in other tumors [10]. Here, we aimed to investigate the role and molecular mechanism of TRAP1 in the pathogenesis, occurrence, and development of CRC, with particular emphasis on EMT.

2.1 Cell culture

Human CRC cell line HCT-116 was purchased from the cell bank of Guangzhou Saiku Biotechnology Co., Ltd. Cells were incubated in complete medium containing 10% fetal bovine serum [Dulbecco’s modified Eagle medium (DMEM), 1% penicillin] at 37°C and 5% CO₂. An appropriate level of humidity was set in the cell incubator. The cells were monitored every day, and the medium was refreshed every three days. When the confluence level reached 80%, the cells were digested for cell inheritance.

2.2 Cell transfection

Well-growing CRC cells were seeded in a 24-well plate. The number of cells was approximately 50–70% when lentiviral transfection was performed the next day (cell density was 1×10⁵/mL), with overnight incubation in a 5% CO₂ incubator at 37°C. A total of 250 µL of fresh culture medium containing virus stock and Polybrene was added. At 24 h post-infection, it was replaced with fresh culture medium containing puromycin for maintenance of screening culture. After 24 to 48 h of transfection, the cells with EGFP green fluorescence were regarded as transfected, the transfection efficiency was estimated, and western blotting and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) were used to quantify the expression of TRAP1 after lentiviral interference. Once the success of transfection was confirmed, subsequent experiments were performed.

2.3 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) Assay

CRC cells in the logarithmic growth phase were inoculated into 96-well plates, at a cell seeding density of 1×10⁴ cells/well, and cultured for 0, 24, 48, 72, and 96 h. A total of 25 µL of 5 mg/mL MTT solution was added to each well and incubated for 4 h. Then, 100 µL of DMSO was added to each well, and a microplate reader was used to detect the absorbance value of each well at a wavelength of 490 nm. There were five replicate wells for each group, and the procedure was repeated three times. According to the absorbance and culture time, the growth curve of the cells was plotted to visualize the growth ability of the cells.

2.4 Plate cloning

A single-cell suspension was prepared using complete medium, and the cells were counted under a microscope. An appropriate amount of the cell suspension was diluted with complete medium to obtain a new cell suspension containing 500 cells/mL. The resulting cell suspension (2 mL) was added to the 6-well plate and incubated at 37°C in a 5% CO₂ cell incubator for 10–15 days. When the size of the colony was deemed appropriate, the colony was fixed with 4% neutral paraformaldehyde solution, the number of formed cell clones was counted, and images of cell culture were taken.

2.5 Scratch test

The cells were inoculated into a six-well plate at a seeding density of 5×10⁵ cells/well. After 24 h of seeding, the plate was scratched evenly with a 10-µL pipette tip and then washed two to three times with 1× phosphate-buffered saline (PBS) to remove completely shed cells. Then, 2 mL of serum-free basal medium was added to each well, and the cells were incubated further. Images of cell scratching were taken at 0, 24, 48, 72, and 96 h. The image was processed, and the scratch area was measured using ImageJ software.

2.6 Cell invasion test

Diluted Matrigel (1 mg/mL, 100 µL) was spread onto the polycarbonate membrane of the upper compartment of the Transwell chamber (24-well plate), and the plate was placed in a 37°C incubator for 1 h. A total of 200 µL DMEM-only medium was added to each well. The cells were resuspended in serum-free medium containing 0.05–0.2% bovine serum albumin (BSA) at a cell density of 1×10⁵ cells/mL, and 200 µL of the prepared cell suspension was added to the 24-well plate chamber. Complete medium (500 µL) was added to the lower chamber of the 24-well plate, and the plate was placed in a 37°C, 5% CO₂ cell incubator for 36 and 48 h. The cells were fixed with 4% paraformaldehyde at room temperature and stained with crystal violet for 10 min. The cells that passed through the membrane were directly observed under an inverted microscope. Three to five fields were randomly selected to count the cells. Two parallel replicates were set up for each group of cells, and this procedure was repeated three times.

2.7 qRT-PCR analysis

For RNA extraction from the samples, 500 µL TRIzol was first added to each sample; after the sample was completely lysed, they were placed on ice for 10 min. Cellular RNA was extracted according to the manufacturer’s instructions, followed by reverse transcription to obtain cDNA, which was stored at -20°C for qRT-PCR analysis. The QPCR program was as follows: 55°C for 10 min, 95°C for 30 s for one cycle, followed by 40 cycles of 95°C for 30 s for denaturation, and 60°C for 10 s for annealing and extension. The melt curve was 65°C to 95°C for 5 s per step for one cycle. The relative mRNA levels were detected using the 2^−ΔΔCT method and normalized to β-actin levels.

2.8 Western blotting

The cells were harvested, and proteins were extracted using radioimmunoprecipitation assay buffer (Beyotime, Jiangsu, China). Total proteins were separated using 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis, transferred onto polyvinylidene difluoride membranes (Millipore, MA, USA), and blocked in a blocking solution on a shaker for 2 h at room temperature. After incubation with primary antibodies for vimentin, E-cadherin, Trap1, and forkhead box C2 (FOXC2), diluted in blocking solution [5% nonfat milk dissolved in Tris-buffered saline (TBS)–Tween-20], overnight at 4°C, the membranes were incubated with horseradish peroxidase-labeled secondary antibodies (CST Inc., Danvers, MA, USA) (1:5000, diluted in blocking solution) for 1 h at room temperature. Proteins were visualized using an enhanced chemiluminescence kit (Amersham Corp, Buckinghamshire, United Kingdom) and images of membranes were taken.

2.9 Immunofluorescence staining

Well-growing colon cancer cells were seeded on the slide of a 12-well plate. When the fusion degree reached 40–50%, the cells were fixed with 4% neutral paraformaldehyde solution and then treated with 0.2% Triton X-100 at room temperature for 15 min. One milliliter of 5% BSA was added to the block at room temperature for 60 min, and then the primary antibody diluted with 5% BSA was incubated at 4°C overnight. Fifty microliters of diluted fluorescent secondary antibody Alexa Fluor 594 were added to each well and incubated for 60 min at room temperature on a low-speed shaker. Subsequently, 100 µL of 5 µg/mL phalloidin working solution was added to each well, and finally, 500 µL of 2 µg/mL 4ʹ,6-diamidino-2-phenylindole (5% in BSA) was added to stain the nucleus for 15 min. After mounting the slides, the cells were inspected, and images were taken under a fluorescence microscope. Quantitative analysis of the dissolution and fluorescence intensity of the pictures was performed using ImageJ software.

2.10 Flow Cytometry Apoptosis Assay

CRC cells with good growth and EMT profiles were collected in a 15-mL centrifuge tube upon reaching 80–90% confluence and were centrifuged at 2000 rpm at room temperature for 5 min. The cell concentration was adjusted to 2×10⁷ cells/mL and resuspended in 1 mL of 1× binding buffer. Annexin V-FITC reagent (5 µL) was added to 100 µL of the prepared cell suspension (approximately 1×10⁶ cells), mixed by pipetting, and incubated at room temperature (25°C) under light for 15 min. Propidium iodide (5 µL) and 200 µL 1× binding buffer were added to each tube. Finally, the prepared cell suspension was filtered through a nylon mesh before testing. The solution was analyzed using a BD FACS Aria III flow cytometer.

2.11 Nude mouse tumor transplantation

Cells were collected upon reaching 60–70% confluence, and the cell density was adjusted to 10⁷ cells/mL with serum-free basic culture medium. Nude mice were subcutaneously inoculated with CRC cell suspensions. The cell lump grew for 7–10 days, and its size was measured every three days. Finally, nude mice were sacrificed, and tumor tissues were excised and fixed for HE and immunohistochemical staining analyses.

2.12 Immunohistochemistry

The paraffin sections of nude mouse tumors or human CRC tissues were treated with 0.3% H₂O₂ at room temperature, protected from light for 10 min, and washed with PBS. Then, goat serum blocking solution was added, and the solution was kept for another 10 min. Then, the diluted corresponding primary antibody was added, followed by incubation overnight at 4°C. The sections were rewarmed in an oven at 37°C for 30 min, washed with PBS, and a biotin-labeled secondary antibody was added dropwise. After washing with PBS, the sections were stained with 3, 3'-diaminobenzidine for 3 min. After counterstaining with hematoxylin, the slides were sealed with a neutral resin. Images were taken with an upright fluorescence microscope (DM4 B, Leica Instruments Co., Ltd.) and analyzed using ImageJ software.

2.13 Statistical Analysis

All P-values were two sided, and p < 0.05 was considered to indicate a statistically significant difference. The experimental data were expressed as the mean ± standard deviation, and analysis of variance with an LSD t-test was used to assess the relationship between two groups. Statistical analyses were performed using the SPSS v20.0 software (SPSS, Inc., Chicago, IL, USA).

3.1 TRAP1 was highly expressed in human CRC and shortened cell survival time

First, we analyzed TRAP1 protein expression in 34 samples including human CRC and adjacent tissue cells. Immunohistochemical results showed that TRAP1 expression in CRC was significantly higher than that in adjacent tissues (346242.5 ± 152262.4 vs. 265928.9 ± 179657.3, P = 0.030). Positive histochemical staining of TRAP1 was mainly observed in the cytoplasm (Fig. 1A). CRC patients with low TRAP1 expression also had relatively longer survival time (images were taken from Human Protein Atlas: http://www.proteinatlas.org) (Fig. 1B).

3.2 Effect of TRAP1 knock out and overexpression on the CRC cell proliferation

To investigate the role of TRAP1 in the proliferation of CRC cells, HCT-116 cells were stably transfected with TRAP1 shRNA (OE) and knocked out TRAP1 gene (KD) separately, and established OENC and KDNC groups with both of empty plasmid control (NC). As shown in Fig. 2A. The MTT assay showed that TRAP1 overexpression promoted cell proliferation, whereas TRAP1 knock-out (with empty plasmids) had lower effect on cell proliferation compare to the WT or NC groups, indicating that the effect of cell proliferation was caused by overexpression of TRAP1 (Fig. 2B). The clones in HCT-116 cells overexpressing TRAP1 were also larger and more in number than those in TRAP1 knocked out cells, in the clone formation experiment (Fig. 2C).

3.3 Effect of TRAP1 knock out and overexpression on CRC cells migration and tissue invasion ability

The effect of TRAP1 knock out and overexpression on migration and tissue invasion ability of CRC cells was investigated via Transwell and scratch assays. Using Transwell chamber coated with extracellular matrix to detect cell invasion ability in migration assay. Wound healing percentage of cell invasion ability was calculated by the following equation: (scratch area of 0h - scratch area of 48h or 96h) / scratch area of 0h) %. The results showed that migration abilities of HCT116 cells knock out TRAP1 were lower than those of wild type control. Migration abilities of HCT-116 cells overexpressing TRAP1 were stronger than those of wild type control or NC control (Fig. 3A and 3B).

3.4 TRAP1 inhibited CRC cell apoptosis

To further illustrate the role of TRAP1 in regulating the viability of CRC cells, Cells apoptosis was detected by flow cytometry expressed with apoptosis rate (%). The experiment was independently repeated for three times. The results showed that apoptosis in HCT-116 cells lacking TRAP1 (KD) was significantly increased compare to WT or NC groups (P < 0.001), while the ratio of apoptotic cells in HCT-116 cell populations with high TRAP1 expression (OE) was reduced compare to WT groups. Hence, TRAP1 promoted CRC cell proliferation by inhibiting apoptosis (Fig. 4).

3.5 TRAP1 affected EMT in CRC

To confirm whether TRAP1 induced EMT in CRC, expression levels of E-cadherin and vimentin were measured. Increase in TRAP1 expression was found to trigger the typical EMT phenotype, including the down-regulation of E-cadherin and up-regulation of Vimentin expression, respectively (p < 0.01), as shown in Fig. 5.

3.6 Effected of TRAP1 on crosstalk between different signal transduction pathways

A crosstalk of different signal transduction pathways, including hypoxia, angiogenesis, oxidative stress damage, apoptosis, and metabolism were studied with qRT-PCR and western blot. TRAP1 affected protein and mRNA expression levels with up-regulation in hypoxia inducible factor 1α (HIF-1α), FOXC2, extracellular regulated protein kinase 1/2 (ERK1/2), and Twist proteins, and down-regulation in succinate dehydrogenase complex flavoprotein subunit A (SDHA), as shown in Fig. 6A and B.

3.7 TRAP1 enhances tumorigenicity and metastasis in vivo

We analyzed the tumor formation ability of nude mice injected with HCT-116 cells overexpressing TRAP1 and lacking TRAP1. Tumors produced by TRAP1-overexpressing cells were larger than those produced by cells lacking TRAP1 (Fig. 7A). To determine the metastasis ability of TRAP1-overexpressing cells, immunohistochemical analysis of tumor tissues was performed, and expression levels of EMT-related proteins were determined (Fig. 7B). Collectively, these results show that high TRAP1 expression significantly increased tumor formation and metastasis ability.

The main cause of death in CRC patients is metastasis. Thus, tissue invasion and metastasis are typical behaviors of malignant tumors. EMT refers to the biological process of epithelial cells transforming into cells with mesenchymal phenotypes through specific procedures [11]. EMT is an important early sign of tumor invasion and migration in tumorigenesis and development. During EMT, cellular morphology and biological behavior changes. E-cadherin and vimentin, the mesothelial marker cytoskeleton component, are both important biomarkers of EMT [12]. Here, results of functional in vitro experiments showed that TRAP1 overexpression triggered the occurrence of EMT in CRC. Western blotting and qRT-PCR were used to quantify the expression levels of EMT-related proteins in HCT-116 cells lacking TRAP1. Compared to those in the wild-type HCT-116 cells, E-cadherin and vimentin expression levels were found to be down- and up-regulated, respectively. The results of the nude mouse tumor transplantation experiment also showed that high TRAP1 expression increased the tumor volume and growth rate. Immunohistochemical results showed similar changes in the expression levels of E-cadherin and vimentin in the tumor tissue. In vivo and in vitro results indicate that TRAP1 expression is accompanied by changes in the expression of EMT-related genes such as E-cadherin and vimentin at the RNA and protein levels. This suggests that TRAP1 promotes EMT in CRC cells.

The EMT in CRC is a complex process and involves multiple factors such as cells, cytokines, and extracellular matrix. During EMT, a crosstalk is established between different signal transduction pathways, including hypoxia, angiogenesis, oxidative stress damage, apoptosis, and metabolism [13, 14], through shared connections and interactions. Migration and tissue invasion of CRC cells occur as a result of this crosstalk. Here, we reason that apoptosis-related molecules and HIF-1α play connecting roles. These include important transcription factors that regulate tumor angiogenesis, glucose metabolism, proliferation, apoptosis, and chemotherapy resistance, among other related genes [15].

TRAP1 is mainly found in the inner mitochondrial membrane, and plays important roles in maintaining the integrity and function of mitochondria, as well as in regulating mitochondrial apoptosis, respiration, and energy metabolism. HIF-1α plays a key role in regulating energy metabolism, mitochondrial damage, inducing cell apoptosis, and promoting angiogenesis. HIF-1α also promotes the migration and tissue invasion of tumor cells by regulating related transcription factors [16]. SDHA is a subunit of the heterotetramer succinate dehydrogenase, and it is located in the inner mitochondrial membrane. SDHA participates in the tricarboxylic acid cycle and electron transfer in the mitochondrial respiratory chain, and it plays an important role in the energy metabolism of tumor cells [17]. Previous studies have reported effects of TRAP1 on EMT in liver cancer cells through the abnormal expression of HIF-1α [18]. Moreover, the changes in HIF-1α caused by mutations in the SDHA gene were found to be closely related to a variety of tumors, including renal cell carcinoma, wild-type gastrocolorectal stromal tumors, hereditary paraganglioma, and pheochromocytoma. Tumor cells maintain a high proliferation rate through metabolic reprogramming. Even at normal oxygen levels, tumor cell metabolism switches from oxidative phosphorylation to aerobic glycolysis. HIF-1 is the main regulator of this process. Previous microarray analysis results also showed that SDHA mutants are involved in energy metabolism and hypoxia pathways [19]. Inactivation mutations in the SDHA gene cause pseudohypoxia and lead to attenuation of the tricarboxylic acid cycle. The hydroxylation of HIF-1α is accompanied by the conversion of α-ketoglutarate to succinic acid. The accumulation of succinic acid then inhibits hydroxylation and degradation of HIF-1α, thereby increasing expression of HIF-1α protein and its downstream gene, resulting in the lack of SDHA affecting HIF-1α stability [20]. The dependance of the roles of SDHB or SDHA expression, in HIF-1 activation, on reactive oxygen species remains controversial. Here, we showed that the expression of SDHA in HCT-116 cells overexpressing TRAP1 was lower than that in HCT-116 WT cells. This indicates that TRAP1, which plays an important role in mitochondrial metabolism, promotes the occurrence of EMT in CRC by activating SDHA/HIF-α and affects the mitochondrial metabolism of tumor cells.

Regulation of hypoxia signaling pathway during EMT in CRC requires a powerful transcription mechanism. Accordingly, many synergistic effects that regulate expression of EMT-related proteins, including ERK1/2 and Twist, must be present. The activation of ERK1/2 [21] is an important step in loss of cell-cell adhesion, causes phosphorylation of many downstream proteins (transcription factors including Twist, c-Myc, ribosomal S6 kinase, and c-Jun), and further participates in the formation and development of tumors. Twist is a member of the zinc finger transcription factor family and is overexpressed in many primary tumors, including colon, breast, prostate, and gastric cancers [22, 23].

Twist protein is involved in the two main programmed oncogene cell failure processes of senescence and apoptosis. Twist induces EMT by binding to the E-box site in the E-cadherin promoter and via the consequent inhibition of transcription of E-cadherin [24]. Twist is also a central EMT regulator that not only promotes the down-regulation of cadherin to induce EMT, but also activates gene transcription in the mesenchymal state [25]. Previous studies have shown that the ERK1/2 signaling pathway in CRC promotes EMT via Twist by inhibiting E-cadherin expression and activating the N-cadherin promoter [26]. In addition, studies have shown that one of the relevant regulatory pathways of HIF-1α is ERK1/2/Twist. Based on these results, HIF-1α/ERK1/2/Twist pathway can be considered to play an important role in the infiltration and metastasis of CRC cells. Here, we found that Twist expression level was significantly reduced in the HCT-116 cell line with TRAP1 knockout, whereas that in the HCT-116 cell line with high TRAP1 expression showed a significant increase. Similarly, clear changes in cell function and corresponding immunofluorescence results for the tissue sections of nude mice were observed. These results indicate that the high Twist expression plays a crucial role in TRAP1-induced EMT of CRC. High expression of ERK1/2 and Twist proteins was observed in HCT-116 cells with high TRAP1 expression.

FOXC2 is a member of the FOX gene family. FOXC2 is an important regulatory gene that promotes cancer occurrence and development [27]. FOXC2 mainly promotes tumor angiogenesis and participates in EMT. Sano [28] et al. showed that abnormal FOXC2 expression causes malignant tumor formation and that there are multiple mechanisms regulating the expression of FOXC2. High FOXC2 expression levels were found to reduce expression of hypoxia factors, as well as increase tissue invasion and migration ability of breast cancer MCF-7 cells. High FOXC2 levels can also trigger EMT and increase tumor invasion and metastasis by enhancing the stability of Snail [29, 30]. We have obtained similar results for CRC here. FOXC2 was highly expressed in TRAP1-overexpressing HCT-116 cells. The up-regulation of FOXC1 under hypoxic conditions is related to the expression of HIF-2α, which further verifies that HIF-2α affects the invasion ability of glioma cells by regulating the expression of FOXC1 under hypoxic conditions. The role of the HIF-2α/FOXC1 regulatory axis in glioma cell invasion under hypoxic conditions is unclear. Twist1 is one of the candidate downstream target genes of FOXF2. When FOXF2 is highly expressed in tumor cells, the Twist1 promoter binds to it and down-regulates the expression of the pGL3-Twist1 protein. However, when the transcription factor FOXF2 is lacking or has low expression, it can trigger Twist1 expression and can induce EMT phenotype of epithelial cells, thereby further promoting cancer cell metastasis [34]. In the differentiation and dedifferentiation of mesenchymal and epithelial cells of tumor tissues, FOXF2 and Twist1 play important roles in the EMT phenotype through this coordinated interaction. Even though Twist1 is a candidate downstream target gene of FOXF2, FOXF2 can only bind to the pGL3-Twist1 promoter via a specific binding site region, thereby negatively regulating the expression of Twist1 [31]. When FOXF2 is not expressed, Twist1 transcription is up-regulated, EMT programming is activated, and finally, tumor metastasis ability is enhanced. However, if the Twist1 gene is knocked out, low FOXF2 expression cannot promote the malignant phenotypic transformation of tumor EMT.

Various pathogenic factors play multiple roles through intricate connections between various cytokine networks and signal transduction pathways during EMT. Here, we investigated the effects of high TRAP1 expression through a crosstalk between of SDHA/HIF-1α, HIF/ERK1/2/Twist, and HIF/FOXC/Twist pathways, resulting in changes in key bioenergetic processes in multiple mitochondria and in joint regulation of EMT in CRC. Changes in TRAP1 expression were shown to affect expression levels of multiple EMT-related factors, which indicates that the effect of TRAP1 on EMT in CRC may not occur via a certain gene or pathway, but a crosstalk between multiple pathways. To this end, high TRAP1 expression may also ultimately affect EMT through HIF-1α and cause progression of metastatic CRC [32].

Our results indicate that the crosstalk between SDHA/HIF-1α, HIF/ERK1/2/Twist, and HIF/FOXC/Twist signaling pathways may represent a mechanism for TRAP1 to trigger EMT in CRC. These signaling pathways include extensive regulatory mechanisms. Upon receiving different signals, the pathways can exert different biological effects, and play a role in tumor formation, apoptosis, immunity, and inflammation. The crosstalk may also be manifested through different mechanisms of action, yet these are inseparable from hypoxia and apoptosis and include very complex interactions [33, 34]. Considerable efforts have been spent to investigate the crosstalk mechanisms in classical HIF-1α signaling pathway, yet many non-classical crosstalk relationships remain to be investigated.

Ethics approval and consent to participate: We confirm that all experimental protocols were approved by Laboratory Animal Ethics Committee of Guilin medical university.All methods were carried out in accordance with relevant guidelines and regulations and all methods are reported in accordance with ARRIVE guidelines for the reporting of animal experiments.

Consent for publication: Not applicable.

Availability of data and materials: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing Interests: The authors declare that they have no competing interests for this research.

Funding: This work was in part supported by the National Natural Science Foundation of China (81460446，81860580).

Author Contributions: Liu Yang carried out the molecular biological studies. Yingqi Zhao and Peipei Yi carried out the immunoassays and real-PCR. Lu Liu and Yao Du participated in the statistical analysis. Data Curation; Honglin Zou; Writing – Original Draft Preparation, Hongling Zou; Writing – Review & Editing, Project Administration and Funding Acquisition, Yuanming Lu.

Acknowledgments: Not applicable.

Romain V, Amélie L, Julie V, Johan G, Nicolas B, Elisabeth B, Delphine B, Mathilde B. Microbial markers in colorectal cancer detection and/or prognosis. World Journal of Gastroenterology, 2018, 24(22): 2327-2347.
Uhlmann ME, Milka G, Martin S. Prognostic value of tumor progression-related gene expression in colorectal cancer patients. J Cancer Res Clin Oncol. 2018, 138(10): 1631-40
Yutaka M, Genryu S, Toshihiro A, Masayo H, Kouichi H, Shigeo N, Sachiko K, Toshiko SI, Kazuyasu N. Involvement of tumor necrosis factor receptor-associated protein 1 (TRAP1) in apoptosis induced by beta-hydroxyisovalerylshikonin. J Biol Chem. 2004, 279(41):42503-15.
Daniel E, Miguel B, Yanxin L, Theresa R, Michael AK, David AA. Symmetry broken and rebroken during the ATP hydrolysis cycle of the mitochondrial Hsp90 TRAP1. Elife. 2017, 6: e25235
Cechetto JD, Gupta RS. Immunoelectron Microscopy Provides Evidence That Tumor Necrosis Factor Receptor-Associated Protein 1 (TRAP-1) Is a Mitochondrial Protein Which also Localizes at Specific Extramitochondrial Sites. Exp Cell Res 2000, 260(1):30-39.
Irwin L, Janet P, Hira LG, Jing L, Zhong J, Ronald JC, Lucia RL, Dario CA. Cytoprotective Mitochondrial Chaperone TRAP-1 As a Novel Molecular Target in Localized and Metastatic Prostate Cancer. The American Journal of Pathology, 2010, 176(1):393-401.
Sofia L, David SG, Kelly GB, Michele T, Gordon BM, Yiling L, Andrew VK, Louise CS, Lucia RL, Dario CA. Transgenic Expression of the Mitochondrial Chaperone TNFR-associated Protein 1 (TRAP1) Accelerates Prostate Cancer Development. J Biol Chem 2016, 291(48):25247-25254.
Julia M, Bjoern T, Ulrich R. Real-time analysis of epithelial-mesenchymal transition using fluorescent single-domain antibodies. Scientific Reports, 2015, 5:13402.
Amoroso MR, Matassa DS, Agliarulo I, Avolio R, Maddalena F, Condelli V, Landriscina M, Esposito F. Stress-Adaptive Response in Ovarian Cancer Drug Resistance: Role of TRAP1 in Oxidative Metabolism-Driven Inflammation. Adv Protein Chem Struct Biol 2017,108:163-198.
Maria RA, Danilo SM, Ilenia A, Rosario A, Haonan L, Lorenza S, Giacomo L, Hani G, Matteo L, Franca E. TRAP1 downregulation in human ovarian cancer enhances invasion and epithelial-mesenchymal transition. Cell Death Dis 2016, 7(12):e2522.
Singh A, Settleman J. EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer. Oncogene, 2010, 29(34):4741-51.
Zhai X, Zhu H, Wang W. Abnormal expression of EMT-related proteins, S100A4, vimentin and E-cadherin, is correlated with clinicopathological features and prognosis in HCC. Medical Oncology, 2014, 31(6):970.
Siraj A K, Pratheeshkumar P, Divya SP. TGF-induced SMAD4-dependent Apoptosis Proceeded by EMT in CRC. Molecular Cancer Therapeutics, 2019, 18(7): 1312-1322.
Wang X, Feng Q, Yu H, Zhou X, Shan C, Zhang Q, Liu S. HBXIP: a potential prognosis biomarker of colorectal cancer which promotes invasion and migration via epithelial-mesenchymal transition. Life Sci. 2020, 245:117354.
Gilkes DM, Semenza GL. Role of hypoxia-inducible factors in breast cancer metastasis. Future Oncol. 2013, 9(11):1623-36.
Eman AT, Kisho O, Takanori E. Roles of Extracellular HSPs as Biomarkers in Immune Surveillance and Immune Evasion. Int J Mol Sci. 2019, 20(18):4588.
Burnichon N, Brière, RL. SDHA is a tumor suppressor gene causing paraganglioma. Human Molecular Genetics, 2010, 19(15):3011-3020.
Brian KR. HIF1α and HIF2α: sibling rivalry in hypoxic tumor growth and progression. Nature Reviews Cancer, 2011, 12(1):9-22.
Jean-Jacques Brière, Judith F, Paule B, Vincent EG, Annalisa L, Daniel R, Maria FD R, Anne-Paule GR, Pierre R. Mitochondrial succinate is instrumental for HIF1α nuclear translocation in SDHA-mutant fibroblasts under normoxic conditions. Human Molecular Genetics, 2005, 14(21):3263-9.
Benit P, Favier J, Lorenzato A. Mitochondrial succinate is instrumental for HIF1 alpha nuclear translocation in SDHA-mutant fibroblasts under normoxic conditions. Hum Mol Genet. 2005, 14(21):3263-9.
Liu X, He H, Zhang F, Hu X, Bi F, Li K, Yu H, Zhao Y, Teng X, Li J, Wang L, Zhang Y, Wu Q. m6A methylated EphA2 and VEGFA through IGF2BP2/3 regulation promotes vasculogenic mimicry in colorectal cancer via PI3K/AKT and ERK1/2 signaling. Cell Death Dis. 2022, 13(5):483.
Stockton RA, Jacobson BS. Modulation of Cell-Substrate Adhesion by Arachidonic Acid: Lipoxygenase Regulates Cell Spreading and ERK1/2-inducible Cyclooxygenase Regulates Cell Migration in NIH-3T3 Fibroblasts. Molecular Biology of the Cell, 2001, 12(7):1937-1956.
Zhuo WL, Wang Y, Zhuo XL. Short interfering RNA directed against TWIST, a novel zinc finger transcription factor, increases A549 cell sensitivity to cisplatin via MAPK/mitochondrial pathway. Biochemical & Biophysical Research Communications, 2008, 369(4):1098-1102.
Jun SY, Cho HS, Lee JJ. Abstract 1446: Induction of epithelial-to-mesenchymal transition (EMT) by SL-15 knockdown contributes to anoikis resistance in human colorectal cancer metastases. Cancer Research, 2015, 75(15 Supplement):1446-1446.
Lander R, Nordin K, Labonne C. The F-box protein Ppa is a common regulator of core EMT factors Twist, Snail, Slug, and Sip1. Journal of Cell Biology, 2011, 194(1):17-25.
Chanbora C, Mutsumi M, Toshihiro I, Kana O, Sivmeng H, Phuong TN, Hiromichi I, Takashi T. Bovine lactoferrin reverses programming of epithelial-to-mesenchymal transition to mesenchymal-to-epithelial transition in oral squamous cell carcinoma. Biochem Biophys Res Commun. 2018, 507(1-4):142-147.
Cui YM, Jiao HL, Ye YP. FOXC2 promotes colorectal cancer metastasis by directly targeting MET. Oncogene. 2015 Aug 13;34(33):4379-90.
Hollier BG, Tinnirello AA, Werden SJ. FOXC2 expression links epithelial-mesenchymal transition and stem cell properties in breast cancer. Cancer Research, 2013, 73(6):1981-1992.
Yao-Borengasser A, Monzavi-Karbassi B, Hedges R. Adipocyte hypoxia promotes epithelial-mesenchymal transition-related gene expression and estrogen receptor-negative phenotype in breast cancer cells. Oncol Rep. 2015, 33(6):2689-94..
Miao L, Yang L, Li R. Disrupting androgen receptor signaling induces Snail-mediated epithelial-mesenchymal plasticity in prostate cancer. Cancer Research, 2017:3101.
Jun C, Aixian T, Qingshan W, Pengzhou K, Xindu, Xiaoqing L, Yumei F. FOXF2 suppresses the FOXC2-mediated epithelial–mesenchymal transition and multidrug resistance of basal-like breast cancer. Cancer Letters, 2015, 367(2):129-137.
Boutz PL, Chawla G, Stoilov P. MicroRNAs regulate the expression of the alternative splicing factor nPTB during muscle development. Genes Dev, 2006, 21(1):71-84.
Shang Y, Chen H, Ye J. HIF-1α/Ascl2/miR-200b regulatory feedback circuit modulated the epithelial-mesenchymal transition (EMT) in colorectal cancer cells. Experimental Cell Research, 2017: 360(2):243-256.
Zhang J, Zhang S, Gao S. HIF-1α, TWIST-1 and ITGB-1, associated with Tumor Stiffness, as Novel Predictive Markers for the Pathological Response to Neoadjuvant Chemotherapy in Breast Cancer. Cancer Management and Research, 2020, 12:2209-2222.

Table 1 TRAP1 and EMT-gene Primer Sequences

	Primer	Sequence
TRAP1	Forward primer	CAGGGTTCCACTTCCAAACA
TRAP1	Reverse primer	TGGAGATCAGCTCCCGTATAA
Vimentin	Forward primer	GACGCCATCAACACCGAGTT
Vimentin	Reverse primer	CTTTGTCGTTGGTTAGCTGGT
E-Cadherin	Forward primer	CGAGAGCTACACGTTCACGG
E-Cadherin	Reverse primer	GGGTGTCGAGGGAAAAATAGG
Twist	Forward primer Reverse primer	GTCCGCAGTCTTACGAGGAG GCTTGAGGGTCTGAATCGGGCT
HIF-1α	Forward primer	AGCACAGTTACAGTATTCCAGCAGAC
HIF-1α	Reverse primer	TTAATTCATCAGTGGTGGCAGTGGTAG
SDHA	Forward primer	TGCAGGGAAACCTGGAACTC
SDHA	Reverse primer	ACAGGGGTGGTATTGTTCAGC
FOXC2	Forward primer	TCGGAAGCCTAACTACAGCGA
FOXC2	Reverse primer	AGATGAGCATTGGCAGCGAG
β-actin	Forward primer	CATGTACGTTGCTATCCAGGC
	Reverse primer	CTCCTTAATGTCACGCACGAT

No competing interests reported.

table1.docx

Download PDF

Editorial decision: Revision requested
14 May, 2024
Reviews received at journal
13 May, 2024
Reviewers agreed at journal
06 May, 2024
Reviews received at journal
10 Jan, 2024
Reviewers agreed at journal
10 Jan, 2024
Reviewers agreed at journal
05 Jan, 2024
Reviewers invited by journal
22 Aug, 2023
Editor assigned by journal
13 Aug, 2023
Editor invited by journal
08 Aug, 2023
Submission checks completed at journal
08 Aug, 2023
First submitted to journal
07 Jul, 2023

You are reading this latest preprint version

TRAP1 controls the crosstalk between SDHA/HIF-1α, HIF/ERK1/2/Twist, and HIF/FoxC/Twist pathways via HIF-1α during EMT in colorectal cancer

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

1. Introduction

2. Material and Methods

2.1 Cell culture

2.2 Cell transfection

2.3 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) Assay

2.4 Plate cloning

2.5 Scratch test

2.6 Cell invasion test

2.7 qRT-PCR analysis

2.8 Western blotting

2.9 Immunofluorescence staining

2.10 Flow Cytometry Apoptosis Assay

2.11 Nude mouse tumor transplantation

2.12 Immunohistochemistry

2.13 Statistical Analysis

3. Results

3.1 TRAP1 was highly expressed in human CRC and shortened cell survival time

3.2 Effect of TRAP1 knock out and overexpression on the CRC cell proliferation

3.3 Effect of TRAP1 knock out and overexpression on CRC cells migration and tissue invasion ability

3.4 TRAP1 inhibited CRC cell apoptosis

3.5 TRAP1 affected EMT in CRC

3.6 Effected of TRAP1 on crosstalk between different signal transduction pathways

3.7 TRAP1 enhances tumorigenicity and metastasis in vivo

4. Discussion

Declarations

References

Table 1

Additional Declarations

Supplementary Files

Status:

Version 1