Cell lines, reagents and culture conditions
Human lung adenocarcinoma epithelial A549 cells, immortalized human HaCaT keratinocytes, Calu-3 epithelial lung cancer cells and human embryonic kidney HEK293T cells were kindly provided by Søren R. Paludan (Aarhus University, Denmark) and cultured in DMEM (Lonza) supplemented with 10% heat inactivated fetal calf serum, 200 IU.mL-1 penicillin, 100 mg.mL-1 streptomycin and 600 mg.mL-1 glutamine (hereafter termed DMEM complete). Vero E6 cells expressing hTMPRSS2 were a kind gift of Makoto Takeda (University of Tokyo, Japan)(1) and were cultured in DMEM (Lonza) supplemented with 10% heat inactivated fetal calf serum, 200 IU.mL-1 penicillin, 100 mg.mL-1 streptomycin, 600 mg.mL-1 glutamine and 10 mg.mL-1 blasticidin. All cell lines were regularly tested for mycoplasma contamination by sequencing from GATC Biotech (Germany). 4-octyl-itaconate (4-OI) was chemically synthetized by Thomas B. Poulsen (Aarhus University, Denmark) and was dissolved in DMSO as previously described here(2).
To obtain bone marrow-derived cells (BMDCs), a cell suspension from femurs of C57BL/6 mice (Charles River) was cultured for 6-8 days at 37ºC in RPMI-1640 medium supplemented with 3% FBS and 10% of J558 cell line supernatant containing GM-CSF. Cells were seeded at a density of 106 cells/ml and medium was partially replaced every 2 days. BSC-1 cells (ECACC) were maintained in DMEM supplemented with 5% FBS,
2 mM glutamine, 200 IU/ml penicillin and 100 IU/ml streptomycin at 37ºC 5% CO2.
For generation of KO cell line clones in HaCaT cells specific guide RNA sequences targeting STING (5’-AGAGCACACTCTCCGGTACC-3’) or STAT1 (5’-TTAATGATGAACTAGTGGAG-3’) were cloned into the plasmids pX461 (Addgene) (STING) or LentiCRISPR v2 (Addgene) (STAT1). Wildtype HaCaT cells were transfected with the plasmids using the Lipofectamine 2000 Reagent (Invitrogen, Life Tecnologies). 72 h post transfection, the GFP expressing cells were sorted as single cells by FACS and clones were grown to larger cultures (STING). Or 24 h post transfection, the cells were seeded in a dilution sufficient to obtain single cells clones after the puromycin selection. The 2 μg mL-1 puromycin selection was initiated 48 h post transfection and continued for 72 h (STAT1). Hereafter, single cell clones were grown to larger cultures which were validated for absence of protein by western blotting and functional analysis to confirm the biological effect of the gene deficiency.
Viruses
We used the SARS-CoV2 strain #291.3 FR-4286 isolated from a patient in Germany, and kindly donated by professor Georg Kochs (Freiburg). The virus was propagated in Vero-TMPRSS2 cells(3). Validation and SARS-CoV2 genome detection was performed with Taqman based qPCR using SARS-CoV2 specific primers and probes with the following sequences: Forward primer: AAATTTTGGGGACCAGGAAC, reverse primer: TGGCACCTGTGTAGGTCAAC, Probe: FAM-ATGTCGCGCATTGGCATGGA-BHQ. HSV-1 KOS strain expressing GFP (HSV-1–GFP), HSV-2 333 strain and HSV-2 MS strain were kindly provided by Søren R. Paludan (Aarhus University, Aarhus, Denmark). All HSVs were propagated in Vero cells, purified by ultra-centrifugation, and titrated by standard plaque assay as previously described (4). HaCat cells were infected with the different HSVs at a multiplicity of infection (MOI) of 0.01 in a small volume of serum-free medium for 1 h at 37°C. Prior to analysis, cells were incubated with DMEM complete for an additional day of culture. VACV Western reserve strain (VACV-WR) was a recombinant vaccinia virus (VACV) named vtag2GFP expressing the tag2GFP under the control of strong synthetic VACV early/late promoter was kindly provided by Dr. Rafael Blasco (INIA, Spain). VACV-WR and vtag2GFP stocks were semi-purified by centrifugation through a 36% sucrose cushion and titrated twice by plaque assay. The Brazilian ZIKV isolate ZIKV/H.sapiens/Brazil/PE243/2015 was originally described in (5) and was grown on Vero cells. Viral titers were determined by plaque assay on A549 BVDV NPro cells (kind gift from R. Randall, St Andrews). These cells are optimized for virus growth as they stably express the NPro protein of bovine viral diarrhea virus (BVDV), which induces degradation of IRF3 (6).
Viral entry assay
Quantification of HSV-1 entry in the presence of 4-OI was performed using the cold binding assay previously described(7). Cells were pretreated with 4-OI (150 µM) or DMSO (control) for 48 hours. Cells were pre-incubated at 4oC for 30 minutes, then incubated with HSV-1 at a MOI of 10 for 1 hours at 4oC. Cells were then shifted to 37oC for 1 hours to activate virus internalization. After that, cells were washed twice with PBS, then uninternalized virus particles were washed with citric acid buffer (135 mM NaCl, 10 mM KCl, 40 mM citric acid, pH 3) incubation for 5 minutes, then cells were washed twice more with PBS. Cells were scraped and genomic DNA was extracted using QIAamp DNA mini kit (QIAGEN). Quantitative PCR were performed using UL30-F and UL30-R primers for HSV-1 genomic DNA. Primer sequence: UL30-F: ACATCATCAACTTCGACTGG, UL30-R: CTCAGGTCCTTCTTCTTGTCC
Primary cells and culture conditions
Peripheral Blood Mononuclear cells (PBMCs) were isolated from healthy donors (blood donors gave written consent as accordingly to the ethical guidelines at Aarhus University Hospital) by Ficoll Paque gradient centrifugation (GE Healthcare). Monocytes were separated using a monocyte enrichment kit (STEMCELL) according to the manufacturer’s instructions or from PBMCs by adherence to plastic in RPMI 1640 supplemented with 10% AB-positive human serum. Differentiation of monocytes to macrophages was achieved by culturing in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% heat inactivated AB-positive human serum 9 days in the presence of 10 ng/ml M-CSF (R&D Systems), as previously reported in (8).
Patients included in this study
All patients were positive for SARS-CoV2 by PCR from throat swab and admitted to the ICU and receiving ventilatory support due to severe pneumonia with a component of acute respiratory distress syndrome (ARDS). P1 27-years old male, day 14 at in ICU. P2 57-year-old female, day 9 in ICU. P3 43 years-old male, day 5 in ICU. P4 28 years-old female, day 3 in ICU.
Air-Liquid Interface Epithelium model
Primary nasal cells were isolated using a nasal brush (Dent-O-Care, #620B) inserted into the nasal turbinations and twisted. Cells were isolated from the brush by gently expelling monolayer medium (Airway Epithelial Cells Basal Medium, PromoCell, #C-21260 + 1 pack of Airway Epithelial Cell Growth Medium Supplement, PromoCell, #39160 + 100 U/ml Penicillin/Streptomycin, Gibco #10378) and PBS to wash of cells. Cells were cultured in monolayer culture in tissue culture flask (Sarstedt, TC: Standart #83.3911) coated with 0,1 mg/ml Bovine type I collagen solution (Sigma-Aldrich, #804592, diluted in sterile ddH2O). Monolayer cultures were split using 1x Trypsin mixed with 0.3 mM EDTA (10x Trypsin (2,5 %), Gibco, #15090, diluted to working concentration in PBS + UltraPure 0.5 M EDTA, Invitrogen, #15575) at approx. 80% confluency. At passage two, cells were seeded at 2-3x10^4 cells on 6,5 mm Transwell membranes (Corning, #3470) coated with 30 ug/ml Bovine type I collagen solution (Sigma-Aldrich, #804592, diluted in sterile ddH2O). Cells were seeded and submerged in 2x P/S (200 U/ml Pen/Strep) DMEM-low glycose (Sigma-Aldrich, D5921) mixed one to one with 2x Monolayer medium (Airway Epithelium Cell Basal Medium, (PromoCell, #C-21260) supplemented with 2 packs of Airway Epithelial Cell Growth Medium Supplement (PromoCell, #C-39160) without triiodothyronine + 1 ml of 1.5 mg/ml BSA). When cultures reach full confluency ALI (=Air-liquid interface) is introduced and medium is changed to ALI medium (Pneumacult ALI medium kit (StemCell, #5001) with ALI medium supplement (StemCell, #5001) and 100 U/ml Pen/strep) supplemented with 24 ug of hydrocortisone (StemCell, #07925) and 0.2 mg heparin (StemCell, #07980). Membranes was allowed at least 21 days of differentiation verified by extensive cilia beating and mucus covering.
Upon initiation of treatment ALI cultures was washed for 5 minutes using DMEM (low glycose, no additives) and baso-lateral medium changed for ALI medium containing either 150 uM 4-OI or DMSO. Baso-lateral medium containing treatment was left overnight. 100 ul of DMEM (low glycose) with 150 uM or DMSO was additionally added to the apical compartment overnight. At time of infection, apical medium was removed and 100 ul DMEM (low glycose) containing SARS-CoV-2 at MOI 0.1 was added to all membranes for 1 hour and placed in 37 oC incubator. After 1-hour apical infection medium was removed and membranes placed in 37 oC incubator for 24 hours before harvest.
At time of harvest, baso-lateral medium was removed and 500 ul Trypsin/EDTA was added bao-laterally and 200 ul was added apically. After approx. 5 minutes cells were harvested using 5% FPB/DMEM (low glycose). Cells were lysed for RNA isolation using lysisbuffer from High Pure RNA Isolation Kit (Roche Diagnostics, #11828665001). For Western blot cells were lysed in RIPA buffer containing 1/10 Protease inhibitor (Roche), 1/1000 Benzonase (Sigma, #E1014) and 1/50 0.5 M Sodium Flouride.
Short-interfering RNA (siRNA)-mediated knock down
For short interfering RNA experiments, HaCat cells were transfected in 6-well plates with 80 pmol of human Nrf2(1) (sc-37030) or control si RNA (sc-37007) diluted in serum and antibiotic free DMEM and using Lipofectamine RNAi Max as per manufacturer’s instructions. HaCat cells were incubated for 72h in the presence of the siRNA before being processed.
dsDNA, cGAMP and optimized RIG-I agonist stimulation of cells.
HSV-60 naked, a viral dsDNA motif, 2’3’-cGAMP, a STING ligand, and M8, a sequence optimized RIG-I agonist (9) were obtained from Invivogen and John Hiscott (Pasteur Institute, Rome), respectively. Intracellular delivery of dsDNA and cGAMP was achieved using Lipofectamine 2000 (Invitrogen) diluted in serum-free medium with a ratio of Lipo.dsDNA/cGAMP of 1:1. Final concentration for both dsDNA and cGAMP was 4mg.mL-1. Intracellular delivery of M8 was achieved using Lipofectamine RNAiMax (Invitrogen) diluted in serum-free medium with a ratio of Lipo.RNA of 1:1. Final concentration of M8 was 10 ng.mL-1.
VACV infection assays.
BMDCs, HaCaT and HaCaT Stat1 KO were incubated or not with 150 µM 4-OI for 48 h before infection with vtag2GFP using 0.1 or 0.01 pfu/cell at 37 ºC for 60 min. Then, infected cells were washed to remove potential unbound viruses and infection proceeded at 37 ºC.
To determine the proportion of vtag2GFP infected cells GFP expression was detected at 16 hpi by flow cytometry using triplicates. Briefly, cells were harvested, washed with FACS buffer (PBS, 0.01% sodium azide, and 0.1% BSA) and fixed with paraformaldehyde 4% in PBS for 10 min. After extensive washing with FACS buffer, 2x104 cells were scored
and analyzed in a FACSCalibur flow cytometer (BD Sciences) per experimental condition in triplicates. To determine VACV virus titres, HaCaT and HaCaT STAT1 KO cells were previously stimulated for 48 h or not with 150 µM 4-OI and then infected with VACV-WR using 0.1 or 0.01 pfu/cell at 37 ºC. At 24 hpi, cells were harvested in their own media, centrifuged at 1,800 × g for 5 min, and resuspended in 0.5 ml of fresh medium. In all cases, samples were frozen, thawed three times and titrated using duplicates in BSC-1 cells. Briefly, preconfluent monolayers of BSC-1 cells were infected with 10-fold serial dilutions of viral inoculums for 1h at 37ºC. Then, inoculum was replaced with semi-solid carboxy-methyl cellulose (Sigma) media with 2 % FBS and cells fixed in 10 % formaldehyde at 3 dpi. Plaques were stained with 0.1% (w/v) crystal-violet. Two independent experiments were performed.
Zika Virus infections.
A549 cells (kind gift from G. Kochs, Freiburg) and Huh-7 were cultured at 37°C in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% FCS and 2mM L-Glutamine. Cells were seeded in 24 well plates and pre-treated with 4-octyl-itaconate (4-OI) (150uM) for 48h. Cells were infected with ZIKV (moi 0.1) for 1h. 4-OI was freshly added when the medium was changed.Cells were lysed and total RNA was extracted at 96hpi using the QIAshredder (Qiagen) and RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. RNA was reverse transcribed using SuperScript II Reverse Transcriptase (Invitrogen) into cDNA that was then used for qPCR with SYBR green PCR kit (Life Technologies). CT values were normalized to GAPDH (ΔCT). SYBR green primer probes used include GAPDH (for: CATGGCCTTCCGTGTTCCTA, rev: CCTGCTTCACCACCTTCTTGA) and ZIKV (for: CGAGGAACATCCAGACTC, rev: ATTGGAGATCCTGAAGTTCC).
SARS-CoV2 TCDI50% assay
The assay was performed as follows. 2 x 104 Vero E6 TMPRSS2 cells were seeded in 90ul DMEM (Gibco, + 2% FCS (Sigma-aldrich) + 1% Pen/Strep (Gibco) + L-Glutamine (Sigma-Aldrich) per well in flat-bottom 96-well plates. 24h after, samples were titrated onto the cells by addition of 10ul of a 10-fold serial dilution. One full plate was used per sample analyzed. Each dilution of supernatant were represented 8 times on a plate. The cells were incubated for 72h in a humidified CO2 incubator at 37 ˚C, 5% CO2, before fixing with 5% Formalin (Sigma-Aldrich) and staining with crystal violet solution (Sigma-Aldrich). Images were taken using a Leica DMi1, microscope with a Leica MC170 HD camera. TCDI50 % virus titer calculated by Reed-Muench method.
Western blot.
HaCat cells were lysed in 100 mL of ice-cold Pierce RIPA lysis buffer (Thermo Scientific) supplemented with 10 mM NaF, 1x complete protease cocktail inhibitor (Roche) and 5 IU.mL-1 benzonaze (Sigma), respectively. Protein concentration was determined using a BCA protein assay kit (Thermo Scientific). Whole-cell lysates were denatured for 3 min at 95°C in presence of 1x XT Sample Buffer (BioRad) and 1x XT reducing agent (BioRad). 10-40 mg of reduced samples was separated by SDS-PAGE on 4-20% Criterion TGX precast gradient gels (BioRad). Each gel was run initially for 15 min at 70V and 45 min at 120V. Transfer onto PVDF membranes (BioRad) was done using a Trans-Blot Turbo Transfer system for 7 min. Membranes were blocked for 1h with 5% skim-milk (Sigma Aldrich) at room temperature in PBS supplemented with 0.05% Tween-20 (PBST). Membranes were fractionated in smaller pieces and probed overnight at 4°C with any of the following specific primary antibodies in PBST: anti-Nrf2 (12721, Cell Signaling 1:1000), anti-TBK1/NAK (3013, Cell Signaling 1:1000), anti-phospho-TBK1/NAK (5483, Cell Signaling 1:1000), anti-SQSTM1/p62 (8025, Cell Signaling 1:1000), anti-IRF3 (11904, Cell Signaling 1:1000), anti-phospho-IRF3 (4947, Cell Signaling 1:500), anti-HO-1 (5853, Cell Signaling 1:1000), anti-IFIT1 (14769, Cell Signaling 1:1000), anti-NRF2 (12721, Cell Signaling 1:1000), anti-STING (13647, Cell Signaling 1:1000), anti-NqO1 (3187, Cell Signaling 1:1000), and anti-Vinculin (18799, Cell Signaling 1:1000) used as loading control. After three washes in PBST, secondary antibodies, peroxidase-conjugated F(ab)2 donkey anti-mouse IgG (H+L) (1:10000) or peroxidase-conjugated F(ab)2 donkey anti-rabbit IgG (H+L) (1:10000) (Jackson ImmunoResearch) were added to the membrane in PBST 1% milk for 1h at room temperature. All membranes were washed three times and exposed using either the SuperSignal West Pico PLUS chemiluminescent substrate or the SuperSignal West Femto maximum sensitivity substrate (ThermoScientific) and an Image Quant LAS4000 mini imager (GE Healthcare).
Semi-native WB Dimerization assay.
IRF3 dimerization was assayed under semi-native conditions. Cells were lysed in ice-cold Pierce RIPA lysis buffer (Thermo Scientific) supplemented with 10 mM NaF, 1x complete protease cocktail inhibitor (Roche) and 5 IU/mL benzonaze (Sigma). Protein concentration was determined using a BCA protein assay kit (Thermo Scientific). Whole-cell lysates were mixed with 1x XT Sample Buffer (BioRad); samples were neither reduced nor heated before separation was done on 4-20% Criterion TGX precast gradient gels (BioRad) by SDS-PAGE electrophoresis. Each gel was run initially for 15 min at 70V and 15 min at 120V. Transfer onto PVDF membranes (BioRad) was done using a Trans-Blot Turbo Transfer system for 7 min. Membranes were blocked for 1h with 5% skim-milk (Sigma Aldrich) at room temperature in PBS supplemented with 0.05% Tween-20 (PBST). Membranes were probed overnight at 4°C with the following specific primary antibody in PBST: anti-IRF3. After three washes in PBST, secondary antibodies, peroxidase-conjugated F(ab)2 donkey anti-rabbit IgG (H+L) (1:10000) (Jackson Immuno Research) were added to the membrane in PBST 1% milk for 1h at room temperature. All membranes were washed three times and exposed using either the SuperSignal West Pico PLUS chemiluminescent substrate or the SuperSignal West Femto maximum sensitivity substrate (Thermo Scientific).
qPCR analysis.
Gene expression was determined by real-time quantitative PCR, using TaqMan detection systems (Applied Biosciences). RNA was extracted using the High Pure RNA Isolation kit (Roche) and RNA quality was assessed by Nanodrop spectrometry (Thermo Fisher). RNA levels were analyzed using premade TaqMan assays and the RNA-to-Ct-1-Step kit according to the manufacturer’s recommendations (Applied Biosciences).
Transcriptome analysis COVID19
COVID19 data set analysis (Fig. 1): RNA-seq data was obtained from an already available dataset from Blanco-Melo (doi: https://doi.org/10.1101/2020.03.24.004655). From the raw read-counts differential expression values were calculated using DESeq2(10). Significantly differentially expressed genes (SDEGs) were selected based on the thresholds of adjusted P-value <0.05 and absolute fold change of 2 (Fig. 1A). In order to focus on commonality across the different conditions with respect to generating clinically relevant hypotheses, the 815 SDEGs obtained from the biopsy sample were checked if these were also present in the list of SDEGs in the other conditions. All genes that occur in at least 3 or more other conditions were included in the final list, resulting in 113 genes. Finally, the expression values for all genes in the final list across all conditions were assembled, clustered using Euclidean distance metric and Ward’s variance minimization algorithm, and visualized as a heatmap using Python3.7 and seaborn cluster-map tools. Then the gene-sets from each of the outlined clusters were used for pathway enrichment analysis using Enrichr (Fig. 1B) (11). Finally, the STRING database(12) was used to construct the cloud network starting from lists of genes manually annotated for NRF2, inflammation and IFN signaling. Edges and nodes were extracted from STRING and imported to Cytoscape (13) version 3.7 for further visualization (Fig. 1D).
Transcriptome analysis of HSV1-infected HaCaT cells
RNA sequencing was performed in collaboration with BGI Europe Genome Center (Copenhagen, Denmark) following the standard operational procedure as described before(14). Briefly, the quality of total RNA was checked using the Agilent 2100 bioanalyzer. To construct the sequencing library for MGIseq-2000, approximately 1 μg of polyA enriched RNA was used for library construction using the MGIEasy RNA Directional Library Prep Kit (MGI Tech). Next, paired-end sequencing with 100 cycles was performed using the MGISEQ-2000 sequencing instrument, according to the manufacturer’s instructions. We generated an average of 63 million raw reads for each sample. The clean RNA reads were first aligned to the hg19 UCSC RefSeq (RNA sequences, GRCh37) using bowtie2 at first. To map the transcripts from the viruses, the unmapped reads were then aligned to the coding sequence of the human herpesvirus 1 (KOS strain). The expression of human genes and virus genes were performed by transforming mapped transcript reads to TPM using RSEM(15). The normalized expression were estimated and normalized by DEseq2. Differentially expressed genes were defined as genes with fold change over two-folds and adjusted P-value less than 0.001 using DESeq2.
Data availability
RNA sequencing files generated for analysis of HaCaT cells infected with HSV in the presence or absence of 4-OI have been deposited to the data depository database (CNGBdb, https://db.cngb.org) with the following accession number : CNP0001039.
Ethics
The project was approved by Institutional review boards at Aarhus University Hospital, by the Danish National Committee in Health Research Ethics (1-10-72-80-20) and the Danish Data protection Agency in accordance with the ethical standards of the Helsinki Declaration. Written informed consent was obtained from all study participants.
Statistical analysis.
Values were expressed as the means ± SEM. Graphs and statistics were computed using Graph Pad Prism 7. An unpaired, two-tailed Student's t-test was used to determine significance of the difference between the control and each experimental condition. P values of less than 0.05 were considered statistically significant, ***, p<0.001; **, p<0.01, and *, p<0.05.