Ability of nitrogen-fixing bacteria to alleviate drought stress in cowpea varies depending on the origin of the inoculated strain

doi:10.21203/rs.3.rs-3206317/v1

Download PDF

Research Article

Ability of nitrogen-fixing bacteria to alleviate drought stress in cowpea varies depending on the origin of the inoculated strain

https://doi.org/10.21203/rs.3.rs-3206317/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 14 Dec, 2023

Read the published version in Plant and Soil →

You are reading this latest preprint version

Background and Aims

Drought is one of the main causes of global crop decline. Plant growth-promoting rhizobacteria enhance plant tolerance to adverse environmental conditions. This study aimed to determine whether the rhizobacteria Microvirga vignae (BR 3296 and BR 3299) and Bradyrhizobium sp. (BR 3301) can maintain cowpea growth under drought stress.

Methods

We analyzed biomass, nodulation, nitrogen accumulation, and physiological traits of the inoculated plants. Rhizobacterial strains were assessed for exopolysaccharide (EPS) and indole acetic acid (IAA) production, growth, and biofilm formation in a water-stress medium induced by polyethylene glycol (PEG)-6000. The expression of genes associated with abscisic acid (ABA) biosynthesis in root nodules was also investigated.

Results

All evaluated strains were grown in a culture medium supplemented with PEG. M. vignae strains exhibited increased biofilm formation and EPS production, while Bradyrhizobium showed high IAA production. Cowpea plants inoculated with Bradyrhizobium exhibit higher levels of nodulation, biomass, and nitrogen accumulation. Conversely, M. vignae strains were more efficient at alleviating drought stress and maintaining nodulation, biomass, nitrogen accumulation, and stomatal conductance similar to well-watered plants. Drought-inducible genes were more strongly upregulated in the nodules of plants inoculated with Bradyrhizobium than in those inoculated with M. vignae.

Conclusion

Our results suggest that M. vignae strains, isolated from a semi-arid region, help plants withstand water-stress, whereas the strain of Bradyrhizobium sp. isolated from a wet region did not effectively alleviate drought stress. However, Bradyrhizobium sp. conferred growth and nitrogen accumulation to cowpea superior to M. vignae and like plants supplied with nitrogen fertilizer.

Vigna unguiculata

Drought stress

Rhizobacteria

PGPR

Microvirga

Bradyrhizobium

Crop yields are consistently influenced by environmental conditions, with drought being a severe constraint that hinders growth and limits agricultural productivity worldwide (Bouremani et al. 2023). More than 50% of the Earth's surface is arid, semiarid, or subjected to drought stress (Arzanesh et al. 2011). Climate change is expected to exacerbate this scenario, posing a challenge to global food security (Chaudhry and Sidhu 2022). Consequently, there is a pressing need to develop strategies to adapt to these conditions, including the use of bioinoculants in agriculture. The United Nations adopted 17 Sustainable Development Goals in 2015 as a universal call to action, aiming to eradicate poverty, protect the planet, and foster peace and prosperity by 2030 (UN 2015). These interconnected goals acknowledge that actions in one area can create ripple effects on others; they emphasize the importance of promoting social, economic, and environmental sustainability within development efforts. By exploring the role of nitrogen (N₂)-fixing bacteria in enhancing crop resilience to drought stress, this research contributes to the broader objectives of achieving food security and mitigating climate change.

Cowpea (Vigna unguiculata (L.) Walp.) is a legume of significant social and economic importance, particularly in tropical and subtropical regions such as Africa and South America (Xiong et al. 2016). Brazil is a major global producer of cowpeas, with a cultivation output of approximately 629.3 thousand tons of grains (CONAB 2022). Cowpea production in Brazil is primarily concentrated in the semi-arid regions of the northeast. Although cowpeas are considered drought-tolerant, water deficits during the early vegetative stages can negatively affect their morphological and physiological traits, ultimately affecting biological nitrogen fixation (BNF) and grain yield (Munjonji et al. 2018; Ayalew and Yoseph 2022; Lumactud et al. 2022).

Plant growth-promoting rhizobacteria (PGPR) offer a promising biotechnological approach for mitigating the effects of abiotic stress on various crops (Bittencourt et al. 2023; Cao et al. 2023). Microbial communities sourced from specific environments, such as semi-arid regions, adapted to drought conditions, may exhibit enhanced effectiveness in assisting plants to cope with water deficits (Shirinbayan et al. 2019; Shet and Garg 2022; Braga et al. 2022). The genus Microvirga belongs to the Methylobacteriaceae family and comprises bacteria that have been isolated from several environments, including arid and desert soils (Veyisoglu et al. 2016; Du et al. 2022), as well as the root nodules of different legume host plants (Ardley et al. 2012; Msaddak et al. 2019; Mouad et al. 2020). M. vignae is an N₂-fixing bacterium that was isolated from cowpea nodules in a semiarid region of Brazil (Radl et al. 2014). This strain has been evaluated as an inoculant in field experiments and has demonstrated promising performance (Marinho et al. 2014; Xavier et al. 2017). Bradyrhizobium strains can also be used for plant growth promotion under water-deficit stress conditions, with promising results for lupin (Egamberdieva et al. 2017), peanut (Barbosa et al. 2018; Cesari et al. 2019), and soybean (Silva et al. 2019; Cerezini et al. 2020; Ashwin et al. 2023). Bradyrhizobium has long been used to alleviate water-restriction effects (Figueredo et al. 1999), and Bradyrhizobium associated with salicylic acid (de Andrade et al. 2021) or co-inoculated with Azospirillum (Nonato et al. 2022) is the most efficient strategy for mitigating water shortage effects on cowpea plants.

The present study was conducted to assess the ability of Microvirga vignae isolated from semi-arid soil and Bradyrhizobium sp. isolated from Amazonian soil to alleviate the negative impacts of drought stress in cowpea plants.

2.1 Characteristics of the rhizobacteria strains

Microvirga vignae is aerobic, Gram-negative, shown fast-growth in culture medium (Martins et al. 1997). The strains used in this study (BR 3299 and BR 3296) are a symbiotic N₂-fixing bacteria isolated from the cowpea nodules collected from a semi-arid area known as the Drought Polygon located at the Northeast Region of Brazil (Radl et al. 2014; Zilli et al. 2015). The annual precipitation and mean temperature in this region are 483.9 mm and 25–26°C (Radl et al. 2014).

Bradyrhizobium is aerobic, Gram-negative, and slow-growing bacteria found in root-nodules of leguminous plants (Jordan 1982). The Bradyrhizobium sp. strain BR 3301 (INPA 03-11B syn SEMIA 6463) is approved since 2006 as commercial inoculant for cowpea crops in Brazil (Soares et al. 2006; Brasil 2011). The strain BR 3301 was grouped in the same cluster as Bradyrhizobium elkanii in the recA phylogenetic tree and has a partial 16S rDNA sequence similar to 98% of B. elkanii accession AF208510 (Soares et al. 2006; Guimarães et al. 2015). However, recent genome sequence data revealed that BR 3301 strain belongs to a new species of Bradyrhizobium (FMS Moreira, personal communication, July 10, 2023). Strain BR 3301 was previously isolated from soil of the Amazon region, with the Centrosema sp. as a host-plant (Guimarães et al. 2015; Embrapa 2021). The Amazon region is located in the equatorial zone and is characterized by a humid climate and high temperatures with values over 2,000 mm y^− 1 of precipitation and 26–28°C of mean annual temperature (Marengo et al. 2018). All strains were provided by Johanna Döbereiner Biological Resource Center (https://www.embrapa.br/agrobiologia/crb-jd) at Embrapa Agrobiology.

2.1 In vitro osmotic tolerance of strains

2.1.1 Cell growth under simulated drought stress

The potential of the strains to growth under drought stress was evaluated using TY (Tryptone-Yeast) culture medium with three different water potentials (0.0 MPa, -0.2 MPa and − 1.0 MPa) prepared by adding 0%, 10% and 30% respectively of polyethylene glycol (PEG)-6000 (Michel and Kaufmann 1973). Previously pre-inoculum was prepared in TY culture medium and 108 bacteria cells were inoculated in TY medium with different concentrations of PEG-6000 at 30°C, 180 rpm for 24 hours. The bacterial growth in simulated drought conditions was estimated by optical density at 600 nm (OD600) using a spectrophotometer (Kasuaki IL-592) and the results were expressed as OD units.

2.1.2 Biofilm formation under simulated drought stress

Bacterial strains were incubated in 96-well with the culture medium YM (Yeast Mannitol) prepared by added 0% or 10% of PEG-6000 (equivalent to 0.0 and − 0.2 MPa osmotic potential, respectively) for 24 h, at 30°C, 180 rpm. The broth was discarded, and five washes were performed with 200 µL sterile ultrapure water. The plates were dried at room temperature and 150 µL of violet crystal 1% was added to each well to stain for 45 min. The plates were again washed and dried as described above. At this point, the purple coloration of the walls can be observed, indicating the formation of biofilm. Absolute ethanol (200 µL) was added to each well for eluting the violet crystal present in the biofilm. After 1 minute, the optical density at 560 nm (OD560) was measured at microplate reader (Zenyth 200st).

2.1.3 Exopolysaccharide production

Bacterial strains (BR 3296, BR 3299 and BR 3301) were cultivated during three days at liquid culture medium YM added 2% or 10% of glucose in pH 6.8 at 30°C, 180 rpm. Exopolysaccharide (EPS) was extracted from cell cultures by centrifugation at 10,000 g for 20 min at 4°C. The supernatant was collected and stored at -20°C for 4 days to the EPS precipitation. After this time, the solution was centrifuged at 10,000 g for 15 min at 4°C and the precipitate was resuspended in 1 mL of sterile ultrapure water. The EPS was quantified by the colorimetric method for sugar determination according to the modified Dubois et al. (1956). In 0.5 mL of the sample was added 0.5 mL of 5% phenol solution and 2.5 mL of sulfuric acid. The sample was kept at room temperature for 20 min and the OD490 was measured by a spectrophotometer (Kasuaki IL-592). Glucose standard solution curve (0.1%) was used at the following concentrations: 20, 40, 60, 80 and 100 µg mL^− 1.

2.2 Indole acetic acid production

Indole acetic acid (IAA) production by the strains (BR 3296, BR 3299 and BR 3301) was evaluated in the YM culture medium with 25 µg mL^− 1 of L-tryptophan. An inoculum of 10⁸ cells of each bacteria strain was cultivated at 30°C, 180 rpm for three days. Cell suspension was centrifuged at 5,000 rpm for 10 min. 150 µL of the supernatant was collected and 100 µL of Salkowski's reagent was added. The microplate was shaken and incubated in the dark for 30 min. IAA quantification was performed by OD540 using the spectrophotometer (Zenyth 200st). The standard curve was plotted using 25, 100, 300, 500 and 600 µg mL^− 1 of the synthetical IAA.

2.3 Greenhouse experiment

2.3.1 Experimental setup

Two experiments were carried out at the same time and arranged close together in a greenhouse under controlled temperature and natural lighting at Embrapa Agrobiologia in Seropedica, Rio de Janeiro State, Brazil. In both experiments, a randomized block design with four replicates was employed.

In Experiment I, used to assess nodulation, dry mass, N accumulation and physiological parameters, the cowpea seeds were single inoculated with each strain of M. vignae (BR 3299 or BR 3296) or Bradyrhizobium sp. strain (BR 3301) and compared with plants fertilized with mineral nitrogen (N) in two water regimes. Experiment II, used exclusively for RT-qPCR assay, had the same experimental design of the Experiment I, but without the mineral N treatment, therefore was composed of three rhizobacteria inoculations and two water regimes. BRS Guariba cowpea cultivar was used in the experiments, a moderately tolerant to drought cultivar (Vilarinho et al. 2007). Seeds were surface sterilized with 70° ethanol for 30 seconds and 1% sodium hypochlorite (NaClO) solution for 3 min, followed by successive washes with autoclaved distilled water. For inoculation, 0.5 mL of YM inoculant containing only one of each bacteria strain, with 108 CFU mL^− 1, was deposited over each seed by an automatic pipettor. Five seeds were sown in 2.0 Kg pots containing sand:vermiculite (2:1) sterile substrate, and later the seedlings were thinned to two per pot. The plants were supplied by nutrient solution lacking N (Pacheco et al. 2017), except in the mineral N treatment that received the equivalent to 60 kg N ha-1 as (NH₄)₂SO₄ (ammonium sulfate). Nutrient solution was provided at 7, 21 and 35 DAE (Days After Emergence).

2.3.2 Drought stress application

The field-capacity of each pot was considered as the total weight of the set: pot + substrate + water (retained by the substrate after saturation and consequent action of gravity, until the cessation of drainage). The irrigation was controlled through the daily weighing of the pots with subsequent replacement of the evapotranspiration water in the period, keeping the pots close to the field capacity. In the 38 DAE, the pots were split into two groups: well-watered and water-restriction. The drought stress (water-restriction treatment) was imposed by the total suspension of the water supply for 12 consecutive days. Plants that were not submitted to the water restriction regime (well-watered treatment) continued to be normally irrigated with distilled water until the end of the experiment.

2.3.3 Plant sampling and analyzes (Experiment I)

Plants were harvested at 50 DAE. On the last day of the drought stress was measured the plants chlorophyll contents and stomatal conductance. Plant samples were collected for the measurements of dry biomass of plants and shoot N contents. Shoot and roots were separated by a cut at the level of cotyledon. Roots were washed and nodules detached and counted. Samples were dried at 65°C until they reached constant weight. Shoot N content was measured by the semi-micro Kjeldahl method. Shoot N accumulation was obtained by the product of N content and the respective shoot dry mass.

2.3.4 Measurements of physiological parameters (Experiment I)

Leaf chlorophyll was performed with the portable chlorophyll meter Falker ClorofiLOG® (model CFL1030-Falker, Brazil). The device is widely used to measure, in an instantaneous, indirect, and non-destructive way, chlorophyll levels based on the leaf optical properties. According to the manufacturer's protocol (Falker 2008), the ClorofiLOG quantifies of the chlorophyll index determined by the light flux transmitted by the leaf, through three wavelengths (λ) of different absorbances: =635 and 660 nm (red band) and = 880 nm (infrared band). Finally, the chlorophyllometer indicates the Falker Chlorophyll Index (FCI), directly proportional to the absorbance of chlorophylls.

Stomatal conductance was measured using a hand-held SC-1 steady-state leaf porometer (Decagon Devices, Pullman, WA, US), calibrated according to standard manufacturer's procedure (Decagon devices 2006). The device calculates stomatal conductance from the relative humidity gradient of the leaf. The porometer was previously calibrated using a known value of conductance from a filter paper moistened with distilled water. Before use, the device was left in equilibrium with the room temperature for about 10 minutes and between each measurement, the porometer chamber was opened to eliminate any residual humidity.

In both analyses, the leaf chlorophyll and stomatal conductance were made six readings per pot (three in each plant) on different leaves and the mean of these readings were considered as the final data of each plot.

To determine the relative water content (RWC) three leaf discs (28.3 mm²) were detached with a paper punch, totaling 84.9 mm² leaf^− 1 of sample composed of green tissue by leaf. The leaf segments were immediately weighed to determine the fresh weight, then, transferred to 1.5 mL microtubes and immersed in distilled water for 24 h in the dark at room temperature. These wet leaf discs were rapidly blotted to remove surface water and weighed to obtain turgid weight. Finally, the segments of leaf were dried in an oven for 72 h at 65°C and weighed again to determine the dry weight. The RWC was calculated by the formula, according to Zegaoui et al. (2017):

% RWC = [(FW – DW) ÷ (TW – DW)] x 100

Where: FW = fresh weight of leaf discs; DW = dry weight of leaf discs; TW = turgid weight of leaf discs

All physiological parameters readings were performed from 8:00 to 10:00 a.m in the mid-section of fully developed leaf blades. The chosen leaves were clean, intact, with no apparent disease or damage and receiving natural sunlight.

2.4 RT-qPCR assay (Experiment II)

The experiment was conducted in triplicate for every four biological replicates of each rhizobacteria strain. Total RNA from the nodules was extracted using Trizol reagent (Invitrogen®) and followed the manufacturer's protocol. Concentration and RNA purity was determined by spectrophotometry using the NanoDrop 2000-2000C (Thermo Scientific, DE, USA). The integrity of the extracted total RNA was evaluated by non-denaturing agarose gel electrophoresis (1.5%). RNA was treated with DNase and 5 µg was used for cDNA synthesis using the SuperScript III Reverse Transcriptase™ enzyme (Invritrogen®). Synthesized cDNA samples were quantified using Qubit® with the ssDNA Assay Kit (Invitrogen, Cat. No. Q10212). RT-qPCR reactions were performed on a 7500 fast real-time PCR system (Applied Biosystems) using the GoTaq® qPCR Master Mix, 2X kit (Promega, Madison, WI, USA). Raw data obtained were entered in the online Miner software (Zhao and Fernald 2005) to obtain the values of cycle threshold (Ct). Ct values were then used by the qBASE Software v.1.3.5 (Hellemans et al. 2007) to calculate the relative expression of each gene. The primers sequences for all genes are listed in Table 1.

Table 1

Primer sequences used in RT-qPCR assay to evaluate the relative expression of drought-related genes in nodules of cowpea inoculated with the strains BR 3296 or BR 3299 (*Microvirga vignae*) or BR 3301 (*Bradyrhizobium* sp) and submitted to two water regimes treatments.
Gene ID	Molecule encoded	Function	Sequence (5’- 3’)	Amplicon length (bp)	Efficiency
VuNCED1	9-cis-epoxicarotenoide dioxygenase	ABA biosynthesis	CGAAGACGATTTACCCTACCAC GAGGTAAGGCTTCTGAATGACG	144	1,78 ± 0,010
VuCPRD65	9-cis-epoxicarotenoide dioxygenase	ABA biosynthesis	GTTTGTGCTTCCACCTCTGG GCACGCTCTTCAAACTCTCC	144	1,84 ± 0,005
VuCPRD12	Nonmetallo-short-chain alcohol dehydrogenase	ABA-dependent induction	AACTGTGTGTCCCCTTTTGC CAGCTTCTGCCACATCGTTA	258	1,82 ± 0,006
VuPDF2*	Regulatory subunit of protein phosphatase	Reversible dephosphorylation of proteins	CATTGTTGAGCTTGCTGAGG GAGCACCAAGCTTGTCATCA	100	2.08 ± 0.007
VuYLS8*	Mitotic protein	Involved in pre-mRNA splicing	CTGGTGGACATAACGGAGGT GTTGTTTCCAGTGCCGAGAT	100	2.07 0.007
* Reference genes

The genes VuPDF2 (protein phosphatase regulatory subunit) and VuYLS8 (mitotic protein) were used as reference genes (da Silva et al. 2015) and significant differences in expression were estimated by the standard deviation values. Three drought-related genes were evaluated: i) VuNCED1, which encodes the 9-cis-epoxycarotenoid dioxygenase, a key enzyme involved in abscisic acid (ABA) biosynthesis under drought stress; ii) VuCPRD65, a cowpea responsive to dehydration gene that is homology with the 9-cis-epoxycarotenoid dioxygenase; iii) VuCPRD12, a cowpea responsive to dehydration gene, dependent to ABA and which encode putative proteins related to non metallo-short-chain alcohol dehydrogenase.

2.5 Statistical analysis

Data from in vitro tests and Experiment I represent means using analysis of variance (ANOVA) from four repetitions. Assumptions of normality and of homoscedasticity were verified using the Shapiro Wilk test. Statistical analyses were performed using the STATISTICA Software (Stat Soft Inc. 2004), version 10, and significant differences between treatments were assessed by applying the Fisher test (p ≤ 0.05).

In the Experiment II, significant differences were determined by estimation of the standard error and also using the REST software version 2.0.7 (p < 0.05) which performs a Pair Wise Fixed Reallocation Randomization Test (bootstrap = 2000 permutation as default) to obtain p values (Pfaffl et al. 2002) (http://www.gene-quantification.info).

3.1 In vitro assay with bacterial strains

3.1.1 Bacterial growth under simulated drought stress

All tested strains demonstrated the ability to grow in a culture medium supplemented with polyethylene glycol (PEG), which induced osmotic stress. However, their survival and growth rates were influenced by increasing concentrations of PEG, indicating a decline in viability under high osmotic stress conditions (Fig. 1). Notably, Bradyrhizobium BR 3301 displayed slower growth than the two Microvirga strains, as evidenced by its lower optical density at 600 nm. Moreover, strain BR 3301 exhibited the lowest tolerance to osmotic stress among the tested strains, with a decrease in growth of 61% and 69% under osmotic pressures of -0.2 and − 1.0 MPa, respectively, compared to the control (Fig. 1). In contrast, M. vignae strains (BR 3296 and BR 3299) demonstrated higher osmotic tolerance than strain BR 3301. When subjected to osmotic stress conditions of -0.2 MPa and − 1.0 MPa, strain BR 3296 presented a growth decline of 26% and 63%, respectively, while strain BR 3299 exhibited a decrease of 31% and 62% in growth, respectively, compared to the control condition of 0.0 MPa (Fig. 1).

3.1.2 Biofilm formation and exopolysaccharide (EPS) production

Strain BR 3301 exhibited the highest biofilm production when cultivated in culture medium without PEG. However, biofilm production significantly declined when the strain BR 3301 was exposed to 10% PEG. In contrast, BR 3299 showed a drastic increase in biofilm production under osmotic stress. Strain BR 3296 did not show a significant increase in biofilm production when grown in 10% culture medium supplemented with PEG (Fig. 2a).

At a low glucose concentration (2%), all three strains produced similar levels of EPS. However, under 10% glucose, there was an approximately 2.7-fold increase in EPS production in M. vignae BR 3296 and a 2.1-fold increase in M. vignae BR 3299. In contrast, no change in the levels of secreted EPS was observed in Bradyrhizobium BR 3301 (Fig. 2b).

3.1.3 Indole acetic acid (IAA) production

All strains demonstrated the ability to produce IAA in the culture medium supplemented with 25 µg mL^− 1 of L-tryptophan as a precursor (Fig. 3). However, the Bradyrhizobium strain exhibited higher IAA production, with 1.4-to 1.8-fold higher amounts compared to M. vignae strains BR 3296 and BR 3299, respectively (Fig. 3).

3.2 Greenhouse experiments

3.2.1 Nodulation

There was no significant difference in the number of nodules between plants subjected to well-watered conditions and those subjected to water restriction. However, under well-watered conditions, cowpea plants inoculated with BR 3296 or BR 3301 exhibited a higher number of nodules than those inoculated with BR 3299. Under water-restricted conditions, only plants inoculated with BR 3296 showed a higher number of nodules than those inoculated with BR 3299 (Table 2).

Table 2

Nodule number and nodule dry weight of cowpea inoculated with the strains BR 3296 or BR 3299 (*Microvirga vignae*) or BR 3301 (*Bradyrhizobium* sp) and submitted to two water regimes treatments.
Treatment	Nodule number			Nodule dry weight
	------------ plant^− 1 -----------			------------- mg plant^− 1 --------------
	WW^b	WR	Mean	WW	WR	Mean
BR 3296	84 a^a	73 a	79 a	861,7 A a	584,2 B a	723,0 a
BR 3299	59 b	49 b	54 b	376,7 A b	398,0 A b	387,3 b
BR 3301	82 a	60ab	71 a	786,0 A a	544,2 B a	665,1 ab
Mean^c	75 A	61 A		674,8 A	508,8 B
^aMeans followed by equal letters, uppercase letters on the line and lowercase letters on the column do not differ by the 5% Tukey test. Data are means of n = 4 biological replicates.
^bWW and WR represent the well-watered and water-restriction treatments, respectively.
^cMineral N treatment was excluded from the statistical analysis because there was no root nodules.

The overall mean nodule dry mass decreased under the water-restricted treatment (Table 2). This decrease was primarily driven by a reduction in nodule mass in plants inoculated with BR 3296 and BR 3301. However, even under water-restricted conditions, plants inoculated with these strains exhibited higher nodule mass than plants inoculated with strain BR 3299 in both water regimes. Interestingly, plants inoculated with BR 3299 had the lowest nodulation, but the results indicated that the nodule dry mass in these plants did not decrease when subjected to water restriction and remained similar to that of the non-stressed plants (Table 2). This suggests that BR 3299 may possess certain mechanisms that enable it to maintain nodule functionality and biomass under water-restricted conditions, thereby providing a level of resilience to drought stress. Further investigation of the specific characteristics of BR 3299 could help elucidate the potential mechanisms of drought tolerance in relation to nodulation and nodule dry mass.

3.2.2 Root and shoot biomass and N accumulation

Cowpea plants inoculated with rhizobacteria did not surpass the root and shoot dry matter obtained from plants fertilized with mineral N (Table 3). There were no significant differences in root dry weight between the well-watered and water-restricted treatments. Among the three rhizobacteria evaluated, Bradyrhizobium strain BR 3301 had the highest root and shoot dry weights, followed by M. vignae BR 3296 and BR 3299, regardless of the water regime applied (Table 3).

Table 3

Root dry weight, shoot dry weight and shoot N accumulation of the cowpea inoculated with the strains BR 3296 or BR 3299 (*Microvirga vignae*) or BR 3301 (*Bradyrhizobium* sp) and submitted to two water regimes treatments.
Treatment	Root dry weight			Shoot dry weight			Shoot N accumulation
	------------ g plant^− 1 ------------			------------ g plant^− 1 -------------			------------- mg plant^− 1 -------------
	WW^b	WR	Mean	WW	WR	Mean	WW	WR	Mean
BR 3296	1,54 c^a	1,37 bc	1,41 c	4,44 A c	3,83 A c	4,14 c	132,5 A b	110,9 A b	121,7 b
BR 3299	0,99 d	0,79 c	0,89 d	2,69 A d	2,06 A d	2,38 d	100,9 A c	85,4 A c	93,2 c
BR 3301	2,24 b	1,89 b	2,06 b	6,71 A b	4,48 B b	5,60 b	205,9 A a	134,8 B a	170,4 a
Mineral N^c	3,92 a	3,41 a	3,67 a	8,34 A a	6,99 B a	7,67 a	213,2 A a	131,7 B a	172,5 a
Mean	2,17 A	1,84 A		5,55 A	4,34 B		163,1 A	123,2 B
^aMeans followed by equal letters, uppercase letters on the line and lowercase letters on the column do not differ by the 5% Tukey test. Data are means of n = 4 biological replicates.
^bWW and WR represent the well-watered and water-restriction treatments, respectively.
^cEquivalent to 60 kg N ha^− 1 as (NH₄)₂SO₄

Water restriction did not affect the shoot biomass of plants inoculated with M. vignae strains BR 3296 or BR 3299, as these plants under drought stress did not differ significantly from well-watered plants. In contrast, well-watered plants from the N-fertilized treatment or those inoculated with strain BR 3301 produced a large amount of shoot biomass, but the growth of these plants significantly decreased under stressful water conditions (Table 3). Plants that were N-fertilized or inoculated with strain BR 3301 displayed the highest root and shoot dry weights and N accumulation under drought conditions, followed by strains BR 3296 and BR 3299 (Table 3).

The highest N accumulation in the shoots was observed in the control plants under mineral N and in plants inoculated with strain BR 3301, regardless of the water regime. However, when plants inoculated with BR 3301 or fertilized with mineral N were subjected to water restriction, N accumulation significantly decreased. Contrastingly, plants inoculated with strains BR 3296 or BR 3299 did not differ in N accumulation when subjected to water shortage conditions (Table 3).

3.2.3 Plant physiological parameters

Regardless of the treatment, all plants under well-watered conditions displayed higher chlorophyll content than the drought-stressed plants. However, plants subjected to water restriction and inoculated with any rhizobacterial strain had a higher chlorophyll content than control plants fertilized with mineral N. Overall, the inoculated plants had higher chlorophyll content than the N-fertilized plants (Table 4).

Table 4

Total chlorophyll, stomatal conductance, and relative water content in the leaves of the cowpea inoculated with the strains BR 3296 or BR 3299 (*Microvirga vignae*) or BR 3301 (*Bradyrhizobium* sp) and submitted to two water regimes treatments.
Treatment	Total chlorophyll			Stomatal conductance			Relative water content
	-------------- FCI^d --------------			---------- mmol m^− 2 s^− 1 ----------			----------------- % ----------------
	WW^b	WR	Mean	WW	WR	Mean	WW	WR	Mean
BR 3296	55.8 ^a	45.6 a	50.7 a	89 A b	66 A ab	77 b	91	78 a	84
BR 3299	52.9	44.6 a	48.8 a	96 A b	80 A a	88 b	90	68 b	79
BR 3301	56.2	47.2 a	51.7 a	169 A a	56 B b	112 a	96	71 b	84
Mineral N^c	53.0	30.1 b	41.5 b	154 A a	47 B b	101 a	97	68 b	83
Mean	54.4 A	42.8 B		127 A	62 B		93 A	71 B
^aMeans followed by equal letters, uppercase letters on the line and lowercase letters on the column do not differ by the 5% Tukey test. Data are means of n = 4 biological replicates.
^bWW and WR represent the well-watered and water-restriction treatments, respectively.
^cEquivalent to 60 kg N ha^− 1 as (NH₄)₂SO₄
^dFalker chlorophyll index

Plants inoculated with Bradyrhizobium strain BR 3301 and fertilized with mineral N showed the highest rates of stomatal conductance under well-watered conditions. In contrast, under water-restricted conditions, plants inoculated with M. vignae strain BR 3299 exhibited better stomatal conductance than those inoculated with strain BR 3301 or mineral N treatments. Water restriction significantly decreased stomatal conductance, except in plants inoculated with M. vignae strains BR 3296 or BR 3299, which showed stomatal conductance levels closer to those of well-watered plants (Table 4).

Well-watered plants showed higher relative water content in the leaves than plants under water-restricted conditions. In the overall mean and well-watered treatments, there were no significant differences in leaf relative water content between plants inoculated with rhizobacteria or fertilized with mineral N. Plants under water restricted conditions and inoculated with BR 3296 had a higher relative water content compared to other treatments (Table 4).

3.2.4 Expression pattern of drought-related genes in cowpea nodules

As expected, the stress-related genes were upregulated in the nodules from cowpeas grown under water-restricted conditions (Fig. 4). In plants inoculated with Bradyrhizobium sp. strain BR 3301, the expression of VuNCED1, VuCPRD65, and VuCPRD12 was higher than that in plants inoculated with M. vignae strains BR 3296 and BR 3299 (Fig. 4). Under water-restricted conditions, the expression level of the VuNCED1 transcript was induced approximately 2.5-fold in nodules from cowpeas inoculated with BR 3301. In contrast, when inoculated with BR 3296 and BR 3299, VuNCED1 expression was induced 1.9-fold and 1.5-fold, respectively. Transcript levels of VuCPRD65 exhibited a 3.9-fold increase in nodules from cowpeas inoculated with BR 3301. In contrast, nodules from plants inoculated with BR 3299 showed a milder induction of only 1.6-fold (Fig. 4). Gene expression of VuCPRD12 was significantly upregulated, showing a strong induction of approximately 17-fold in nodules from cowpeas inoculated with BR 3301. However, in nodules from plants inoculated with BR 3296 and BR 3299, VuCPRD12 expression was not induced by more than 2.5-fold, even under water-restricted conditions (Fig. 4).

Drought is a major stress factor that significantly hampers plant growth and reduces crop yield. The intensification of climate change has resulted in more frequent water restrictions, causing a significant drop in food production (Chaudhry and Sidhu 2022; Bouremani et al. 2023). In the present study, we investigated the potential of rhizobacteria, specifically Microvirga vignae (strains BR 3296 and BR 3299) and Bradyrhizobium sp. (strain BR 3301), to alleviate the adverse effects of water restriction on cowpea plants under controlled greenhouse conditions. To the best of our knowledge, this is the first study to explore species from the Microvirga genus as PGPR to enhance drought tolerance in plants. Furthermore, the potential of Bradyrhizobium sp. strain BR 3301, commonly employed as an inoculant for cowpea in Brazil, to mitigate the adverse effects of water stress on crops has not been previously evaluated.

The growth rate of Bradyrhizobium sp. strain BR 3301 was slower than both strains of M. vignae, as shown in Fig. 1. Interestingly, in semi-arid regions, which are the origins of M. vignae strains, a significant proportion of bacteria isolated from cowpea nodules (up to 60%) exhibit rapid growth in culture medium, a characteristic that is not typically associated with the genus Bradyrhizobium (Jordan 1982; Martins et al. 1997). The prevalence of fast-growing rhizobia in arid regions suggests a survival strategy based on a reduction in generational intervals (Sprent 1994).

Microbial communities may shape phenotypic and genotypic responses to stress when exposed to adverse conditions. It is plausible that the high biofilm formation and EPS production exhibited by M. vignae strains (Fig. 2) contribute to their ability to withstand drought stress. The biofilm matrix, which is primarily composed of EPS, provides protection and resilience to bacteria (Vu et al. 2009). Bacterial EPS play a crucial role in providing protection against desiccation. EPS can retain significant amounts of water, and some studies have shown that it can contain up to 97% water within its polymer matrix (Naseem et al. 2018). This water-trapping property helps to create a hydrated microenvironment surrounding bacterial colonies, preventing dehydration and maintaining cell viability in challenging conditions such as drought or water-restricted environments.

One of the key traits of PGPR is their ability to produce IAA. In our study, we observed that root dry weight did not significantly change under drought conditions compared to non-stressed plants (Table 3). Similar results have been reported in pot experiments with soybeans (Marinković et al. 2019) and cowpeas (Nonato et al. 2022), where PGPR inoculation showed no significant effect on root dry weight under water stress. These findings highlight the potential of the studied rhizobacterial strains, M. vignae and Bradyrhizobium sp., to mitigate the negative effects of drought stress on root growth. The ability of PGPR to produce IAA can stimulate root development, enhance nutrient uptake, and contribute to overall plant growth. Therefore, IAA production by rhizobacteria likely plays a role in maintaining root dry weight under drought conditions. Further research is required to gain a deeper understanding of these mechanisms and their specific contributions to the observed effects of PGPR inoculation on plant growth under water-restricted conditions.

All bacterial strains in the present study produced IAA; however, Bradyrhizobium sp. strain BR 3301 secreted large amounts of IAA (Fig. 3), which may have stimulated greater root biomass accumulation in plants inoculated with this strain than in those inoculated with both M. vignae strains (Table 3). IAA-producing bacteria can modify root architecture by increasing root length, surface area, and branching formation (Fierro-Coronado et al. 2014; Grover et al. 2021), consequently enhancing nutrient acquisition and water access and promoting plant growth under abiotic stress (Gang et al. 2021; Uzma et al. 2022).

Biological N₂ fixation is the best example of the successful ecological services offered by PGPR to crops (Alves et al. 2003; Telles et al. 2023). However, drought stress impairs rhizobial survival in soil or rhizobial inoculants applied to the soil, constraining the process of nodulation and negatively affecting BNF (Munjonji et al. 2018; Lumactud et al. 2022). Surprisingly, in our experiment, the number of nodules did not differ significantly between the two water regimes, although there was a slight decrease in nodule quantity under water-shortage conditions (Table 2). Nevertheless, the nodule biomass decreased under water restriction conditions in plants inoculated with BR 3296 and BR 3301, indicating that the nodules formed under these conditions were small. This indicates that root infection and the onset of nodulation are affected by drought stress. In contrast, plants inoculated with BR 3299 maintained the same nodule dry mass in both the well-watered and water-restricted regimes (Table 2), suggesting that plants inoculated with BR 3299 compensated for stress by increasing the mass of existing nodules (Lumactud et al. 2022). Interestingly, plants inoculated with BR 3299 showed a smaller number and mass of nodules; however, they were the only plants that did not show a decrease in nodulation under water restriction treatment.

Another interesting finding was that the plants inoculated with Bradyrhizobium sp. were well nodulated and showed greater shoot biomass and N accumulation; therefore, we can assume that this strain was more efficient in providing BNF benefits to plants than the M. vignae strains. Strain BR 3301 was selected as the inoculant for cowpeas because of its high efficiency in nodulation and N₂ fixation (Soares et al. 2006). Despite the lower results in our greenhouse experiment, the strain BR 3299 of M. vignae promoted N accumulation and grain yield under field conditions, similar to treatments with mineral N or inoculations with commercial strains, including Bradyrhizobium sp. strain BR 3301 (Marinho et al. 2014; Xavier et al. 2017).

Abscisic acid (ABA) is involved in plant adaptation to various abiotic stressors. In dehydrated plants, levels of endogenous ABA increase significantly, and the accumulated ABA induces the expression of many genes that might be involved in responses to drought stress in cowpeas (luchi et al. 1996a, b; luchi et al. 2000; da Silva et al. 2012; Zegaoui et al. 2017). We analyzed the expression profiles of three genes linked to molecular stress responses in cowpea nodules, including the ABA biosynthesis genes VuNCED1 and VuCPRD65 and the ABA-dependent gene VuCPRD12. All three genes were upregulated under drought stress, with the highest induction observed in cowpea plants inoculated with BR 3301 compared to the other strains (Fig. 4). This suggests that plants inoculated with BR 3301 may exhibit greater susceptibility to water restriction than those inoculated with BR 3296 or BR 3299. Upregulation of these genes in response to drought stress has been reported in common bean (Qin and Zeevaart 1999) and cowpea (Iuchi et al. 1996a; Iuchi et al. 2000), and their expression levels are known to increase proportionally with the severity of stress perceived by the plant (Iuchi et al. 1996b; Iuchi et al. 2000).

The induction of VuNCED1, VuCPRD65, and VuCPRD12 has been reported in cowpea leaves in response to progressive dehydration (Iuchi et al. 1996a; Iuchi et al. 2000). Furthermore, the induction of these genes has been observed in cowpea nodules, suggesting that the molecular mechanisms activated in leaves during stress may also operate in nodules, contributing to the maintenance of BNF under adverse conditions (da Silva et al. 2012; da Silva et al. 2015).

The expression of drought-related genes NCED1, CPRD65, and CPRD12 and the accumulation of ABA increase proportionally with drought stress (luchi et al. 1996a, b; Qin and Zeevaart 1999; Zegaoui et al. 2017). ABA activity is directly related to stomatal movement in cowpea (Iuchi et al. 2000). Increases in ABA concentrations imply stomatal closure and, consequently, decrease in transpiration and the incorporation of CO₂ by plants, resulting in reduced plant growth (Hall and Schulze 1980; Belko et al. 2013). Plants inoculated with Bradyrhizobium strain BR 3301 exhibited a significant reduction in stomatal conductance under water-restricted conditions (Table 4). This reduction in stomatal conductance had a negative impact on biomass and N accumulation in these plants compared with well-watered plants (Table 3). However, these effects were not observed in cowpea plants inoculated with the strains of M. vignae, BR 3296 or BR 3299. There were no significant differences between the two water regimes in terms of stomatal conductance, shoot dry mass, or N accumulation. These findings are consistent with our observations of the relative expression levels of ABA- and drought-inducible genes. They provide further support for the idea that rhizobacteria isolated from semi-arid soil have the potential to alleviate the negative effects of water shortages on cowpea plants.

Despite the decrease in stomatal conductance under water-restricted conditions, the relative water content and leaf chlorophyll levels were significantly reduced (Table 4), indicating that the plants were activated by water stress and physiological changes associated with drought. An intriguing finding was that all rhizobia-inoculated plants, irrespective of the strain, showed higher chlorophyll content than the N-fed plants under water-restricted conditions. This suggests that the inoculated plants were able to maintain a healthier and greener appearance, indicating a potential enhancement in their photosynthetic rate. However, it is important to note that in our experiments, plants fertilized with mineral N consistently exhibited superior plant growth and N accumulation, regardless of the water supply conditions. This could be attributed to the repeated application of N-ammonium sulfate in the closed-pot system, which may have resulted in higher nutrient concentrations in the substrate. The ample availability of mineral N in the substrate likely contributed to the robust performance of the N-fed plants, enabling them to maintain favorable growth and nutrient uptake even under water-deficit conditions. Nevertheless, legume plants have been reported to be more resilient to drought when they establish symbiosis with rhizobia than when they are supplied with mineral N (Álvarez-Aragón et al. 2023), and this benefit tends to be more effective if rhizobia are isolated from drylands (Marulanda et al. 2009; Shet and Garg 2022).

Organisms growing in arid and semi-arid regions have developed remarkable adaptations to survive the challenging conditions prevalent in these environments. Bacteria associated with plants in such harsh habitats can be regarded as xerotolerant because they have evolved mechanisms to withstand and thrive under water restriction (Kavamura et al. 2013). Strains BR 3296 and BR 3299 of M. vignae, isolated from a semi-arid region (Radl et al. 2014), are likely to possess genetic traits that enable them to cope with water stress. These strains have likely undergone selective pressures that have shaped their genetic makeup, favoring the development of stress-tolerant characteristics (Sprent 1994). Our findings from in vitro tests, including bacterial growth in PEG-stressed medium (Fig. 1), biofilm formation, and EPS production (Fig. 2), further support this hypothesis. These results suggest that M. vignae can adapt to water stress and may contribute to the maintenance of nodulation, shoot biomass, N accumulation, and stomatal conductance in cowpea plants under water-restricted conditions, resembling the responses observed in well-watered plants. Indeed, Bradyrhizobium sp. strain BR 3301, despite being isolated from tropical soil in the Amazon rainforest (Soares et al. 2006; Embrapa 2021) where water scarcity is not a major concern, has been selected for its high efficiency in N₂ fixation. Although isolated more than 30 years ago, this strain has not lost its efficacy for nodulation and fixation of N₂, making it a recommended inoculant for cowpeas in Brazil (Brasil 2011; Guimarães et al. 2015).

Despite not being specifically adapted to water scarcity, its effectiveness in N₂ fixation may contribute to the overall performance of cowpea plants under water-restricted conditions. This can explain the good performance of cowpeas inoculated with strain BR 3301 in our experiment, as nodulation, plant growth, and N accumulation were close to those of the N-fed plants and superior to plants inoculated with M. vignae strains in both water regimes. However, regardless of this result, we cannot consider that strain BR 3301 of Bradyrhizobium sp. succeeded in relieving the drought stress on cowpeas because of the decreasing plant parameters under water-restricted conditions when compared to well-watered plants.

In summary, inoculation with M. vignae strains did not lead to significant increases in biomass and N accumulation but conferred tolerance to drought stress in cowpea plants. In contrast, plants inoculated with the BR 3301 strain of Bradyrhizobium exhibited substantial biomass and N accumulation. However, these parameters decreased when the inoculated plants were subjected to water restriction. Other PGPR traits possessed by the strains used in this study, such as siderophore synthesis, phosphorus and potassium solubilization, and ACC deaminase activity, could have influenced our results. These additional traits may have contributed to the overall plant growth and stress tolerance observed. Further investigation is needed to explore the potential mechanisms of action of these strains.

Several studies have proposed the use of PGPR consortia to improve the tolerance of legumes to abiotic stress. These consortia have been investigated in important legume crops, such as the common bean (Figueiredo et al. 2008), peanut (Cesari et al. 2019), soybean (Silva et al. 2019), and cowpea (Figueiredo et al. 1999; do Nascimento et al. 2021; Nonato et al. 2022). Additionally, the coexistence of members of the Microvirga and Bradyrhizobium genera as root nodule symbionts has been identified in various plants, including lupinus (Msaddak et al. 2017; Rejili et al. 2019), Stylosanthes capitate (Nunes et al. 2018), and cowpea (Oliveira et al. 2020; Sena et al. 2020). Based on these findings, it is possible to propose co-inoculations that combine the high N₂ fixation and IAA production abilities of Bradyrhizobium strain BR 3301 with the osmotic stress resistance and drought alleviation capacities of Microvirga vignae, with the aim of developing an ideal inoculant for enhanced plant performance under adverse conditions. Further research is warranted to explore the potential of co-inoculation for agricultural applications.

The results of this study highlight the significant influence of bacterial isolation sites on the observed outcomes. The BR 3301 strain of Bradyrhizobium sp., isolated from Amazon rainforest soil, exhibited a high N₂fixation ability and IAA production, resulting in enhanced plant growth and N accumulation in cowpeas, comparable to plants receiving mineral N fertilizer. However, these positive effects decreased under water-restricted conditions. In contrast, M. vignae strains BR 3296 and BR 3299 isolated from semiarid soil demonstrated strong osmotic tolerance, enabling them to alleviate the detrimental effects of water scarcity on cowpea plants. These strains sustained nodulation, shoot dry mass, N accumulation, and stomatal conductance at levels similar to those observed in non-stressed plants. Analysis of the relative expression of drought-and ABA-related genes supports our hypothesis. Further investigations should be conducted, including co-inoculation experiments between M. vignae and Bradyrhizobium sp. strains, as well as field trials, to evaluate the effect of these PGPR on cowpea grain yield under drought stress conditions. Such studies are crucial for addressing the challenges posed by global climate change currently taking place.

Acknowledgements We would like to thanks Dr. Jerri Zilli (curator of the Johanna Döbereiner Biological Resource Center of Embrapa Agrobiologia) and Drª. Fátima Moreira (professor of Universidade Federal de Lavras) for information on the nomenclature of Bradyrhizobium BR 3301 strain. We also thank Dr. Leonardo Medice (professor of Universidade Federal Rural do Rio de Janeiro) for providing the chlorophyllometer and porometer devices.

Author Contributions JLSA, RSP, GRX conceptualization the study and supervised the research; SSC, RSP, GC performed the experiments, collected the samples and analyzing the data; MSV assisted in the qPCR analyzes; SSC and RSP wrote the preliminary draft; JLSA reviewed the final manuscript. All authors wrote the manuscript and agreed with the submitting.

Funding Research grants from the CAPES (Coordination for the Improvement of Higher Education Personnel - Finance Code 001) and CNPq (Brazilian National Council for Scientific and Technological Development); and financial support from EMBRAPA (Brazilian Agricultural Research Corporation).

Declarations The authors declare no conflict of interests.

Álvarez-Aragón R, Manuel Palacios JM, Ramirez-Parra E (2023) Rhizobial symbiosis promotes drought tolerance in Vicia sativa and Pisum sativum. Environ Exp Bot 208:105268. https://doi.org/10.1016/j.envexpbot.2023.105268
Alves BJR, Boddey RM, Urquiaga S (2003) The success of BNF in soybean in Brazil. Plant Soil 252:1-9. https://doi.org/10.1023/A:1024191913296
de Andrade WL, de Melo AS, Melo YL, Sá FVS, Rocha MM, Oliveira APS, Fernandes-Júnior PI (2021) Bradyrhizobium inoculation plus foliar application of salicylic acid mitigates water deficit effects on Cowpea. J Plant Growth Regul 40:656-667. https://doi.org/10.1007/s00344-020-10130-3
Ardley JK, Parker MA, De Meyer SE, Trengove RD, O’Hara GW, Reeve WG, Yates RJ, Dilworth MJ, Willems A, Howieson JG (2012) Microvirga lupini sp. nov., Microvirga lotononidis sp. nov. and Microvirga zambiensis sp. nov. are alphaproteobacterial rootnodule bacteria that specifically nodulate and fix nitrogen with geographically and taxonomically separate legume hosts. Int J Syst Evol Microbiol 62:2579-2588. https://doi.org/10.1099/ijs.0.035097-0
Arzanesh MH, Alikhani HA, Khavazi K, Rahimian HA, Miransari M (2011) Wheat (Triticum aestivum L.) growth enhancement by Azospirillum sp. under drought stress. World J Microbiol Biotechnol 27(2):197-205. https://doi.org/10.1007/s11274-010-0444-1
Ashwin R, Bagyaraj DJ, Raju BM (2023) Dual inoculation with Bradyrhizobium liaoningense and Ambispora leptoticha improves drought stress tolerance and productivity in soybean cultivars, MAUS 2 and DSR 12. Biologia 78(2):331-348. https://doi.org/10.1007/s11756-022-01196-3
Ayalew T, Yoseph T (2022) Cowpea (Vigna unguiculata L. Walp.): a choice crop for sustainability during the climate change periods. J Appl Biol Biotechnol 10:154-162. https://doi.org/10.7324/JABB.2022.100320
Barbosa DD, Brito SL, Fernandes PD, Fernandes-Júnior PI, Lima LM (2018) Can Bradyrhizobium strains inoculation reduce water deficit effects on peanuts? World J Microb Biotech 34(7):87. https://doi.org/10.1007/s11274-018-2474-z
Belko N, Zaman-Allah M, Diop NN, Cisse N, Zombre G, Ehlers JD, Vadez V (2013) Restriction of transpiration rate under high vapour pressure deficit and non-limiting water conditions is important for terminal drought tolerance in cowpea. Plant Biol 15:304-316. https://doi.org/10.1111/j.1438-8677.2012.00642.x
Bittencourt PP, Alves AF, Ferreira MB, da Silva Irineu LES, Pinto VB, Olivares FL (2023) Mechanisms and applications of bacterial inoculants in plant drought stress tolerance. Microorganisms 11:502. https://doi.org/10.3390/microorganisms11020502
Bouremani N, Cherif-Silini H, Silini A, Bouket AC, Luptakova L, Alenezi FN, Baranov O, Belbahri L (2023) Plant growth-promoting rhizobacteria (PGPR): a rampart against the adverse effects of drought stress. Water 15:418. https://doi.org/10.3390/w15030418
Braga APA, Cruz JM, de Melo IS (2022) Rhizobacteria from Brazilian semiarid biome as growth promoters of soybean (Glycine max L.) under low water availability. Braz J Microbiol 53:873-883. https://doi.org/10.1007/s42770-022-00711-7
Brasil (2011) Instrução normativa n° 13 de 24 de março de 2011. Ministério da Agricultura Pecuária e Abastecimento. Diário Oficial [da] República Federativa do Brasil, 25 março de 2011. Seção 1, p.3-7. Available at: http://www.agricultura.gov.br/assuntos/insumos-agropecuarios/insumos-agricolas/fertilizantes/legislacao/in-sda-13-de-24-03-2011-inoculantes.pdf/view. Accessed 15 Jun 2023
Cao M, Narayanan M, Shi X, Chen X, Li Z, Ma Y (2023) Optimistic contributions of plant growth-promoting bacteria for sustainable agriculture and climate stress alleviation. Environ Res 217:114924. https://doi.org/10.1016/j.envres.2022.114924
Cerezini P, Kuwano BH, Grunvald AK, Hungria M, Nogueira MA (2020) Soybean tolerance to drought depends on the associated Bradyrhizobium strain. Braz J Microbiol 51:1977-1986. https://doi.org/10.1007/s42770-020-00375-1
Cesari AB, Paulucci NS, López-Gómez M, Hidalgo-Castellanos J, Lluch Plá C, Dardanelli MS (2019) Performance of Bradyrhizobium and Bradyrhizobium–Azospirillum in alleviating the effects of water-restrictive conditions during the early stages of Arachis hypogaea growth. J Plant Growth Regul 38:1362-1374. https://doi.org/10.1007/s00344-019-09939-4
Chaudhry S, Sidhu GPS (2022) Climate change regulated abiotic stress mechanisms in plants: a comprehensive review. Plant Cell Rep 41(1):1-31. https://doi.org/10.1007/s00299-021-02759-5
CONAB, Companhia Nacional de Abastecimento (2022) Monitoring the Brazilian grain harvest, Brasília, DF, v. 9, 2021/22 harvest, n.12 - twelfth survey, September 2022, 88p, ISSN 2318-6852. file:///C:/Users/rspacheco/Downloads/E-book_Boletim-de-Safras-12o-levantamento.pdf
Decagon Devices (2006) Leaf porometer. Operator’s manual. Version 1.0. Decagon Devices. Inc. Pullman, WA, US.
Du X, Ran Q, Wang J, Jiang H, Wang J, Li YZ (2022) Microvirga roseola sp. nov and Microvirga lenta sp. nov., isolated from Taklamakan desert soil. Int J Syst Evol Microbiol 72:5409. https://doi.org/10.1099/ijsem.0.005409
DuBois M, Gilles KA, Hamilton JK, Rebers PT, Smith F (1956) Colorimetric method for determination of sugars and related substances. Anal Chem 28(3):350-356.
Egamberdieva D, Reckling M, Wirth S (2017) Biochar-based Bradyrhizobium inoculum improves growth of lupin (Lupinus angustifolius L.) under drought stress. Eur J Soil Biol 78:38-42. http://dx.doi.org/10.1016/j.ejsobi.2016.11.007
Embrapa (2021) AleloMicro Consultas, Empresa Brasileira de Pesquisa Agropecuária. Section: "Linhagem". Available at https://am.cenargen.embrapa.br/amconsulta/linhagem?id=33699. Accessed 05 Jun 2023
Falker (2008) Manual do medidor eletrônico de teor clorofila (ClorofiLOG / CFL 1030). Falker Automação Agrícola Ltda. Porto Alegre, Brasil: 33p. Available at: http://www.falker.com.br/produto_download.php?id=4
Fierro-Coronado RA, Quiroz-Figueroa FR, García-Pérez LM, Ramírez-Chávez E, Molina-Torres J, Maldonado-Mendoza IE (2014) IAA-producing rhizobacteria from chickpea (Cicer arietinum L.) induce changes in root architecture and increase root biomass. Can J Microbiol 60:639-648. https://doi.org/10.1139/cjm-2014-0399
Figueiredo MVB, Burity HA, Martínez CR, Chanway CP (2008) Alleviation of drought stress in the common bean (Phaseolus vulgaris L.) by co-inoculation with Paenibacillus polymyxa and Rhizobium tropici. Appl Soil Ecol 40:182-188. https://doi.org/10.1016/j.apsoil.2008.04.005
Figueiredo MVB, Villar HA, Burity HA, de França FP (1999) Alleviation of water stress effects in cowpea by Bradyrhizobium spp. inoculation. Plant Soil 207:67-75.
Gang S, Sharma S, Saraf M, Buck M, Schumacher J (2021) Bacterial indole-3-acetic acid influences soil nitrogen acquisition in barley and chickpea. Plants 10:780. https://doi.org/10.3390/plants10040780
Grover M, Bodhankar S, Sharma A, Sharma P, Singh J, Nain L (2021) PGPR mediated alterations in root traits: way toward sustainable crop production. Front Sustain Food Syst 4:618230. http://dx.doi.org/10.3389/fsufs.2020.618230
Guimarães AA, Florentino LA, Almeida KA, Lebbe L, Silva KB, Willems A, Moreira FMS (2015) High diversity of Bradyrhizobium strains isolated from several legume species and land uses in Brazilian tropical ecosystems. Syst Appl Microbiol 38(6):433-441. http://dx.doi.org/10.1016/j.syapm.2015.06.006
Hall AE, Schulze E-D (1980) Stomatal response to environment and a possible interrelation between stomatal effects on transpiration and CO₂ assimilation. Plant Cell Environ 3:467-474. https://doi.org/10.1111/1365-3040.ep11587040
Hellemans J, Mortier G, de Paepe A, Speleman F, Vandesompele J (2007) qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol 8:R19. https://doi.org/10.1186/gb-2007-8-2-r19
Iuchi S, Kobayashi M, Yamaguchi-Shinozaki K, Shinozaki K (2000) A stress-inducible gene for 9-cis-epoxycarotenoid dioxygenase involved in abscisic acid biosynthesis under water stress in drought-tolerant cowpea. Plant Physiol 123(2):553-562.
Iuchi S, Yamaguchi-Shinozaki K, Urao T, Shinozaki K (1996a) Characterization of two cDNAs for novel drought-inducible genes in the highly drought-tolerant cowpea. J Plant Res 109(4):415-424.
Iuchi S, Yamaguchi-Shinozaki K, Urao T, Terao T, Shinozaki K (1996b) Novel drought-inducible genes in the highly drought-tolerant cowpea: cloning of cDNAs and analysis of the expression of the corresponding genes. Plant Cell Physiol 37(8):1073-1082.
Jordan DC (1982) Transfer of Rhizobium japonicum Buchanan 1980 to Bradyrhizobium gen. nov., a genus of slow-growing, root nodule bacteria from leguminous plants. Int J Syst Bacteriol 32:136-139
Kavamura VN, Santos SN, da Silva JL, Parma MM, Ávila LA, Visconti A, Zucchi TD, Taketani RG, Andreote FD, de Melo IS (2013) Screening of Brazilian cacti rhizobacteria for plant growth promotion under drought. Microbiol Res 168:183-191. https://doi.org/10.1016/j.micres.2012.12.002
Lumactud RA, Dollete D, Liyanage DK, Szczyglowski K, Hill B, Thilakarathna MS (2022) The effect of drought stress on nodulation, plant growth, and nitrogen fixation in soybean during early plant growth. J Agro Crop Sci. https://doi.org/10.1111/jac.12627
Marengo JA, Souza CM Jr, Thonicke K, Burton C, Halladay K, Betts RA, Alves LM, Soares WR (2018) Changes in climate and land use over the Amazon region: current and future variability and trends. Front Earth Sci 6:228. http://dx.doi.org/10.3389/feart.2018.00228
Marinho RCN, Nóbrega RSA, Zilli JE, Xavier GR, Santos CAF, Aidar ST, Martins LMV, Fernandes-Júnior PI (2014) Field performance of new cowpea cultivars inoculated with efficient nitrogen-fixing rhizobial strains in the Brazilian Semiarid. Pesq Agropec Bras 49:395-402. https://doi.org/10.1590/S0100-204X2014000500009
Marinković J, Bjelić D, Đorđević V, Balešević-Tubić S, Jošić D, Vucelić-Radović B (2019) Performance of different Bradyrhizobium strains in root nodule symbiosis under drought stress. Acta Physiol Plant 41:37. https://doi.org/10.1007/s11738-019-2826-9
Martins LMV, Neves MCP, Rumjanek NG (1997) Growth characteristics and symbiotic efficiency of rhizobia isolated from cowpea nodules of the north-east region of Brazil. Soil Biol Biochem 29:1005-1010
Marulanda A, Barea JM, Azcón R (2009). Stimulation of plant growth and drought tolerance by native microorganisms (AM fungi and bacteria) from dry environments: mechanisms related to bacterial effectiveness. J Plant Growth Regul 28:115-124. https://doi.org/10.1007/s00344-009-9079-6
Michel BE, Kaufmann MR (1973) The osmotic potential of polyethylene glycol 6000. Plant Physiol 51(5):914-916.
Mouad L, Hanane L, Omar B, Meryeme B, Hanaa A, Bedma EJ, El Idrissi Mustapha M (2020) Nodulation of Retama species by members of the genus Microvirga in Morocco. Symbiosis 82:249-258. https://doi.org/10.1007/s13199-020-00725-5
Msaddak A, Rejili M, Durán D, Mars M, Palacios JM, Ruiz-Argüeso T, Imperial J (2019) Microvirga tunisiensis sp. nov., a root nodule symbiotic bacterium isolated from Lupinus micranthus and L. luteus grown in northern Tunisia. Syst Appl Microbiol 42(6):126015. https://doi.org/10.1016/j.syapm.2019.126015
Msaddak, A, Rejili M, Durán D, Rey L, Imperial J, Palacios JM, Ruiz-Argüeso T, Mars M (2017) Members of Microvirga and Bradyrhizobium genera are native endosymbiotic bacteria nodulating Lupinus luteus in Northern Tunisian soils. FEMS Microbiol Ecol 93:28505340. https://doi.org/10.1093/femsec/fix068
Munjonji L, Ayisi KK, Haesaert G, Boeckx P (2018) Screening cowpea genotypes for high biological nitrogen fixation and grain yield under drought conditions. Agron J 110:1925-1935. https://doi.org/10.2134/agron j2017.01.0037
do Nascimento TR, Sena PTS, Oliveira GS, da Silva TR, Dias MAM, de Freitas ADS, Martins LMV, Fernandes-Júnior PI (2021) Co-inoculation of two symbiotically efficient Bradyrhizobium strains improves cowpea development better than a single bacterium application. 3 Biotech 11:1-12. https://doi.org/10.1007/s13205-020-02534-5
Naseem H, Ahsan M, Shahid MA, Khan N (2018) Exopolysaccharides producing rhizobacteria and their role in plant growth and drought tolerance. J Basic Microbiol 58(12):1009-1022.
Nonato JJ, da Silva TJA, Bonfim-Silva EM (2022) Cowpea root growth under water availability and co-inoculation with growth promoting rhizobacteria. Commun Soil Sci Plant Anal 53(14):1756-66. https://doi.org/10.1080/00103624.2022.2063320
Nunes GFO, Menezes KAS, Sampaio AA, Leite J, Fernandes-Júnior PI, Seido SL, Zilli JÉ, Martins LMV (2018) Polyphasic characterization of forage legumes root nodule bacteria isolated from semiarid region in Brazil. Rev Ciênc Agrár 41:612-624. https://doi.org/10.19084/RCA17339
Pacheco RS, Boddey RM, Alves BJR, Straliotto R, Araújo AP (2017) Growth patterns of common bean cultivars affect the ‘B’value required to quantify biological N₂ fixation using the ¹⁵N natural abundance technique. Plant Soil 419(1):293-304. https://doi.org/10.1007/s11104-017-3331-9
Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30:e36
Qin XQ, Zeevaart JAD (1999) The 9-cis-epoxycarotenoid cleavage reaction is the key regulatory step of abscisic acid biosynthesis in water-stressed bean. Proc Natl Acad Sci USA 96:15354-15361
Radl V, Simões-Araújo JL, Leite J, Passos SR, Martins LM, Xavier GR, Rumjanek NG, Baldani JI, Zilli JE (2014) Microvirga vignae sp. nov., a root nodule symbiotic bacterium isolated from cowpea grown in semi-arid Brazil. Int J Syst Evol Microbiol 64:725-7230. https://doi.org/10.1099/ijs.0.053082-0
Rejili M, Msaddak A, Filali I, Benabderrahim MA, Mars M, Marín M (2019) New chromosomal lineages within Microvirga and Bradyrhizobium genera nodulate Lupinus angustifolius growing on different Tunisian soils. FEMS Microbial Ecol 95(9):fiz118. https://doi.org/10.1093/femsec/fiz118
Sena PTS, do Nascimento TR, Lino J, Oliveria GS, RAF N, de ADS F, Fernandes PI Jr, LMV M (2020) Molecular, physiological, and symbiotic characterization of cowpea rhizobia from soils under different agricultural systems in the semiarid region of Brazil. J Soil Sci Plant Nutr 20(3):1178-1192. https://doi.org/10.1007/s42729-020-00203-3
Shet SA, Garg S (2022) Plant growth promotion of Vigna unguiculata in arid sandy soil using bacterial species from coastal sand dune. Agric Res 1-12. https://doi.org/10.1007/s40003-022-00613-y
Shirinbayan S, Khosravi H, Malakouti MJ (2019) Alleviation of drought stress in maize (Zea mays) by inoculation with Azotobacter strains isolated from semi-arid regions. Appl Soil Ecol 133:138-145. https://doi.org/10.1016/j.apsoil.2018.09.015
Silva ER, Zoz J, Oliveira CES, Zuffo AM, Steiner F, Zoz T, Vendruscolo EP (2019) Can co-inoculation of Bradyrhizobium and Azospirillum alleviate adverse effects of drought stress on soybean (Glycine max L. Merrill.)? Arch Microbiol 201(3):325-335. https://doi.org/10.1007/s00203-018-01617-5
da Silva HAP, Galisa PDS, Oliveira RSDS, Vidal MS, Simões-Araújo JL (2012) Gene expression induced by abiotic stress in cowpea nodules. Pesq Agropec Bras 47:797-807. [in Portuguese, with English abstract]
da Silva HAP, Nardeli SM, Alves-Ferreira M, Simões-Araújo JL (2015) Evaluation of reference genes for RT-qPCR normalization in cowpea under drought stress during biological nitrogen fixation. Crop Sci 55:1660-1672. https://doi.org/10.2135/cropsci2014.10.0738
Soares ALL, Pereira JPAR, Ferreira PAA, Vale HMM, Lima AS, Andrade MJB, Moreira FMS (2006) Agronomic efficiency of selected rhizobia strains and diversity of native nodulating populations in Perdões (MG - Brazil). I - Cowpea. R Bras Ci Solo 30:795-802. [in Portuguese, with English abstract]
Sprent JI (1994) Evolution and diversity in the legume-rhizobium symbiosis: chaos theory? Plant Soil 161:1-10
Telles TS, Nogueira MA, Hungria M (2023) Economic value of biological nitrogen fixation in soybean crops in Brazil. Environ Technol Innov 31:103158. https://doi.org/10.1016/j.eti.2023.103158
UN (2015) Transforming our world: the 2030 agenda for sustainable development. A/RES/70/1. United Nations General Assembly, New York, p 25. Available at: https://sustainabledevelopment.un.org/post2015/transformingourworld. Accessed 10 Jul 2023
Uzma M, Iqbal A, Hasnain S (2022) Drought tolerance induction and growth promotion by indole acetic acid producing Pseudomonas aeruginosa in Vigna radiata. PLoS One 17(2):e0262932. https://doi.org/10.1371/journal.pone.0262932
Veyisoglu A, Tatar D, Saygin H, Inan K, Cetin D, Guven K, Tuncer M, Sahin N (2016) Microvirga makkahensis sp. nov., and Microvirga arabica sp. nov., isolated from sandy arid soil. Antonie Van Leeuwenhoek 109:287-296. https://doi.org/10.1007/s10482-015-0631-z
Vilarinho AA (2007) BRS Guariba: cultivar de feijão-caupi de alto desempenho em Roraima. Available at: http://www.infobibos.com/Artigos/2007_4/Guariba/index.htm. Accessed 14 Mai 2023
Vu B, Chen M, Crawford RJ, Ivanova EP (2009) Bacterial extracellular polysaccharides involved in biofilm formation. Molecules 14:2535-2554. https://doi.org/10.3390/molecules14072535
Xavier GR, Runjanek NG, de Rosalia e Silva Santos CE, de Freitas ADS, da Silva VSG, da Silva AF, de Alcantara RMCM (2017) Agronomic effectiveness of rhizobia strains on cowpea in two consecutive years. Aust J Crop Sci 11:1154-1160. https://doi.org/10.21475/ajcs.17.11.09.pne715
Xiong H, Shi A, Mou B, Qin J, Motes D, Lu W, Wu D (2016) Genetic diversity and population structure of cowpea (Vigna unguiculata L. Walp). PLoS One 11:8e.160941. https://doi.org/10.1371/journal.pone.0160941
Zegaoui Z, Planchais S, Cabassa C, Djebbar R, Belbachir OA, Carol P (2017) Variation in relative water content, proline accumulation and stress gene expression in two cowpea landraces under drought. J Plant Physiol 218:26-34. http://dx.doi.org/10.1016/j.jplph.2017.07.009
Zhao S, Fernald RD (2005) Comprehensive algorithm for quantitative real-time polymerase chain reaction. J Comput Biol 12:1047-1064. https://doi.org/10.1089/cmb.2005.12.1047
Zilli JE, Passos SR, Leite J, Xavier GR, Rumjaneck NG, Simoes-Araujo JL (2015) Draft genome sequence of Microvirga vignae strain BR 3299^T, a novel symbiotic nitrogen-fixing Alphaproteobacterium isolated from a Brazilian semiarid region. Genome Announc 3(4):e00700-15. https://doi.org/10.1128/genomeA.00700-15

Download PDF

Journal Publication

published 14 Dec, 2023

Read the published version in Plant and Soil →

Reviewers agreed at journal
08 Aug, 2023
Reviewers invited by journal
07 Aug, 2023
Editor invited by journal
30 Jul, 2023
Editor assigned by journal
30 Jul, 2023
First submitted to journal
28 Jul, 2023

You are reading this latest preprint version

Ability of nitrogen-fixing bacteria to alleviate drought stress in cowpea varies depending on the origin of the inoculated strain

Status:

Journal Publication

Version 1

Abstract

Background and Aims

Methods

Results

Conclusion

Figures

1 Introduction

2 Materials and Methods

2.1 Characteristics of the rhizobacteria strains

2.1 In vitro osmotic tolerance of strains

2.1.1 Cell growth under simulated drought stress

2.1.2 Biofilm formation under simulated drought stress

2.1.3 Exopolysaccharide production

2.2 Indole acetic acid production

2.3 Greenhouse experiment

2.3.1 Experimental setup

2.3.2 Drought stress application

2.3.3 Plant sampling and analyzes (Experiment I)

2.3.4 Measurements of physiological parameters (Experiment I)

2.4 RT-qPCR assay (Experiment II)

2.5 Statistical analysis

3 Results

3.1 In vitro assay with bacterial strains

3.1.1 Bacterial growth under simulated drought stress

3.1.2 Biofilm formation and exopolysaccharide (EPS) production

3.1.3 Indole acetic acid (IAA) production

3.2 Greenhouse experiments

3.2.1 Nodulation

3.2.2 Root and shoot biomass and N accumulation

3.2.3 Plant physiological parameters

3.2.4 Expression pattern of drought-related genes in cowpea nodules

4 Discussion

Conclusion

Declarations

References

Status:

Journal Publication

Version 1