DOI: https://doi.org/10.21203/rs.3.rs-32064/v1
Background Plasmodium vivax contribute over 70% malaria burden in Pakistan. Limited data exist on various aspects including genetic diversity of the parasite as compared to other parts of the world. The information about extent of genetic diversity assists to understand the transmission patterns of the parasite in human host. The current study was designed to understand population divergence of Plasmodium vivax in Pakistan using circumsporozoite protein and merozoite surface protein-I genes as molecular markers.
Methods PvCSP and PvMSP-1 specific PCR and DNA sequencing were carried out for 150 blood samples collected from Islamabad and Rawalpindi, Pakistan. Genetic diversity was analysed using ChromasPro, ClustalW, MEGA7 and DnaSP v.5 programs.
Results The PCR for PvCSP and PvMSP-1 genes was carried out for 150 P. vivax isolates resulting the PCR products ranging from 900 to 1100 bp for PvCSP gene and ~ 400 bp for PvMSP-1 gene. Majority (93%; 121/150) of the P. vivax isolates were of VK210 variant type and only 9 isolates were found of VK247 variant type based on PvCSP gene. Out of the numerous peptide repeat motifs (PRMs) detected, GDRADGQPA (PRM1) and GDRAAGQPA (PRM2) were more extensively dispersed among the P. vivax isolates. Partial sequences (~ 400 bp) at the N-terminal of PvMSP-1 gene depicted high level of diversity.
Conclusion High-level genetic diversity based on PvCSP and PvMSP-1 genes was observed in clinical isolated in the study area. Parasite typing is essential in predicting pattern of antigenic variations, drug resistance and for effective drug and vaccine designing and development which can further evaluate for malaria control and eradication at individual and community level. The base-line data presented here warrant future studies to investigate more into the genetic diversity of P. vivax with large sample size from across the country for better understanding of the vivax malaria transmission patterns.
Malaria remains a serious health concern worldwide. Globally, around 42% population is at risk [1] with 0.4 million deaths out of 228 million malaria cases [2]. Among five Plasmodium species, Plasmodium vivax (P. vivax) contributes around 70% malaria cases in Pakistan [3] with variable severity [4–6]. To circumvent the parasite load, there is a need to investigate the population structure, genetic diversity [7], parasite typing of the local P. vivax species, pattern of antigenic variations and drug resistance [8, 9]. It would lead to discontinue transmission cycle of the parasite in human host in endemic areas. Despite multiple academic research ventures, scanty data is available regarding the diverse genetic make-up of P. vivax in Pakistan [10]. Genetic sequences of P. vivax circum-sporozoite protein (PvCSP) and merozoite surface protein-I (PvMSP-1) are being used to understand the genetic diversity [11, 12]. PvCSP, a highly immunogenic sporozoite surface protein, hence a good vaccine candidate, is encoded by single copy gene [8]. PvCSP comprises of a central repeat domain that varies across Plasmodium species. It has two non-repetitive domains at N- and C-terminals [13, 14]. The varying degree of the amount of peptides in the central repeat region reveals three variants of P. vivax namely VK210, VK247, P. vivax-like [15, 16]. Across the globe, these variants exhibit certain spatial predispositions. With a GDRA(A/D)GQPA amino acid repetition, VK210 strain dominates in the endemic region [17, 18]. Originating in Thailand, the VK247 strain is mostly reported from the areas where mixed infections are prominent. VK247 depicts ANGAGNQPG amino acid repeat in the central region [19, 20]. In PvCSP, polymorphism is reported to be limited in central tandem repeat among the isolates from the regions of Sub-Saharan Africa [21]. PvMSP-1 is expressed on the surface of the blood-stage parasite [22]. PvMSP-1, a large gene, covers conserved and polymorphic regions [23] and has mosaic organization with 13 regions of variable blocks [24]. The three main regions of sequence divergence are block 2 (F1 region), 6–8 (F2 region) and 10 (F3 region) [25]. In the representative blocks, the genetically distinct PvMSP-1 populations within the regions and polymorphism can be detected through PCR [4, 26]. Selective pressure of the host immune maintained the diversity of PvMSP-1 gene. However, immunogenic properties can be affected by single-point mutation [27, 28]. The present study was designed to investigate the genetic diversity of P. vivax in Potohar region of Pakistan exploiting PvCSP and PvMSP-1 genes as molecular markers. In addition, the study depicted base-line molecular epidemiology and phylogenetic characteristics of the local P. vivax isolates exploiting PvCSP and PvMSP-1 gene-based diversity data. It would help to re-design malaria control or eradication measures in the area.
The study was conducted in Islamabad and Rawalpindi districts of the Punjab with longitudes 72°45′ and 73°30′ E and latitudes 33°30′ and 33°50′ N [29] (Fig. 1). The climate ranges from showery warm weather to chilly dry wintry weather with the attributes of the semi-arid region of Pakistan. The monsoon rains typically start in June, get peak in August, and finish by September. The rainfall is between 620 and 1,200 mm per year. The weather and geographical settings of this region is favorable for the mosquito breeding with highest frequency reported in Rawalpindi (25.5%) and lowest in Chakwal (15.9%) [30].
Blood samples (n = 150) were collected during malaria transmission season (April and October, 2019) from Pakistan Institute of Medical Sciences (PIMS), Islamabad and Rawalpindi General Hospital, Rawalpindi, Pakistan. Venous blood (5 mL) was collected in ethylene diamine tetra-acetic acid (EDTA) (BD, USA) vacutainers from malaria patients for microscopy and molecular studies. Blood samples were stored at 4 °C until further analysis.
DNA extraction and PCR amplification of PvCSP and PvMSP-1 genes
Genomic DNA from 150 malarial blood samples were extracted by using standard phenol-chloroform method as described elsewhere [31]. PCR primers for PvCSP and PvMSP-1 genes were designed at Geneious software by using reference sequence of P. vivax (AB539044). The set of primers and cycling conditions used to amplify PvCSP gene is mentioned in Table 1. The PCR reactions were carried out in a 25 µL reaction mixture comprising of 2µL DNA template, 0.5 mM dNTPs,1X PCR reaction buffer (SolarBio Life Sciences, China), 0.2 mM of each primer (BGI, China), 2.5 mM MgCl2 and 1 unit of Taq DNA polymerase (BLIRT, Poland). The PCR products were visualized using 1% agarose gel (ThermoFisher, USA) stained with ethidium bromide (SolarBio Life Sciences, China) and visualized under UV-transilluminator (ThermoFisher, USA).
| Gene | Primers | PCR Conditions |
|---|---|---|
| PvCSP | F: 5’-GGCCATAAATTTAAATGGAG-3’ R: 5’-ATGCTAGGACTAACAATATG-3’ | 94 °C 10 min (94 °C 1 min, 52 °C 1 min, 72 °C 1 min), 35 cycles, 72 °C 10 min |
| PvMSP-1 | F: 5ACATCATTAAGGACCCATACAAG 3’ R: 5’-GCAATTTCTTTACAGTGATCTCG-3’ | 94 °C 10 min (94 °C 1 min, 56 °C 1 min, 72 °C 1 min), 35 cycles, 72 °C 10 min |
The amplified PCR products were purified and sent to BGI, China for sanger sequencing. DNA sequences of both PvCSP and PvMSP-1 genes were read, assembled on both strands and analyzed by using ChromasPro (version 1.5) software (http://technelysium.com.au/wp/ chromaspro/) and Bio Edit alignment editor (version 7.2) (https://bioedit. software. informer. com/7.2/). The sequenced samples were validated by BlastN (https://blast.ncbi. nlm. nih. gov/ Blast.cgi) and alignment of top hit resulted sequences were done by ClustalW (https://www.genome.jp/tools-bin/clustalw). The number of haplotypes and nucleotide and haplotype diversity were calculated by DNAsp v5. Polymorphism of DNA sequence of PvCSP and PvMSP-1 genes were also measured by Tajima’s D, Fu and Li’s D*, and Fu and Li’s F* tests using DNAsp v5. The evolutionary relationships were established and phylogenetic trees of the both genes were constructed by the neighbor-joining method using Molecular Evolutionary Genetics Analysis (MEGA 7.0) software. The nucleotide sequences of PvCSP and PvMSP-1 genes resulted from this study were submitted in NCBI database under accession number MT222296 to MT222330 and MT303819 to MT303848, respectively.
A total of 150 blood samples were collected from P. vivax infected patients from twin cities of Islamabad and Rawalpindi. The blood samples were verified by microscopic examination and PCR and no mixed infections with other malaria parasites were found. The PCR for PvCSP and PvMSP-1 genes were carried out in a total of 150 P. vivax isolates with PCR products ranging from 900 to 1100 bp for PvCSP gene and ~ 400 bp for PvMSP-1 gene.
Sequence analysis of PvCSP gene
Multiple sequence alignment of the translated nucleotide sequences was carried out for the analysis of polymorphisms in the pre-, post- and central-repeats of the PvCSP gene. When compared with the reference sequence (KT588208.1), sequence analysis of PvCSP gene showed only the VK210 and VK247 variant types infection without the existence of the mixed infections. PvSCP gene sequence analysis revealed that majority (93%; 121/150) of the P. vivax isolates were of VK210 variant type and only 9 isolates were found to be VK247 variant type. All PvCSP gene-based P. vivax variants started with the same pre-repeat sequence (KLKQP region). In the central-repeat region (CRR), the VK210 sequences comprised of variable repeats of PRMs, GDRADGQPA (PRM1), GDRAAGQPA (PRM2) which are abundant and found in all the isolates. It is followed through two conserved post-repeat sequence GNGAGGQAA (PRM3) and GGNAANK (PRM4) and one post-repeat insert i.e. KAEDA region. The one-time repeat region of GGNA was found after the CRR in all the analyzed sequences. The repeat units and differences in the order amino acid sequences in CRR have been listed and summarized in Table 2. The observed non-synonymous substitution based on diverse types of repetition in allotypes (RATs) which leads to different PRMs are mentioned in Table 3.
| Type | Repeated amino acid sequences in Pvcsp | No. of Repeats | No. of GGNA |
|---|---|---|---|
| Pak1 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak2 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak3 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak4 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak5 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak6 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak7 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak8 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak9 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak10 | KLKQP□□○□○□○□○□○○□○○○◊●KAEDA | 18 | 1 |
| Pak11 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak12 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak13 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak14 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak15 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak16 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak17 | KLKQP□□○□○□○□○□○○□□○○○○◊●KAEDA | 20 | 1 |
| Pak18 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak19 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak20 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak21 | KLKQP□□○□○□○□○□○○□○○○◊●KAEDA | 18 | 1 |
| Pak22 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak23 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak24 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak25 | KLKQP□□○□○□○□○□○○□○○○◊●KAEDA | 18 | 1 |
| Pak26 | KLKQP□□○□○□○□○□○○□○○○◊●KAEDA | 18 | 1 |
| Pak27 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak28 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak29 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak30 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak31 | KLKQP□□○□○□○□○□○○□○○○◊●KAEDA | 18 | 1 |
| Pak32 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Pak33 | KLKQP□□○□○□○□○□○○□○○○○◊●KAEDA | 19 | 1 |
| Amino acid motifs for the four allelic CSP variants. A different variant is shown with different symbols GDRAAGQPA-○, GDRADGQPA-●, GNGAGGQAA-◊, GGNAANK-□ | |||
| PRMs | Nucleotide sequence of the repeat allotypes (RATs) |
|---|---|
| GDRADGQPA (PRM1) | GGAGACAGAGCAGATGGACAGCCAGCA GGAGACAGAGCAGATGGACAGCCAGCA GGTGATAGAGCAGCTGGACAACCAGCA GGTGATAGAGCAGATGGACAGCCAGCA GGCGATAGAGCAGCTGGACAGCCAGCA GGCGATAGAGCAGATGGACAGCCAGCA GGAGATAGAGCAGCTGGACAGCCAGCA GGCGATAGAGCAGATGGACAGCCAGCA GGAGATAGAGCAGCTGGACAGCCAGCA GGCGATAGAGCAGATGGACAGCCAGCA GGAGATAGAGCAGCTGGACAACCAGCA GGTGATAGAGCAGCTGGACAACCAGCA GGAGATAGAGCAGATGGACAACCAGCA GGAGATAGAGCAGCTGGACAGCCAGCA GGAGATAGAGCAGCTGGACAGCCAGCA GGAGATAGAGCAGCTGGACAGCCAGCA GGAGATAGAGCAGCTGGACAGCCAGCA GGAAATGGTGCAGGTGGACAGGCAGCA GGAGGAAATGCGGCAAACAAG |
| GDRAAGQPA (PRM2) | |
| GNGAGGQAA (PRM3) | |
| GGNAANK (PRM4) |
PvCSP CRR based genetic population structure
The population genetic structure based on the PvCSP CRR of the P. vivax isolates
was analyzed and compared with PvCSP isolates of neighboring country Iran giving the values average dS and dN for each isolate. The haplotype diversity of PvCSP gene was similar between two countries ranging from 0.345 to 0.547. Adding to this, Tajima’s D, Fu and Li’s D* and F* tests also accepted occurrence of a neutral model of polymorphism with values for PvCSP (Pakistan) (Tajima’s D = 0.54276, P < 0.10; Fuand Li’s D* = 1.17870, P < 0.10; Fu and Li’s F* = 1.12083,P < 0.10) and PvCSP (Iran) (Tajima’s D = 0.43556, P < 0.10;Fu and Li’s D* = 1.80767, P < 0.10; Fu and Li’s F* =0.43556,P < 0.10) respectively (Table 4).
| Population | Type P. vivax | No. of samples | No. of Haplotypes | Haplotype diversity | Diversity ± SD | Fu & Li’s D* | Fu & Li’s F* | Tajima’s D* |
|---|---|---|---|---|---|---|---|---|
| Nucleotide Haplotype | ||||||||
| Pakistan Iran | PvCSP PvCSP | 35 28 | 15 10 | 0.547 0.345 | 0.02371 ± 0.0005620 0.084 ± 0.00701 0.02001 ± 0.0003146 0.057 ± 0.00478 | 1.17870 1.01980 | 1.12083 1.80767 | 0.54276 0.43556 |
| Pakistan Iran | PvMSP-1 PvMSP-1 | 30 32 | 10 10 | 0.962 0.954 | 0.00162 ± 0.0000026 0.012 ± 0.00014 0.00159 ± 0.0000023 0.012 ± 0.00014 | 1.86276 1.78902 | 2.13897 1.90878 | 1.67790 1.56845 |
*P > 0.10
Based on sequence of PvMSP-1 gene, a phylogenetic tree was constructed (Fig. 3). Two distinct clades can be inferred from the tree. The first clade is divided further into three sub-clades contained 11 Pakistani isolates and isolates belong to East Africa, Thailand and Mexico. Second clade is further divided into two sub-clades having Turkey, Iran and Southern Mexico isolates in addition of sequences of Pakistani isolates. The Neighbor-Joining method was used to deduce evolutionary history with the sum of branch length of tree = 0.50423062 was shown.
Malaria, a protozoan parasitic disease, is one of the major public health concerns with limited data in Pakistan [32]. As Pakistan shares border with malaria endemic countries like Iran, India and Afghanistan so human migration across the border is inevitable which may facilitate substantial cross-border transmission of malaria. Human migration, immune responses exhibited by the human host, chemotherapy, genetic mutation and recombination lead to genetic diversity and affects the frequency of new alleles in the parasite population [33, 34]. The study of genetic diversity can give significant indications about parasite response to different drugs and vaccines as positive selection will favor the fixation of important alleles in the population and can lead to reduction of genetic diversity [35]. Despite P. vivax contributing to 88% of malaria burden in Pakistan [4–6], data regarding genetic diversity of this key circulating species is lacking. There are limited studies from Pakistan which analyzed the diversity of local P. vivax in detail [4, 5, 23, 33]. So, the need for the detailed understanding of the extent and nature of P. vivax genetic diversity is obvious. PvCSP and PvMSP-1 are among the other important genetic markers used by the researchers to understand population structure and evolutionary dynamics from different geographical regions [4, 25]. In the present study, genetic diversity of both PvCSP and PvMSP-1 and PvMSP-1 genes were estimated among clinical isolates collected from different hospitals of Federal and Punjab region of Pakistan.
The results of PvCSP uphold the findings of the previously published results showing that VK210 strain is predominant type with the prevalence rate ranging between 81–100% [9, 12, 14, 36]. There are few malaria endemic areas where VK247 isolates are commonly present [37, 38]. In the present study, the translated nucleotide sequences suggested that there were peptide repetitive motifs in which GDRADGQPA (PRM1) and GDRAAGQPA (PRM2) which found to be the two major PRMs. Earlier studies also pointed out the dominance of these two prime PRMs (GDRADGQPA, GDRAAGQPA) in the clinical isolates [7, 8 12, 39]. All the isolates collected were composed of similar pre-repeat sequence (KLKQP) region and conserved post-repeat sequence GGNAANK (PRM4). At the end of the sequence the conserved post-repeat sequence is present as a last section in all of the VK210 isolates, consistent with the findings of aforementioned studies from India, Iran and Sri Lanka [8, 14, 20]. Another peptide repeat motif GNGAGGQAA (PRM3) was found at lower frequency (0.6%) in the isolates. The essential behind the development of genetic diversity found in the PvCSP gene, across various spatial locations, is the number of PRMs. Difference in the amino acid and nucleotide sequences of the Plasmodium antigens due to variations exist in the repeat unit numbers depicted the pressure of natural selection displayed by the host immune system [14, 40]. The arrangement of the main PRM1 and PRM2 factors lead to 15 different haplotypes in PvCSP. The pragmatic neutrality tests also accepted a neutral model of polymorphism which indicated that events of positive selection occurred in the complex group P. vivax isolate [14].
PvMSP-1 is one of the most promising vaccine candidates and is available for antigenic and genetic variation studies of P. vivax populations [41]. In this study, partial sequence (~ 400 bp) at N-terminal of PvMSP-1 gene depicted a high-level of diversity. Such high level of genetic diversity is in concordance with what has already observed in neighboring country Iran [20] and in previous study from Pakistan [32]. In the northwestern region of Thailand, a high degree of mutational variety was observed in PvMSP-1 gens of P. vivax isolates [28, 42]. The natural selection was determined by the neutrality tests on the PvMSP-1 N-terminal fragment of P. vivax. Overflow of transitional frequency alleles were observed because of significantly positive values which may be the result of balancing the selection and population bottlenecks. The sequence diversity of the population is best studied by the intragenic recombination of PvMSP-1 gene where the allelic recombination frequencies may aid as a character reference for understanding the parasitic population structure [27]. Kibria et al. [25] also indicated that the given variations suggest high genetic diversity in all areas under study, furthermore, that the PvMSP-1 gene undergoes selective pressure for the existence and spread of the parasite. The PvMSP-1 gene sequences were instructive in distinguishing the two central localities of sample origin in terms of geography as well as helping them to group in two different clades. These clades are further sub divided into different clusters and group these sequences on these sub clusters according to its geographic origin [43].
Other studies suggested that the mode of evolution in PvCSP gene can lead to cohort of variants that can elude the host immune response under the effect of both mitotic recombinantion and positive selection of P. vivax new variants [16]. It is safe to assume, therefore, that the wide variety of P. vivax is perhaps interrelated with multiple other variables including, but not limited to, genetic and biological characteristics, immunity of the host and the displacement of individuals within the boundaries of the endemic areas. Furthermore, the spread of P. vivax infections is also buttressed by relapse and early gametocytaemia, which in turn sustains local diversity, paving way for a more efficient transmission to the vector mosquitoes [12, 44].
In the research undertaken here, a broad range of genetic variety of PvCSP and PvMSP-1 genes in P. vivax population was noticed. The localities of the study areas, inhabited by various ethnicities, suggest that the migration of people may carry diverse parasite entities that increase the variety of the gene-pool. Furthermore, individuals infected by the disease might carry various clones with varying degree of PvCSP derivatives, which may recombine during the sexual stage of the mosquito leading to the production of offspring with new PvCSP genotypes. This prevalent phenomenon could strengthen the introduction of new strains of P. vivax into the regions where conditions for malaria transmission are conducive [12, 25].
High-level genetic diversity based on PvCSP and PvMSP-1 genes for P. vivax in clinical isolates was observed in Pakistan. The data will facilitate the documentation of areas targeted by the host
immune response and facilitate in better insight of the host-parasite relationship, will provide novel insights into the events/signaling mechanisms and recognition of novel vaccine and drug target sites. A better understanding of genetic variability will help to control malaria at individual and community level. In order to design and put new and more effective vaccinations into effect, these studies can provide substantial help. The base-line data presented here warrant future studies to investigate more into the genetic diversity of P. vivax with large sample size from across the country for better understanding of the vivax malaria transmission patterns.
Ethics approval and consent to participate
The study was approved by institutional review board (IRB), Virtual University of Pakistan, (letter No. VU/ASRB/131-7). Blood samples were collected from diagnosed malaria patients after informed consent.
Consent for publication
Not applicable
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Competing interests
The authors declare no competing interests
Funding
There was no financial support for this research.
Authors' contributions
ZB conducted laboratory experiments and data analysis, AF helped in sample collection, clinical inputs and malaria identification, RR helped in primer designing and molecular data input, AM provided scientific inputs and critical review of manuscript, SK helped specifically in CSP gene analysis, SN supervised the wet labs, critically reviewed manuscript, helped in manuscript drafting and data analysis, SW conceived the idea and study design, provided all wet lab reagents/lab facilities and contributed to the critical revision of the manuscript, . All authors read and approved the final manuscript.
Acknowledgements
We would like to thank medical staff of hospital and all the study participants to participate in the study
Authors' information
1Department of Molecular Biology, Virtual University of Pakistan, Lahore, Pakistan. 2Department of Medicine, Polyclinic Hospital, Islamabad, Pakistan. 3Department of Life Sciences, Abasyn University, Islamabad, Pakistan. 4Department of Biological Sciences, National University of Medical Sciences, Rawalpindi, Pakistan. 5Alpha Genomics (Pvt) Ltd., Islamabad, Pakistan.