Transcription factor TFAP2B exerts neuroprotective effects targeting BNIP3 mediated mitophagy in ischemia/ reperfusion injury

doi:10.21203/rs.3.rs-3207959/v1

Download PDF

Research Article

Transcription factor TFAP2B exerts neuroprotective effects targeting BNIP3 mediated mitophagy in ischemia/ reperfusion injury

https://doi.org/10.21203/rs.3.rs-3207959/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 21 Feb, 2024

Read the published version in Molecular Neurobiology →

You are reading this latest preprint version

Cerebral ischemia-reperfusion injury (CIRI) leads to malignant brain edema, blood-brain barrier destruction and neuronal apoptosis. N6-methyladenosine (m6A) RNA modification in CIRI has still limited. MeRIP and RNA-sequencing were performed of middle cerebral artery occlusion and reperfusion (MCAO/R) rats to find novel potential molecular targets. Transcription factor TFAP2B, was standed out of which its m6A abundance decreased associated with a marked reduction of its mRNA based on joint interactive bioinformatics analysis of the MeRIP and RNA-Sequencing data. It was suggeted TFAP2B could have an role in CIRI. Functionally, overexpression of TFAP2B in cultrued primary neurons could effectively improve the cell survival and pro-survival autophagy in parallel with reduced cell apoptosis during OGD/R in vitro. Through the RNA-sequencing of TFAP2B overexpressed primary neurons and subsequent validation experiments, it was found that mitophagy receptor BNIP3 was one of an important target of TFAP2B in OGD/R neurons through which TFAP2B could bind to its promoter region for further transcriptional activation of BNIP3, thereby enhancing BNIP3 mediated mitophagy to protect against OGD/R injury of neurons. Lastly, TFAP2B was demonstrated to alleviated the MCAO/R damage to a certain extent in vivo. Although it was failed to confirm TFAP2B dysregulation was m6A dependent in current research, this is the first study of TFAP2B in CIRI field with important guiding significance.

Cerebral ischemia-reperfusion injury

MeRIP-sequencing

RNA sequencing

TFAP2B

primary neurons

BNIP3

mitophagy.

Cerebral ischemia-reperfusion injury (CIRI) which could lead to malignant brain edema, blood-brain barrier destruction and neuronal apoptosis, often occurs during thrombolysis or surgical treatment [1]. In the past few decades, the main intervention strategies for ischemic cerebrovascular disease have focused on neuroprotection to save ischemic neurons in the brain from irreversible damage[2]. The neuroprotective strategies mianly based on the underlining mechanisms, such as oxidative stress, apoptosis and autophagy, inflammation [3–5].

N6-methyladenosine (m6A) which is the most common and abundant RNA modification in eukaryotes governs the fate and function of the transcripts in an m6A-dependent manner [6,7]. Recent findings indicate that the m6A modification is associated with several human diseases and regulates a variety of biological functions including transcript alternative splicing, nuclear RNA export, protein translation, cell fate determination and myocardial function [8–10]. In this study, methylated RNA immunoprecipitation sequencing (MeRIP seq) and RNA transcriptome sequencing (RNA seq) were implemented to analyze the profiles of m6A modifications and mRNA levels of transcriptome in the cortex of cerebral ischemic areas in rats with middle cerebral artery occlusion and reperfusion (MCAO/R). TFAP2B standed out with the m6A abundance decreased significantly accompanied by obvious down-regulated mRNA level based on combinatnt interactive bioinformatics analysis of the MeRIP-Seq and RNA-Seq data (MCAO/R vs Sham).

TFAP2B (transcription factor activating enhancer-binding protein 2B) is a neural crest-expressed transcription factor belonging to AP-2 transcription factor family which mediate many downstream genes through binding to GC-rich consensus sequences to orchestrate cell induction, differentiation, survival, proliferation and apoptosis within various developmental contexts [11,12] [13]. Although TFAP2B was reported to be associated with adipocytokine regulation, type 2 diabetes mellitus and the growth acceleration of different kinds of tumors [14,11,12], its functional roles in CIRI have hardly been studied before. Therefore, we took the lead in putting forward the scientific hypothesis: TFAP2B could have an important regulatory role in CIRI and studing The functional roles of TFAP2B was in OGD/R-induced primary neurons and MCAO/R rats for the first time.

Mitochondrial injury associated with blood flow recovery is an important pathophysiological process after ischemia-reperfusion (IR) [15]. The clearance of damaged mitochondria through autophagy is called mitophagy, which is beneficial for maintaining the ATP production required by cells [16]. In CIRI field, Enhanced mitophagy was proposed as a therapeutic strategy to protect neurons from ischemic insults by preventing mitochondrial-dependent apoptosis [17,18]. Bcl-2 19-kDa interacting protein 3 (BNIP3) is a mitochondrial protein which plays a critical role in mitophagy [19]. Combined with the RNA-seq results of TFAP2B overexpressed primary neurons and subsequent confirmatory experiments, it was speculated and proved that TFAP2B mediated mitophagy receptor BNIP3 through transcriptional activation then enhanced the mitophagy of damaged mitochondria to protect against cerebral ischemia-reperfusion injury caused by OGD/R. That could be one of the potential molecular mechanisms for TFAP2B to alleviate CIRI.

This is the first study to research the functional role of TFAP2B in the field of CIRI injury which may provide some ideas for the development of cerebral I/R injury clinical treatment strategies.

Middle cerebral artery occlusion / reperfusion model and experimental groups

Male Sprague–Dawley rats were purchased from the Hunan experimental animal center (Hunan drug safety evaluation and research center). Transient MCAO/R models were established using the middle cerebral artery occlusion / reperfusion as described in previous study [20]. Berifly, anesthetize rats with isoflurane gas. After skin preparation and disinfection, the neck skin was cut open to separate the external carotid artery. A silk suture was advanced from the external into the internal carotid artery until the origin of the middle cerebral artery. The suture was withdrawn after 1 hr of cerebral ischemia and 24 hr of reperfusion was followed. The rat skulls were exposed before the operation and connected to a laser Doppler flow meter (PF5001, Perimed, Switzerland). The Doppler flow meter was used to monitor cerebral blood flow throughout the surgical process and reperfusion. Animals with a cerebral blood flow decrease of more than 70% were considered established MCAO models successfully. The MCAO/R model rats involved in this study were divided into two parts: part 1 for sequencing experiments (RNA-seq and MeRIP-seq; Sham and MCAO 1hr / R-24 hr, n = 4, respectively); Rats in part 2 were mainly used to study the bio-function of TFAP2B in vivo. TFAP2B-overexpressed adeno-associated virus which were packaged at Genechem Co, Ltd, Shanghai, China) were administered through intracerebroventricular injection. MCAO/R operation was established 7days post-injection (AAv-TFAP2B-ov or AAv-NC-ov, n = 3, respectivly) according to previous study [21].

MeRIP-Sequencing, RNA-Sequencing and Data Analysis

In order to obtain the m6A peaks and mRNA profiles of cerebral cortex, MeRIP-seq and RNA-seq were performed in Kaitai Biotechnology (Hangzhou, Zhejiang, China). The relevant bio-informatic statistical analysis was carried out by Science ༆ Well Biotechnology (Changsha, Hunan, China) according to the previous literature. differential methylation sites (fold change ≥ 2 and p < 0.05) were identified by diffReps.

Cell culture and oxygen-glucose deprivation reperfusion

Primary hippocampal neurons isolated from newborn rats (3 days) were used in the present study according to the method described in the reference [22]. NeuroGro® neuron basic medium (Peiyuan biotech, Nanjing, China)was used to culture neurons. The culture liquid was completely changed every three days. On the eighth day, the primary cells were used.

To accomplish Oxygen-glucose deprivation reperfusion (OGD/R) cell model construction, normal growth media was exchanged for serum free DMEM without glucose, and cells were transferred into a low-oxygen (96% N₂, 3% CO₂, 1% O₂) incubator at 37°C (oxygenglucose deprivation, OGD). 4 hrs later, glucose and sodium pyruvate were added to the culture medium, OGD was terminated via returning cells to normoxic condition so as to initiate reperfusion. As a control, cells were cultured under normoxic and conventional culture conditions in parallel.

Lentivirus infection of neurons

Lentivirus of overexpression of TFAP2B (Lv-TFAP2B-Ov) and Lentivirus of BNIP3 silence (Lv-BNIP3-si) were packaged by Tsingke (Beijing, China). Infection experiments were conducted according to the instructions at the MOI value of 200.

Quantitative real-time PCR (QPCR), m6A-specific QPCR and western blotting

Total RNAs were extracted from the tissues and cells using RNAsimple total RNA kit (Cat.no. PD419, Tiangen, China) and then were reverse transcribed using the RevertAid First Strand cDNA Synthesis Kit (Cat.no.K1622, ThermoFisher, USA). Quantitative real-time PCR was carried out as described in the reference [23]. The relative gene expressions were calculated in accordance with the 2^ΔΔCt method. The methylated m6A RNA immunoprecipitation (me-RIP) assay was performed as described previously [24]. Relevant primer information was listed in Table 1.

Table 1

The specific primer sequences
mRNA	Forward primer (5^, to3^,)	Reverse Primer (5^, to3^,)
HIF-1α	GGCGAGAACGAGAAGAAAAATAGG	AGATGGGAGCTCACGTTGTG
TFAP2B	CTATGAGGACCGGCACGATG	TGCCGCTGTTATTGGCATCT
TOMM20	AGCTGGGCTTTCCAAGTTAC	TGTCAGATGGTCTACGCCCT
CoxIV	AAGTGTTGTGAAGAGCGAAGAC	TGAACTTAATGCGATACAACTCG
BAX	TCACTGAAGCGACTGATGTCC	GAGCACTCCCGCCACAAA
β-actin	TTCCTTCCTGGGCATGGAGTC	TCTTCATTGTGCTGGGTGCC

Protein expression of interest was deteced using western blot as previously described [23]. Relevant antibody information was listed in Table 2. Amount of the protein of interest was normalized to the densitometric units of β-actin.

Table 2

Antibody used in western blot assay
Antibody	Cat. no	Brand	Dilution	MW
TFAP2B antibody	YT0253	Immunoway	1:1000	49 KDa
P62 antibody	P06535	Promab	1:1000	62 KDa
LC3 antibody	P20655	Promab	1:1000	14/16 KDa
BNIP3 antibody	P01066	Promab	1:1000	30 KDa
Tomm20 antibody	P22730	Promab	1:1000	16 KDa
C-caspase3 antibody	P20032	Promab	1:1000	17 KDa
β-actin antibody	3854	Sigma	1:40000	42 KDa

EdU incorporation assay

TFAP2B gain-of-function neuronal cells were incubated with 10µM EdU (Cat.no C0081s, Beyotime, Shanghai, China) for 24 hrs and then were fixed with 4% formaldehyde for 30 min. EdU incorporation was tested according to manufacturer’s instructions. Neuronal cells which were both positive for EdU and DAPI (Cat.no C0060, Solarbio, Beijing, China) were considered to be the viable cells which were used to calculate the percentage of EdU-positive cells using Image J software (Wayne Rasband, NIH).

Flow cytometry

Flow cytometry was used to detect apoptosis of TFAP2B gain-of-function neurons with annexin-V-FITC method (catalog no. 556547, BD Biosciences) according to the instructions. Cell Quest software (BD Biosciences) was used to analyze the results. The experiments were carried out three times in parallel.

TUNEL staining

Cell apoptosis of TFAP2B gain-of-function neurons was determined by TdT mediated dUTP nick-end labelling (TUNEL) analysis (cat.no T6039S, Bioscience, Shanghai, China) according to the manufacturer’s instructions. The results were observed and measured under a fluorescence microscope (AE31, Motic, China). Neuronal cells which were both positive for Tunel and DAPI were thought to be apoptotic cells which were used to evaluate the apoptotic ratio.

Nissle and immunofluorescence multiple staining

Both Nissle and Tunel + NeuN immunofluorescence double staining were conducted in Servicebio (Wuhan, China). The staining results were recorded by panoramic scanning (Pannoramic Scan, 3DHISTECH), presented and photographed using CaseViewer software.

Luciferase reporter assay

To investigate whether BNIP3 is transcriptionally regulated by TFAPB2 based on Jaspar's prediction, HEK293 cells were transfected with BNIP3 promoter (WT-P1/P2 or MUT-P1/P2) reporter constructs, and further co-transfected with TFAP2B-Ov. After a 48-hr culture, the Dual-Luciferase reporter assay system was used to assess promoter activity, with Renilla luciferase used for normalization[25].

Mitophagy observation,

For mitophagy observation, cells were seeded onto a poly-l-lysine-treated glass bottom dish and infected with Lv-TFAP2B-Ov. After 48hrs, cells were seeded on slides (Nest, 801010) and HBAD-mcherry-LC3(Hanbio, Wuhan, China) was used to infect cells again. After OGD/R, cells were reperfused for the indicated duration of time. Cells were incubated with MitoTracker Green (150nmol/L, C1048, Beyotime, Shanghai, China) for 15 min before observation. All slides were observed and photographed under panoramic scanning system (Pannorramic MIDI, Hungary).

Statistical analysis

All experimental results listed in this research are presented as the mean ± SD. GraphPad Prism 9.0 software (GraphPad Software, San Diego, CA, USA) was used to perform the statistical analysis. T-test was carried out for the comparison of two conditions. Ordinary one-way ANOVA was used for multiple comparisons. P value of < 0.05 was considered statistically significant.

Overviews of the MeRIP-sequencing and RNA-sequencing profiles in MCAO/R Rats

The schematic protocol of this part was shown (Fig. 1a). The 2,3,5-triphenyltetrazolium chloride (TTC) staining was performd to roughly estimate infarct volume (Fig. 1b). All of the MeRIP-seq data were deposited into NCBI-SRA database under the project number of PRJNA73198. According to the MeRIP-peak region situations, there were 23,121 and 23,000 m6A peaks identified in the sham and MCAO/R tissues respectively of which 3,319 peaks within the same mRNAs overlapped in this two groups (Fig. 1c). To clarify the preferential distribution of m6A modification in transcripts, we investigated the metagene profiles of all identified m6A peaks in the entire transcriptome which showed that m6A peaks were mainly enriched in the 3-UTR and Exon regions in both groups (Fig. 1d). To further elucidate the m6A methylation differences between this two groups, a differential m6A methylation level analysis was carried out. It was demonstrated that when compared with the sham group, a total of 9,192 differential m6A-methylated peaks were identified among which 2,686 hypermethylated and 7,506 hypomethylated m6A sites were discovered respectively (fold changes ≥ 1.5, p < 0.05 vs Sham) in the MCAO/R group (Fig. 1e). In addition, transcriptome profiles of altered mRNAs were detectd through RNA-seq. 1,497 differentially expressed genes (DEGs) were uncovered (MCAO/R vs Sham, fold changes ≥ 2 and p < 0.05) including 989 upregulated and 508 downregulated DEGs (Fig. 1e, right)

TFAP2B standed out based on combinant interactive bioinformatics analyses of the MeRIP and RNA-sequencing data

In order to excavate key DEGs which mRNA levels changed due to the m6A modification as much as possible, combinant interactive bioinformatics analyses of the MeRIP-Seq and RNA-Seq data were carried out (Fig. 2a). It was identified 83 DEGs with hypermethylated m6A peaks among which 74 DEGs were significantly upregulated (hyper-up) and 9 were downregulated (hyper-down). On the other hand, 359 DEGs with hypomethylated m6A peaks, consisting of 78 upregulated (hypo-up) and 281 downregulated (hypo-down) (Fig. 2b). The results suggested that DEGs with altered m6A-methylated peaks were mainly enriched in the “hyper-up” or “hypo-down” which is consistent with the previous literature [4]. Then, clustering was made again according to the following parameters: the significance of DEG (p < 0.05, |log FC| > 1.0) and with significant alterations in m6A abundance (p < 0.01, |log FC| > 1.0), based the results, top20 DEGs were picked out again (Fig. 2c). Among these DEGs, transcription factor TFAP2B attracted our interest which has never been studied in ischemic cerebrosis. In order to make the visual contrast more intuitive and clear, the peaks of IP and the corresponding input samples were drawn overlapped of TFAP2B (Fig. 2d). Ordinary QPCR and m6A-specific qPCR were implemented to verify the mRNA levels (Fig. 2e). and m6A abundance (Fig. 2f) differences between sham and MCAO/R tissues respectivly, and the result showed both the relative mRNA levels and the m6A-modified abundance of TFAP2B were significantly lower in MCAO/R when compared with sham, which were consistent with the RNA-seq and MeRIP-Seq result

TFAP2B was inhibited in primary neurons under the OGD/R context

OGD/R induced neurons are widely considered as classic cell models of CIRI. In order to further explore the expression of TFAP2B in OGD/R induced neurons, OGD/R neuron models were established, in which OGD lasted for 1,2,4 hrs respectively followed by 12 hr of reoxygenation (Fig. 3a). The primary neurons of newborn rats were isolated and cultured (Fig. 3b) . The mRNA levels of HIF-α were detected to be a preliminary indicator of the successful construction of the model. It was shown that when OGD lasted for 2 hr, the relative mRNA level of HIF-α began to increase. when OGD lasted for up to 4 hr, the relative mRNA level of HIF-α showed a very significant upregulation (vs NC, Fig. 3c). Next, the mRNA levels of TFAP2B were detected accordingly. It was shown that when OGD lasted for both 2 hrs and 4 hrs, the relative mRNA levels of TFAP2B reduced significantly compared with NC group (Fig. 3d).Then western blot was carried out and the result showed TFAP2B expression was significantly reduced under OGD/R induction compared to the NC (Fig. 3e). Besides, m6A-specific QPCR was conducted and the results showed the m6A abundance of TFAP2B in OGD/R neurons was obviously reduced when compared with NC group which was in line with that in MCAO/R tissues (Fig. 3f).

TFAP2B effectively improved the survival of OGD/R induced primary neurons

The experimental design of this part is shown in Fig. 4a. TFAP2B-overexpressed lentivirus was infected into primary rat neuronal cells to construct the gain-of-function neuronal cell model which was verified at both mRNA and protein levels (Fig. 4b and c). Annexin-V/FITC assay showed that compared with the negative control group (Lv-NC-Ov), the apoptosis of TFAP2B-overexpressed neurons decreased from 14.5–6.8% after OGD/R treatment (Fig. 4d). In order to confirm this result again, tunel staining was performed and the result demonstrated that after OGD/R treatment, the proportion of neurons with red apoptotic signal in Lv-TFAP2B-Ov group was significantly lower than that in negative control (Lv-NC-Ov) group (Fig. 4e). As neurons hardly proliferate, a Edu assay was conducted to reflec cell vitality. It could be observed that after OGD/R, the number of edu-positive neurons showing red signal increased obviously in Lv-TFAP2B-Ov neurons when compared with the Lv-NC-Ov neurons (Fig. 4f). The above results demonstrated that TFAP2B could effectively improve the survival of primary neurons under OGD.

RNA-sequencing of primary neurons with TFAP2B overexpression.

As a transcription factor, exploring its transcription targets is crucial for revealing the potential molecular mechanisms of its biological function. To explore the mechanism through which TFAP2B improve the survival of OGD/R induced primary neurons, we performed RNA sequencing of cell extracts from TFAP2B-overexpressing primary neurons and controlled primary neurons, treated with OGD/R, to seek candidate target genes (RNA-sequencing data were deposited into NCBI-SRA database under the project number of PRJNA73199). It was found that 1624 mRNA were up-regulated and 575 mRNA were down regulated significantly in TFAP2B overexpressed neurons (Lv-TFAP2B-Ov vs Lv-NC-Ov, p < 0.05, |log FC| > 1.0) (Fig. 5a). Further, t-test was carried out, and DEGs with significant differences were screened out (p < 0.05); Next, DEGs with FPKM ≥ 10.0 were screened out and were sorted according to their coefficient of variation (CV), and the top 25 genes with the upper and lower levels were selected separately and the cluster heat maps were generated (Fig. 5b). Among these genes, BNIP3 is an important mediator of mitophagy [23,26] and became the focus of our study, although we cannot rule out the potential function of the other genes. Then western blot was used to empirically confirm the trends of BNIP3 and validated it successfully, when TFAP2B was overexpressed, both the mRNA level and the protein expression of BNIP3 were increased correspondingly (Fig. 5c and d). Subsequently, Jaspar (https://jaspar.genereg.net/) was used to predict the potential binding segments of TFAP2B in the BNIP3 promoter region. It was found that there are two peridcted putative sites with relative profile score threshold 90% in the + strand (-1452-1442 nt;. -1267-1257 nt) (Fig. 5e). Furthermore, luciferase reporter assays were used to validate whether TFAP2B activating transcription of BNIP3 promoter. BNIP3 promoter sequences containing wild-type (WT-P1 and P2) or mutant-type (MUT-P1 and P2) were inserted in the luciferase reporter plasmid promoter. It was found that luciferase activity from the WT-P1, but not the MUT-P1, was markedly increased through TFAP2B overexpressing which demonstrated that the P1 segments(-1452-1442 nt) is one of the binding site of TFAP2B in the BNIP3 promoter (Fig. 5f and g).

TFAP2B protects against the OGD/R induced apoptosis through mediating mitophagy.

BNIP3 serves as mitochondria associated protein that can promote mitophagy. Due to the transcriptional activation of BNIP3 by TFAP2B, it was speculated that TFAP2B alleviated neuronal apoptosis through promoting mitophagy in damaged mitochondria under the OGD/R context and experiments were performed (Fig. 6a). To verify the hypothesis, firstly, western blots were implemented to evaluate autophagy markers (LC3II/I, P62) and mitochondrial mass markers ( TOMM20). The results demonstrated that the LC3II/I was enhanced and the autophagy substrate P62 decreased in TFAP2B-Overexpressed neuron cells (vs.Lv-NC-Ov) under OGD/R treatment suggesting autophagy promotion. Correspondingly, there was a certain degree of Tomm20 recovery in TFAP2B-Overexpressed neuron cells (vs.Lv-NC-Ov) under OGD/R treatment implying the recovery of mitochondrial mass to some extent (Fig. 6b and c). Besides, the expression of apoptotic executing protein c-caspase3 was also significantly reduced in TFAP2B-Overexpressed neuron cells (vs.Lv-NC-Ov) under OGD/R treatment (vs.Lv-NC-Ov) (Fig. 6b and c). The involvement of TFAP2B was further evaluated by mitophagosome formation through the co-localization of LC3B and Mito-Tracker Green. As indicated by colocalization of RFP-LC3B and MitoTracker, mitophagy was increased a little in OGD/R-treated cells (Lv-NC-Ov + OGD/R vs. Lv-NC-Ov). As expected, TFAP2B overexpression significantly promoted the mitophagy formation as indicated by the increased co-localization of LC3B and MitoTracker Green. These results suggested TFAP2B mediates OGD/R-induced mitophagosome formation in neurons (Fig. 6d). To explore whether the regulation of TFAP2B on mitophagy was partially mediated by BNIP3, BNIP3 was silenced (Lv-BNIP3-si) in neurons overexpressing TFAP2B using lentivirus infection again. Subsequently, the mitophagy of neurons under the OGD/R was evaluated again. It was found that the mitophagy formation was decreased obviously as indicated by the reduced co-localization of LC3B and MitoTracker Green when BNIP3 was knocked-down in TFAP2B overexpressed neurons (Fig. 6e). On the other hand, QPCR assays showed that, under OGD/R, the relative mRNA levels of mitochondrial mass markers Tommy20 and CoxⅣ which had originally recovered with TFAP2B overexpression, decreased again with BNIP3 knockdown, while the apoptotic protein BAX, which had significantly decreased with TFAPB overexpression, increased again with BNIP3 KD (Lv-BNIP3-si vs. Lv-NC-si) (Fig. 6f).

TFAP2B overexpression alleviated the MCAO/R damage to a certain extent in vivo

In vivo, Nissl staining and NeuN + tunel IF double staining were performed (Fig. 7a). The Nissl body is the main site for protein synthesis in neurons. When neurons are damaged, Nissl bodies in the neurons significantly decrease or even disappear, ultimately leading to neuronal necrosis. The Nissl dying showed that when compared with AAv-NC-Ov rats, the neurons in the sham groups both (AAv-TFAP2B-Ov and AAv-NC-Ov were plump in shape, with obvious nuclei and abundant Nissl bodies, suggesting the normal viability of nerurons. However, after MCAO/R, without TFAP2B overexpression, neurons were wrinkled and necrotic but the with TFAP2B overexpression, neuronal injury was alleviated obviously when compared with the AAv-NC-Ov group (Fig. 7b). In order to show the apoptosis of nerve cells more intuitively, immunofluorescence mulitiple staining was performed using Cy3 labeled neuron-specific nuclear protein (NeuN, red) ,tunel (green) and DAPI (blue). By global immunofluorescence staining, it can be seen that no obvious TUNEL positive areas of nerve cells (green fluorescence indicates apoptosis) were found of the sham group.After MCAO/R, the right half of the brains in both groups showed obvious neuronal cell apoptosis (green). However, in the TFAP2B overexpression group, the apoptosis areas was significantly narrowed compared with the AAv-NC-Ov group (Fig. 7c). At the same time, the local results also showed that after MCAO/R, the AAv-TFAP2B-Ov group showed a lower neuronal apoptosis rate when compared with the AAv-NC-Ov group (Fig. 7d). These results proved that TFAP2B overexpression alleviated the MCAO/R damage to a certain extent in vivo

Although m6A related researches have been very popular in recent 5 years, the role of m6A in cerebral ischemia reperfusion injury was still very limited. The m6A modification was reported to be reversible and dynamically regulated by m6A writers and erasers [27]. Methyltransferases are the so-called m6A writers, mainly responsible for catalyzing the addition of m6A to target RNAs [28]. Demethylases are considered the m6A erasers which catalyze the removal of m6A, the two most famous are FTO and ALKBH5 [29]. The changes of m6A abundance of targets are generally caused by the upstream m6A writers or erasers. Relevant researches found that FTO expressions were decreased in the MCAO/R rat brain tissues and FTO could alleviate cerebral I/R injury CIRI [30,31]; Another study found that OGD/R and MCAO/R induce FTO upregulation in neurons and cerebral cortex[27].However, in our RNA-seq matched with MeRIP-seq, the desregulation of key m6A writers and erasers were not obvious. This may be the tissues we use for sequencing were not satisfactory enough, or it may implied there are other m6A modulators have not been explored. In addition, we found that the regulation of Mettl-3 on the m6A abundance of target genes could be directly confirmed by experiments without considering whether there is a significant difference in mRNA levels between groups [32]. This also seems to suggest that a significant change in the mRNA levels of m6A wrtiers /erasers do not seem to be a necessary prerequisite when studing the mechanism of a target specific m6A abundance.

Besides, according to the prediction of m6a2target (http://m6a2target.canceromics.org/)，Mettl-3 and ALKBH5 may have targeted regulatory relationship with TFAP2B, but neither considered to be m6A dependent. Lacking obvious clues, it is difficult for us to explore the mechanisms for the m6A abundance decreasement of TFAP2B in MCAO/R, we can only detect the m6a writers and erasers in primary rat neuron cells infected by corresponding lentivirus one by one, but we regret that we failed to do so at this stage.

As a transcriptional factor, in order to understand the downstream targets in neurons of TFAP2B, RNA-sequencing was performed in TFAP2B overexpressed and NC neurons. Through stricter bioinformatics screening, top25 upregulated and downregulated factors were uncovered. In DEGs that upregulated with TFAP2B overexpression, BNIP3, LCN2 and CSF-1 have been reported to protect against renal, cerebral or Cardiac I/R injury [33,23,34,18]. In DEGs that dowun-regulated with TFAP2B overexpression, DUSP5 was reported to induces autophagy inhibition [35]. Downregulation of BACH1 protects against Cerebral I/R [36]. GPR4 blockade attenuated renal injury after I/R and reduced the cell apoptosis [37]. These also suggested that TFAP2B may alleviate cerebral I/R injury through transcriptional regulation of multiple targets including other TOP DEGs without I/R related researches.

Mitophagy is a selective autophagy which degrades damaged mitochondria specifically to enable their components to be reused. Through selective removal and degradation of damaged mitochondria, the accumulation of mitochondrial DNA mutations was prevented and cellular metabolism was reprogramed by mitophagy [15]. Mitophagy is considerd to be beneficial for neuronal survival in Cerebral I/R [38,39]. Mitochondrial protein BNIP3, plays a critical role in mitophagy. BNIP3 deficiency leads to mitophagy defects in mammary tumor cells [14], and p53 inhibits the transcription of BNIP3 resulting in mitophagy stagnation [15]. What is more important is BNIP3-mediated mitophagy play protective roles in cerebral I/R injury [17,18]. Therefore, when the expression of BNIP3 was found to be upregulated in TFAP2B overexpressed neurons, it was speculated that TFAP2B transcriptionally activated BNIP3, then enhanced the mitophagy of mitochondria to protect against cerebral ischemia-reperfusion injury. Therefore, localization experiments with LC3 and mitro-green were set up to evaluate the mitophagy of TFAP2B overexpressed neurons with or without BNIP3-KD, respectively. Meanwhile, due to two rounds of lentivirus infection (Lv-TFAP2B-Ov, Lv-BNIP3-si) and OGD/R, there were few neurons available for subsequent experiments, so only QPCR assay was used to evaluate the changes in neuronal apoptosis.

Because of limited experimental funding and instrument configuration, there are still many imperfections in this study, this is the first study of transcription factor TFAP2B in CIRI research field with important guiding significance. It was found for the first time that the transcription factor TFAP2B was inhibited under the CIRI context, restoring TFAP2B expression could transcriptionally activated BNIP3, thereby enhanced the mitophagy of damaged mitochondria to protect against cerebral ischemia-reperfusion injury .

CIRI: Cerebral ischemia-reperfusion injury；

m6A: N6-methyladenosine；

MCAO/R: middle cerebral artery occlusion / reperfusion；

OGD/R: Oxygen-glucose deprivation-reperfusion;

RNA-seq: RNA-sequencing；

DEGs: Differential expression genes；

BNIP3: Bcl-2-interacting protein 3;

TFAP2B: Transcription factor activating enhancer-binding protein 2B;

Sequence data deposited ：NCBI-SRA database under project number of PRJNA973198 and PRJNA973199.

Author declarations

Ethics approval

Approval was obtained from the ethics committee of University Xiangya Second Hospital of Central South University (approval number: 2022632). The procedures used in this study adhere to the tenets of the Declaration of Helsinki.

Consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and materials

The sequence data generated during Me-RIP and RNA-seq are deposited into NCBI-SRA database (https://www.ncbi.nlm.nih.gov/sra/) under project number of PRJNA973198 and PRJNA973199. Other original experimental data could be available from the corresponding author on reasonable request.

Competing Interests

The authors have no competing interests to declare that are relevant to the content of this article.

Funding

This study was supported by [Natural Science Foundation of Hunan Province] (grant number 2021JJ40858).

Authors' contributions

[Yong Peng] and [Mengqiang Yu] contributed to the study conception and design. Material preparation, data collection and analysis were performed by [Jiaoying Jia], [Mingming Zhang] and [Wenjia Ma]. The first draft of the manuscript was written by [Yong Peng] and [Yan Cui], all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Liu MB, Wang W, Gao JM, Li F, Shi JS, Gong QH (2020) Icariside II attenuates cerebral ischemia/reperfusion-induced blood-brain barrier dysfunction in rats via regulating the balance of MMP9/TIMP1. Acta Pharmacol Sin 41 (12):1547-1556. https://doi:10.1038/s41401-020-0409-3
Han B, Zhang Y, Zhang Y, Bai Y, Chen X, Huang R, Wu F, Leng S, Chao J, Zhang JH, Hu G, Yao H (2018) Novel insight into circular RNA HECTD1 in astrocyte activation via autophagy by targeting MIR142-TIPARP: implications for cerebral ischemic stroke. Autophagy 14 (7):1164-1184. https://doi:10.1080/15548627.2018.1458173
Barer D, Berge E (2017) Thrombolytic Treatment for Ischaemic Stroke: Could the Crisis of Confidence Have Been Avoided by Better Analysis of Trial Data? Drugs Aging 34 (2):79-88. https://doi:10.1007/s40266-016-0432-8
Yi D, Wang Q, Zhao Y, Song Y, You H, Wang J, Liu R, Shi Z, Chen X, Luo Q (2021) Alteration of N (6) -Methyladenosine mRNA Methylation in a Rat Model of Cerebral Ischemia-Reperfusion Injury. Front Neurosci 15:605654. https://doi:10.3389/fnins.2021.605654
Zhang Y, Zhang Y, Jin XF, Zhou XH, Dong XH, Yu WT, Gao WJ (2019) The Role of Astragaloside IV against Cerebral Ischemia/Reperfusion Injury: Suppression of Apoptosis via Promotion of P62-LC3-Autophagy. Molecules 24 (9). https://doi:10.3390/molecules24091838
Li Y, Xiao J, Bai J, Tian Y, Qu Y, Chen X, Wang Q, Li X, Zhang Y, Xu J (2019) Molecular characterization and clinical relevance of m(6)A regulators across 33 cancer types. Mol Cancer 18 (1):137. https://doi:10.1186/s12943-019-1066-3
Shafik AM, Allen EG, Jin P (2020) Dynamic N6-methyladenosine RNA methylation in brain and diseases. Epigenomics 12 (4):371-380. https://doi:10.2217/epi-2019-0260
Ma C, Chang M, Lv H, Zhang ZW, Zhang W, He X, Wu G, Zhao S, Zhang Y, Wang D, Teng X, Liu C, Li Q, Klungland A, Niu Y, Song S, Tong WM (2018) RNA m(6)A methylation participates in regulation of postnatal development of the mouse cerebellum. Genome Biol 19 (1):68. https://doi:10.1186/s13059-018-1435-z
Mathiyalagan P, Adamiak M, Mayourian J, Sassi Y, Liang Y, Agarwal N, Jha D, Zhang S, Kohlbrenner E, Chepurko E, Chen J, Trivieri MG, Singh R, Bouchareb R, Fish K, Ishikawa K, Lebeche D, Hajjar RJ, Sahoo S (2019) FTO-Dependent N(6)-Methyladenosine Regulates Cardiac Function During Remodeling and Repair. Circulation 139 (4):518-532. https://doi:10.1161/CIRCULATIONAHA.118.033794
Tang C, Klukovich R, Peng H, Wang Z, Yu T, Zhang Y, Zheng H, Klungland A, Yan W (2018) ALKBH5-dependent m6A demethylation controls splicing and stability of long 3'-UTR mRNAs in male germ cells. Proc Natl Acad Sci U S A 115 (2):E325-E333. https://doi:10.1073/pnas.1717794115
Fu X, Zhang H, Chen Z, Yang Z, Shi D, Liu T, Chen W, Yao F, Su X, Deng W, Chen M, Yang A (2019) TFAP2B overexpression contributes to tumor growth and progression of thyroid cancer through the COX-2 signaling pathway. Cell Death Dis 10 (6):397. doi:10.1038/s41419-019-1600-7
Hara S, Kawasaki S, Yoshihara M, Winegarner A, Busch C, Tsujikawa M, Nishida K (2019) Transcription factor TFAP2B up-regulates human corneal endothelial cell-specific genes during corneal development and maintenance. J Biol Chem 294 (7):2460-2469. https://doi:10.1074/jbc.RA118.005527
Wu H, Zhang J (2018) Decreased expression of TFAP2B in endometrial cancer predicts poor prognosis: A study based on TCGA data. Gynecol Oncol 149 (3):592-597. https://doi:10.1016/j.ygyno.2018.03.057
Fu L, Shi K, Wang J, Chen W, Shi D, Tian Y, Guo W, Yu W, Xiao X, Kang T, Wang S, Huang W, Deng W (2014) TFAP2B overexpression contributes to tumor growth and a poor prognosis of human lung adenocarcinoma through modulation of ERK and VEGF/PEDF signaling. Mol Cancer 13:89. https://doi:10.1186/1476-4598-13-89
Cai Y, Yang E, Yao X, Zhang X, Wang Q, Wang Y, Liu J, Fan W, Yi K, Kang C, Wu J (2021) FUNDC1-dependent mitophagy induced by tPA protects neurons against cerebral ischemia-reperfusion injury. Redox Biol 38:101792. https://doi:10.1016/j.redox.2020.101792
Zhang W, Chen C, Wang J, Liu L, He Y, Chen Q (2018) Mitophagy in Cardiomyocytes and in Platelets: A Major Mechanism of Cardioprotection Against Ischemia/Reperfusion Injury. Physiology (Bethesda) 33 (2):86-98. https://doi:10.1152/physiol.00030.2017
Wu X, Zheng Y, Liu M, Li Y, Ma S, Tang W, Yan W, Cao M, Zheng W, Jiang L, Wu J, Han F, Qin Z, Fang L, Hu W, Chen Z, Zhang X (2021) BNIP3L/NIX degradation leads to mitophagy deficiency in ischemic brains. Autophagy 17 (8):1934-1946. https://doi:10.1080/15548627.2020.1802089
Yuan Y, Zheng Y, Zhang X, Chen Y, Wu X, Wu J, Shen Z, Jiang L, Wang L, Yang W, Luo J, Qin Z, Hu W, Chen Z (2017) BNIP3L/NIX-mediated mitophagy protects against ischemic brain injury independent of PARK2. Autophagy 13 (10):1754-1766. https://doi:10.1080/15548627.2017.1357792
Alberts MJ (2017) Stroke Treatment With Intravenous Tissue-Type Plasminogen Activator: More Proof That Time Is Brain. Circulation 135 (2):140-142. https://doi:10.1161/CIRCULATIONAHA.116.025724
He QW, Li Q, Jin HJ, Zhi F, Suraj B, Zhu YY, Xia YP, Mao L, Chen XL, Hu B (2016) MiR-150 Regulates Poststroke Cerebral Angiogenesis via Vascular Endothelial Growth Factor in Rats. CNS Neurosci Ther 22 (6):507-517. https://doi:10.1111/cns.12525
Zheng L, Tang X, Lu M, Sun S, Xie S, Cai J, Zan J (2020) microRNA-421-3p prevents inflammatory response in cerebral ischemia/reperfusion injury through targeting m6A Reader YTHDF1 to inhibit p65 mRNA translation. Int Immunopharmacol 88:106937. https://doi:10.1016/j.intimp.2020.106937
From the American Association of Neurological Surgeons ASoNC, Interventional Radiology Society of Europe CIRACoNSESoMINTESoNESOSfCA, Interventions SoIRSoNS, World Stroke O, Sacks D, Baxter B, Campbell BCV, Carpenter JS, Cognard C, Dippel D, Eesa M, Fischer U, Hausegger K, Hirsch JA, Shazam Hussain M, Jansen O, Jayaraman MV, Khalessi AA, Kluck BW, Lavine S, Meyers PM, Ramee S, Rufenacht DA, Schirmer CM, Vorwerk D (2018) Multisociety Consensus Quality Improvement Revised Consensus Statement for Endovascular Therapy of Acute Ischemic Stroke. Int J Stroke 13 (6):612-632. https://doi:10.1177/1747493018778713
Fu ZJ, Wang ZY, Xu L, Chen XH, Li XX, Liao WT, Ma HK, Jiang MD, Xu TT, Xu J, Shen Y, Song B, Gao PJ, Han WQ, Zhang W (2020) HIF-1alpha-BNIP3-mediated mitophagy in tubular cells protects against renal ischemia/reperfusion injury. Redox Biol 36:101671. doi:10.1016/j.redox.2020.101671
Li X, Gao Y, Chen W, Gu Y, Song J, Zhang J, Ai Y (2022) N6-methyladenosine modification contributes to arecoline-mediated oral submucosal fibrosis. J Oral Pathol Med:e13292. https://doi:10.1111/jop.13292
Liu M, Zhong J, Zeng Z, Huang K, Ye Z, Deng S, Chen H, Xu F, Li Q, Zhao G (2019) Hypoxia-induced feedback of HIF-1alpha and lncRNA-CF129 contributes to pancreatic cancer progression through stabilization of p53 protein. Theranostics 9 (16):4795-4810. https://doi:10.7150/thno.30988
O'Sullivan TE, Johnson LR, Kang HH, Sun JC (2015) BNIP3- and BNIP3L-Mediated Mitophagy Promotes the Generation of Natural Killer Cell Memory. Immunity 43 (2):331-342. https://doi:10.1016/j.immuni.2015.07.012
Xu K, Mo Y, Li D, Yu Q, Wang L, Lin F, Kong C, Balelang MF, Zhang A, Chen S, Dai Q, Wang J (2020) N(6)-methyladenosine demethylases Alkbh5/Fto regulate cerebral ischemia-reperfusion injury. Ther Adv Chronic Dis 11:2040622320916024. https://doi:10.1177/2040622320916024
Chai RC, Wu F, Wang QX, Zhang S, Zhang KN, Liu YQ, Zhao Z, Jiang T, Wang YZ, Kang CS (2019) m(6)A RNA methylation regulators contribute to malignant progression and have clinical prognostic impact in gliomas. Aging (Albany NY) 11 (4):1204-1225. https://doi:10.18632/aging.101829
Rajecka V, Skalicky T, Vanacova S (2019) The role of RNA adenosine demethylases in the control of gene expression. Biochim Biophys Acta Gene Regul Mech 1862 (3):343-355. https://doi:10.1016/j.bbagrm.2018.12.001
Hou L, Li S, Li S, Wang R, Zhao M, Liu X (2023) FTO inhibits oxidative stress by mediating m6A demethylation of Nrf2 to alleviate cerebral ischemia/reperfusion injury. J Physiol Biochem 79 (1):133-146. https://doi:10.1007/s13105-022-00929-x
Yu Z, Zheng L, Geng Y, Zhang Y, Wang Y, You G, Cai M, Li M, Cheng X, Zan J (2023) FTO alleviates cerebral ischemia/reperfusion-induced neuroinflammation by decreasing cGAS mRNA stability in an m6A-dependent manner. Cell Signal 109:110751. https://doi:10.1016/j.cellsig.2023.110751
Xu S, Li Y, Chen JP, Li DZ, Jiang Q, Wu T, Zhou XZ (2020) Oxygen glucose deprivation/re-oxygenation-induced neuronal cell death is associated with Lnc-D63785 m6A methylation and miR-422a accumulation. Cell Death Dis 11 (9):816. https://doi:10.1038/s41419-020-03021-8
Alikhan MA, Jones CV, Williams TM, Beckhouse AG, Fletcher AL, Kett MM, Sakkal S, Samuel CS, Ramsay RG, Deane JA, Wells CA, Little MH, Hume DA, Ricardo SD (2011) Colony-stimulating factor-1 promotes kidney growth and repair via alteration of macrophage responses. Am J Pathol 179 (3):1243-1256. https://doi:10.1016/j.ajpath.2011.05.037
Qiu S, Chen X, Pang Y, Zhang Z (2018) Lipocalin-2 protects against renal ischemia/reperfusion injury in mice through autophagy activation mediated by HIF1alpha and NF-kappab crosstalk. Biomed Pharmacother 108:244-253. https://doi:10.1016/j.biopha.2018.09.023
Wang J, Cao B, Han D, Sun M, Feng J (2017) Long Non-coding RNA H19 Induces Cerebral Ischemia Reperfusion Injury via Activation of Autophagy. Aging Dis 8 (1):71-84. doi:10.14336/AD.2016.0530
Yu S, Zhai J, Yu J, Yang Q, Yang J (2020) Downregulation of BACH1 Protects AGAINST Cerebral Ischemia/Reperfusion Injury through the Functions of HO-1 and NQO1. Neuroscience 436:154-166. https://doi:10.1016/j.neuroscience.2020.04.014
Dong B, Zhang X, Fan Y, Cao S, Zhang X (2017) GPR4 knockout improves renal ischemia-reperfusion injury and inhibits apoptosis via suppressing the expression of CHOP. Biochem J 474 (24):4065-4074. https://doi:10.1042/BCJ20170676
Baek SH, Noh AR, Kim KA, Akram M, Shin YJ, Kim ES, Yu SW, Majid A, Bae ON (2014) Modulation of mitochondrial function and autophagy mediates carnosine neuroprotection against ischemic brain damage. Stroke 45 (8):2438-2443. https://doi:10.1161/STROKEAHA.114.005183
Zhang X, Yan H, Yuan Y, Gao J, Shen Z, Cheng Y, Shen Y, Wang RR, Wang X, Hu WW, Wang G, Chen Z (2013) Cerebral ischemia-reperfusion-induced autophagy protects against neuronal injury by mitochondrial clearance. Autophagy 9 (9):1321-1333. https://doi:10.4161/auto.25132

Download PDF

Journal Publication

published 21 Feb, 2024

Read the published version in Molecular Neurobiology →

Reviewers agreed at journal
05 Oct, 2023
Reviewers invited by journal
02 Oct, 2023
Editor invited by journal
24 Aug, 2023
Editor assigned by journal
04 Aug, 2023
First submitted to journal
02 Aug, 2023

You are reading this latest preprint version

Transcription factor TFAP2B exerts neuroprotective effects targeting BNIP3 mediated mitophagy in ischemia/ reperfusion injury

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and methods

Middle cerebral artery occlusion / reperfusion model and experimental groups

MeRIP-Sequencing, RNA-Sequencing and Data Analysis

Cell culture and oxygen-glucose deprivation reperfusion

Lentivirus infection of neurons

Quantitative real-time PCR (QPCR), m6A-specific QPCR and western blotting

EdU incorporation assay

Flow cytometry

TUNEL staining

Nissle and immunofluorescence multiple staining

Luciferase reporter assay

Statistical analysis

Results

Overviews of the MeRIP-sequencing and RNA-sequencing profiles in MCAO/R Rats

TFAP2B standed out based on combinant interactive bioinformatics analyses of the MeRIP and RNA-sequencing data

TFAP2B was inhibited in primary neurons under the OGD/R context

TFAP2B effectively improved the survival of OGD/R induced primary neurons

TFAP2B overexpression alleviated the MCAO/R damage to a certain extent in vivo

Discussion

Abbreviations

Declarations

References

Status:

Journal Publication

Version 1