EMCV Replication in BHK-21 in Vitro is Mediated by Caveolin-1, Actin, Dynamin-Dependent Endocytic Pathway

doi:10.21203/rs.3.rs-32102/v1

Download PDF

Research article

EMCV Replication in BHK-21 in Vitro is Mediated by Caveolin-1, Actin, Dynamin-Dependent Endocytic Pathway

https://doi.org/10.21203/rs.3.rs-32102/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Encephalomycarditis virus is a member of Cardiovirus, belongs to the family Picornaviridae, and can infect different domestic and wild animals. However, the endocytic pathway by which EMCV infected BHK-21 cells remains unclear. In this study, endocytic pathway used by EMCV replication in BHK-21 cells was elucidated.

Methods: The function of numerous cellular key factors implicated in the various endocytic mechanisms known to date were systematic detected using chemical inhibitors. Furthermore, RNA interference (RNAi) silencing, the overexpression of dominant protein combined to virus infectivity assays, and confocal imaging to examine which cellular molecules involved in the infection process were also analyzed.

Results: The results indicated that the EMCV replication was related to endocytosis. However, neither clathrin nor macropinocytosis pathway was involved in virus infection. QRT-PCR and WB analyses showed that caveolin-1 were significantly up-regulated in EMCV infected BHK-21 cells. Immune-fluorescent confocal microscopy analysis showed that caveolin-1 was temporally co-localized with EMCV VP1 at the early stage of EMCV infection. Overexpressed caveolin-1 or downregulated caveolin-1 expression influenced the EMCV infection. Furthermore, EMCV infection was found to depend on dynamin and actin by chemical inhibitors resulted in diminished of virus infection.

Conclusions: EMCV replication in BHK-21 cells via caveolin-1, dynamin, and actin-dependent endocytosis pathways.

Infectious Diseases

Endocytosis

Encephalomycarditis virus

BHK-21

Caveolin-1

Clathrin

Macropinocytosis

Dynamin

Actin

Encephalomycarditis virus (EMCV) is a member of the genus Cardiovirus in the Picornaviridae family and consists of positive single-stranded RNA genome [1, 2]. The virus was first isolated from a captive male gibbon [3] and now it has been isolated from wide range of animal species in the world [4-7]. EMCV is a well-recognized model to study the mechanisms of antiviral immunity, virus myocarditis, and insulin dependent diabetes mellitus [8, 9]. However, the mechanisms involved in the internalization of cardioviruses are unclear [2, 8].

Viruses replication in permissive cells dependent on multiple endocytic pathways, such as macropinocytosis-dependent, clathrin-dependent, caveolin-dependent, and clathrin- and caveolin-independent [10-12]. The Picornaviridae family contains a bunch of pathogenic viruses, such as echovirus 1 (EV1), coxsackievirus B3 (CBV3), poliovirus (PV), and foot-and-mouth-disease virus (FMDV). The Picornaviridae family viruses enter by one or more pathway to infect cells. Pietia¨inen et al showed that EV1 entry to CV-1 cells via dynamin-dependent pathway [13]. PV infect different host cells using different endocytic pathway, it enter into Hela cells was clathrin- and caveolin-independent, whereas, it enter in brain microvascular endothelial cells was caveolin- and dynamin-dependent [14-16]. CBV3 enters in HeLa cells by clathrin-mediated endocytosis pathway [17] and coxsackie virus A9 enters into A549 cells is mediated by dynamin, β2-microglobulin, and Arf6 [12]. FMDV internalization is mediated by clathrin-dependent pathway [18-20]. On basis of the above mention facts, we hypothesized that, as a member of the family Picornaviridae, whether EMCV may also use the endocytic mechanisms to infect BHK-21 cells.

In this study, endocytic pathway used by EMCV replication in BHK-21 cells was elucidated. The function of numerous cellular key factors implicated in the various endocytic mechanisms known to date were systematic detected using chemical inhibitors. Furthermore, RNA interference (RNAi) silencing, the overexpression of dominant protein combined to virus infectivity assays, and confocal imaging to examine which cellular molecules involved in the entry process were also analyzed. At first, we confirmed that the EMCV replication was related to endocytosis. Subsequently, we demonstrated that neither clathrin nor macropinocytosis pathway was involved in virus infection. We have shown that EMCV replication into the BHK-21 cells via caveolin-mediated and dynamin-dependent pathway.

2.1. Cells, viruses, and antibodies.

BHK-21 cells were provided by the Gansu Tech Innovation Center of Animal Cell (Lanzhou, China). BHK-21 cells were maintained in DMEM (Minhai Bio-engineering) supplemented with 10% FBS (Minhai Bio-engineering). Cells were cultured in the incubator at 37 °C with 5% CO₂.

The EMCV strain used in the current study was the BHK-21 cells adapted EMCV (GenBank: X74312) and its titer was 10^6.0 TCID₅₀ ml^-1. The plaque-forming unit (PFU) was calculated according to previously literatures [21].

Mouse monoclonal antibody (mAb) against Caveolin-1 and rabbit polyclonal antibody (pAb) anti-Caveolin-1 were bought from Beyotime. MAb against beta-actin was from Abcam. MAb against EMCV-VP1 was kindly donated by Dr. Juan Bai (College of Veterinary Medicine, Nanjing Agricultural University). The HRP-labeled secondary antibody, Alexa fluor-488-conjugated anti-mouse and Cy^TM3-conjugated anti-rabbit IgG (H+L) were from Jackson ImmunoResearch Laboratories.

2.2. qRT-PCR

Total RNA was isolated, followed by qRT-PCR as previously reported [22], with primers EMCV-3D qF: GTCATACTATCGTCCAGGGACTCTAT and 3D qR: CATCTGTACTCCACACTCTCGAATG. GAPDH was used as the internal reference, the primers sequence is GAPDH qF: AAGGCCATCACCATCTTCCA and GAPDH qR: GCCAGTAGACTCCACAACATAC.

2.3. Gene overexpression and RNA interference

To evaluate the effect of Caveolin-1 in the infection as well as invasion of EMCV into BHK-21 cells, the replication-defective lentivirus system provided by Dr. Enqi Du (Northwest A&F University, China), was used to construct a recombinant plasmid to overexpress caveolin-1. Total RNA was extracted from BHK-21 cells and reverse transcribed into cDNA. The caveolin-1 gene was amplified by PCR based on the murine caveolin-1 sequence in GenBank (accession No. U07645.1). The amplified PCR products were digested by restriction endonuclease XbaI and BamH I (NEB, MA, USA) and inserted pTRIP-CMV-IRES-Puro. The recombinant plasmid named pTRIP-CAV1 using the primers listed in Table 1. As a control, EGFP has been constructed by using the methods and named pTRIP-EGFP. Lentivirus was produced with recombinant lentivirus vector pTRIP-CAV1 and pTRIP-EGFP according to the reference [23], the transfection cells were named BHK-CAV1 and BHK-EGFP, respectively.

Gene	Primer sequence （5´-3´）	Size (bp)
Caveolin-1	F:GCTCTAGAATGTCTGGGGGCAAATACGTGGACTC	537
Caveolin-1	R:CGGGATCCTCATATCTCTTTCTGCGTGCTGATGC	537

Table 1

Caveolin-1 overexpresses primer sequences

Moreover, we designed three individual small interfering RNA (siRNA) against caveolin-1 (Rebobio, Guangdong, China) and cells were transfected. The sequence of the siRNA strands has been showed in Table 2. The transfection of the siRNA was performed with Invitrogen Lipofectamine™ 2000 (ThermoFisher, MA, USA) by following the manufacturer's instructions. The silencing efficiencies were measured by qRT-PCR and WB analysis. After culturing for 2 days, the cells were infected with EMCV. At 9 hours post-infection (hpi), WB and virus infectivity assays were performed.

Name of siRNA	Sequence(5’-3’)
Mus-Cav1-siRNA1	GCAACATCTACAAGCCCAA
Mus-Cav1-siRNA2	CCACCTTCACTGTGACAAA
Mus-Cav1-siRNA3	CATCAAGAGCTTCCTGATT

Table 2

The sequence of the caveolin-1 siRNA

2.4. Chemical inhibitors and Cell viability Determination

DMEM supplemented with 10% FBS and one of the following chemical inhibitors: Nystatin, Pitstop, dynasore, mitmab, cytochalasin D, jasplakinolide and 1,1'-Dithiobis-2-naphthalenol (IPA-3) were purchased from Abcam. Methyl-β-cyclodextrin (MβCD) and NH₄Cl were purchased from Sigma (Sigma, MO, USA), bafilomycin A1 and wortmannin were purchased from Solarbio (Solarbio, Beijing, China). The effects of inhibitors on cells were confirmed by the cell viability assay (see below). The inhibitors were present for 1 hr before and throughout the EMCV infection assay.

After RNA interference and chemical inhibitors treatment, the cell viability was conducted by the CellTiter 96^® Aqueous Non-Radioactive Cell Proliferation Assay kit (Promega, WI, USA) according to the protocol.

2.5. Virus infectivity assays, Post-entry inhibitory effects and detection of virus internalization

For virus infectivity assays, cells were incubated with EMCV at 0.1 multiplicity of infection (MOI) for 1 hr at 37°C in serum-free medium and then washed three times with pre-warmed phosphate-buffered saline (PBS) and maintained in DMEM with 3% FBS. The virus replication was examined by virus yield titration, qRT-PCR and western blotting.

For post-entry inhibitory effects, cells were incubated with EMCV at 0.1 MOI. 2hrs later, the free viruses were washed by PBS and culture medium containing chemical inhibitors was added in cells. Cells incubated for 9 hpi were harvested for further analysis [24].

The ability of EMCV internalized to BHK-21 cells, BHK-Cav1 and BHK-EGFP were determined by measuring the quantity of infectious virus. For binding assay, cells were infected by 1 MOI EMCV at 37°C. 1hr later, cells were washed five times and prepared by three cycles of freeze-thaw [25]. The last wash solution was collected and titrated on BHK-21 to determine the quantity of the virus present after washing [26].

2.6. IFA and Confocal microscopy

Cells were fixed with ice cooling 75% ethanol at 4°C for 30 min. For Co-localization studies, cells were permeabilized with 0.1% Triton X-100 when needed. After washed slides in PBS, the suitable primary antibody was added and incubated at 37°C. 1 hr later, the slides were washed again and 100μl secondary flurescen antibody was added to the samples. Then the sample was incubated for 1 hr. Finally, the samples counterstained with 4, 6-diamidino-2-phenylindole (DAPI) for 5 min at room temperature. An Olympas IX73 inverted fluorescence microscope (Olympas, Japan) or confocal microscope ZEISS LSM 900 was used to mount and analyze (Zeiss, Oberkochen, Germany).

2.7. Western Blotting (WB)

Samples were lysed in NP-40 lysis buffer (Beyotime, Shanghai, China) and concentration was measured using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, A，USA), and then heated 95°C 5 min. Denature sampls run in 10% gel and transfered to PVDF membrane (Millipore, MA, USA). After incubated in 5% milk for 1hr, the membrane was incubated with the primary antibody overnight at 4°C and then treated with HRP-conjugated secondary antibody for 2 hrs at room temperature. The specific bands were obtained with chemiluminescence (Cowin Bioscience, Beijing, China). Protein ladders were from YEASEN (Yeasen Biotech, Shanghai, China).

2.8. Statistical analyses

The results were analyzed by with one-way ANOVA using Graphpad PRISM Version 5.0 software. All data were shown as the means ± standard deviations (SD). Differences were considered statiscally significant if P-value was less than 0.05 (*P<0.05; **P<0.01; ***P<0.001).

3.1. The role of endocytosis in EMCV replication in BHK-21 cells

To elucidate whether the endocytic pathway correlated with EMCV replication in BHK-21 cells, endocytosis specific inhibitors were used. Concentration and effects of the inhibitors applied in this study were described in Table 3. The suitable non-toxic concentration of inhibitors was measured by the CellTiter 96^® Aqueous Non-Radioactive Cell Proliferation Assay kit (data not shown).

Chemical inhibitor	Effect	Concentration
NH4Cl	Inhibits pH-dependent activation of the fusion protein	10mM /20mM
Bafilomycin A1	Vacuolar-type ATPase inhibitor	10nM /20nM
Chlorpromazine	Inhibits clathrin-dependent endocytosis	5μM/10μM
Pitstop-2	Cell-permeable clathrin inhibitor	5μM/10μM
Nystatin	Disrupts caveolae	12.5μg/25μg
MβCD	Extracts cholesterol from lipid membranes	2.5mM/5mM
Dynasore	Inhibits GTPase activity	20μM/40μM
Mitmab	Blocks the lipid binding	5μM/10μM
Cytochalasin D	Disrupts actin polymerization	5μM/10μM
Jasplakinolide	Stabilizes actin microfilaments	5μM/10μM
IPA-3	the Pak-1 inhibitor	7.5μM/15μM
Wortmannin	the PI3K inhibitor	5μM/10μM

Table 3

Chemical inhibitors used in this study

Previous research finds that NH₄Cl can hamper the endosomal entry of viruses through preventing pH-dependent activation of the fusion protein and blocking membrane fusion [27]. In this experiment, BHK-21 cells were firstly treated with NH₄Cl and then incubated with the virus in the presence of NH₄Cl. Afterwards; the media was exchanged to remove unbound viruses. Infection process was sustained for 12 hrs and monitored with virus titer assay and qRT-PCR. As shown in Figure 1A and Figure 1B, we found that expression of EMCV-3D and virus titer was significantly decreased in EMCV positive cells compared to control cells in dose dependent manner. This indicated that EMCV infection is sensitive to inhibition of endosomal acidification. Next, Bafilomycin A1, another inhibitor of endocytic compartment acidification was tested [28]. The trend of bafilomycin A1 was as same as NH₄Cl, also limited the EMCV infection. Additionally, our results showed that 10nM bafilomycin A1 could not block virus replication at 10nM (Fig. 1C and 1D, P＞0.05), while 20nM bafilomycin A1 could enhance the proliferation of EMCV (Fig. 1C and 1D, P＜0.05, P＜0.001).

Consequently, to test whether EMCV enters into cells via endocytosis, the co-localization of viral particles with early endosome antigen 1 (EEA1) was examined at 9 hpi. As shown in Figure 2, co-localization of VP1 and EEA1 could be observed.

Next, we examined which endocytic pathway, including the clathrin-dependent pathway, macropinocytosis and caveolin-dependent pathway, [12, 29], was utilized by EMCV to infect BHK-21 cells.

3.2. Clathrin-mediated endocytosis is not involved in EMCV replication in BHK-21 cells

As Clathrin-mediated endocytosis is often related to endosomal acidification [30] and is a classical pathway for most viruses to enter into host cells [11]. Therefore, we next detected whether EMCV enters into BHK-21 cells through clathrin-mediated endocytosis. Cells were treated with chlorpromazine and Pitstop-2 [31, 32], and their effects on EMCV infection were determined by WB and virus titers assay. VP1 is a structural protein of EMCV, and its expression correlates with the density of EMCV virions, indicating the level of EMCV replication. Compared to control cells, BHK-21 cells treated with increased concentrations of chlorpromazine or Pitstop-2 had no significant influence on expression of viral structural proteins VP1 in EMCV infected cells (Figure 3A, 3C). Similarly, progeny virus was no significant decrease in chlorpromazine or PitStop-2 pretreated BHK-21 cells (Figure 3B, 3D).

3.3. EMCV replication in BHK-21 cells does not depend on macropinocytosis

To check whether the virus replicate via macropinocytosis, BHK-21 cells were treated by the NA⁺/H⁺ exchanger inhibitor EIPA, the Pak-1 inhibitor (1,1′-Dithiobis-2-naphthalenol, IPA-3), and the PI3K inhibitor wortmannin [33]. Virus infectivity assay showed that neither IPA-3 nor wortmannin affected on virus replication (Figure 4).

3.4. Caveolae is required for EMCV replication in BHK-21 cells.

Next, we investigated whether the caveolae-dependent pathway was involved in EMCV infection. Caveolae is rich in cholesterol and sphingolipids and can be disrupted by nystatin or MβCD [29]. As shown in Figure 5, cells treated with 12.5 μg/ml and 25 μg/ml nystatin or MβCD before added virus inhibited EMCV proliferation. However, their effect was limited when added after infection (Supplementary Figure 1).

3.5. Caveolin-1 expression is positively correlated with the infection of EMCV

Caveolin-1 is a main structural protein of caveolae and correlated with many viruses to internalize into host cells [34]. In order to explore whether EMCV used caveolin-1 during its infection, the expression of caveolin-1 during EMCV infection was investigated. As shown in the results of qRT-PCR, caveolin-1 mRNA expression of cells infected with EMCV increased significantly compared to control cells (Figure 6A). At protein level, we also found that caveolin-1 expression level of infected cells was increased in a time-dependent manner, which was consistent with the expression of the EMCV VP1 protein (Figure 6B).

3.6. Caveolin-1 is required for EMCV replication in BHK-21 cells.

To further investigate the impact of caveolin-1 expression changes on EMCV infection, caveolin-1 overexpression and siRNA assays were carried out. BHK-Cav1 and BHK-EGFP cells were cultured in medium without puromycin at least for 2 weeks prior to EMCV infection. Then BHK-Cav1 and BHK-EGFP cells were incubated with 0.1 MOI EMCV at 37°C for 1 hr. As shown in Figure 7A, the mRNA expression of EMCV-3D in the BHK-Cav1 cells was significantly higher compared to BHK-21 cells as well as BHK-EGFP cells infected with EMCV. WB analyses showed that the expression of VP1 was significantly higher in BHK-Cav1 cells compared to control cells (Figure 7B). Consisted of WB results, BHK-Cav1 induced rapidly increase of virus titer (Figure 7C).

Next, RNA interference inhibited the caveolin-1 expression in BHK-21 cells (Figure 8A), and correspondingly, the amounts of VP1 (Figure 8A), titers of progeny virus (Figure 8B) and virus copies (Figure 8C) were also decreased. Above mention results verified that EMCV replication was directly affected by caveolin-1 siRNA. Additionally, we performed the same experiment using BHK-Cav1 cells. The results indicated that down-regulated expression of the caveolin-1 significantly inhibited the virus replication (Figure 8D, 8E, 8F). To ensure the effect of caveolin-1, we examined the co-localization of virus particles with caveolin-1 by confocal imaging. As shown in Figure 9, after exposed to the EMCV for 120 min, EMCV-VP1 co-localized with caveolin-1 could be observed in infected BHK-21 cells.

3.7. Caveolin-1 is essential for EMCV infection by involving in internalization

To investigate the contribution of caveolin-1 to EMCV internalization, the involvement of caveolin-1 in EMCV endocytosis was studied by measuring virus proliferation in cells down-regulated caveolin-1 or BHK-Cav1. Figure 10A and 10B showed that BHK-Cav1 resulted in increasing EMCV internalization efficiency compared to BHK-EGFP or BHK-21 cells (P＜0.05, P＜0.001). Consistent with the results of caveolin-1 overexpressed, siRNAs which effectively restrain caveolin-1 expression inhibited the EMCV internalization (P<0.01) compared to control (Figure 10C and 10D).

3.8. Dynamin is needed for EMCV replication in BHK-21 cells

Dynamin is a kind of large GTPase that can promote the split of endocytic membranes [12]. It was considered to participate in both clathrin-dependent endocytosis and several other endocytic pathways [35]. Therefore, we hypothesized whether dynamin played a role in EMCV replication. Two inhibitors which inhibited the GTPase activity (dynasore) [36, 37] or blocked the lipid-binding (MiTMAB) were selected [38]. As shown in Figure 11, all these two inhibitors affected virus replication when incubated with BHK-21 before infection. However, their effects were limited when added into BHK-21 postinfection (Supplementary Figure 2).

3.9. Role of actin in EMCV infection in BHK-21 cells

The results suggested that EMCV enter into BHK-21 cells via caveolin- and dynamin-dependent endocytosis. Next, the role of the cytoskeleton during virus entry was examined by actin disrupting agent (cytochalasin D) and stabilizing compound (jasplakinolide) [39, 40]. We found that both actin-stabilizing jasplakinolide and actin-disrupting agent cytochalasin D inhibited EMCV infection in a statistically significant manner (Figure 12). Disrupting actin filaments led to a reduction (P<0.05) in viral infection, filament stabilization also affected virus yield. However, the post-entry treatment showed that viral infection was not affected when inhibitors added after virus incubated (Supplementary Figure 3).

Endocytosis is a key factor for viruses to infect permissive cells. First, we supposed whether replication of EMCV in BHK-21 cells is related to endocytosis. lysosomotropic agents sensitivity is considered a good evidence of endocytosis [41]; therefore, we pretreated cells with different inhibitors (NH₄Cl or Baflomycin A1) of endosome acidification. Both reagents partly stop the virus infection (Figure 1 and Figure. 2), suggesting that endocytosis took part in EMCV infection.

As both enveloped and nonenveloped viruses, such as HIV [42], adenovirus [43], foot-and-mouth disease virus [44], MRV [45] and BTV [46, 47], enter into host cells through a clathrin-mediated pathway. In this study, the concentration of viral structural proteins and viral titers were not significantly decreased by treatment with clathrin specific inhibitors (Figure 3). These results suggested that clathrin-mediated endocytosis might be not an essential pathway for EMCV infection.

Next, we supposed whether macropinocytosis-dependent pathway may be involved in EMCV infection. First, cells were pretreated with macropinocytosis specific inhibitor such as EIPA, IPA-3, wortmannin and then infected with the EMCV virus. Our results showed that these inhibitors did not affect EMCV replication (Figure 4). These results indicated that macropinocytosis is not involved in EMCV infection.

Except clathrin-dependent endocytosis, lipid raft and caveolae-dependent endocytosis are alternative endocytic pathways [35, 48]. It has been reported that MβCD could inhibit the CAV9 infection via lipid microdomains [49], we hypothesised that EMCV infected BHK-21 cells via caveolar/lipid rafts endocytosis. We found that EMCV infection significantly decreased in MβCD and nystatin treated cells compared to control cells before incubated with EMCV (Figure 5), while their effect was limited when added after infection (Supplementary Figure 1). The results indicated that caveolae are essential during EMCV entry BHK-21 cells.

Caveolin-1 is a main structural protein of caveolae and has various functions in endosomal membrane traffic and other cellular processes, such as endocytosis, signal transductions, protein trafficking and secretion [50-53]. Additionally, caveolin-1 is also involved in many viruses entry process, such as HIV [54], Aquareoviruses [55], coronavirus [34], HCV [56], RSV [57], CSFV [58]. As EMCV infection regulated the caveolin-1 expression level (Figure 6), we supposed whether caveolin-1 was involved in the EMCV replication. We transfected BHK-21 cells with caveolin-1 siRNAs and found that EMCV infectivity significantly decreased compared to control cells (Figure 8). While, overexpression of caveolin-1 significantly increase the virus infectivity compared to control cells (Figure 7). These results suggested that caveolin-1 was required for EMCV infection.

Entry into a permissive cell is an important stage in multiplication cycle of virus [11, 48], different viruses exploit different cellular endocytic mechanisms to initiate internalization and infection [59]. We next examined whether caveolin-1 played any role in EMCV internalization. The EMCV internalization was strongly inhibited when caveolin-1 was downregulated (Figure 10A and Figure. 10B) while EMCV internalization was increased by overexpression caveolin-1 (Figure. 10C and Figure. 10D). These findings, together with the results of co-localization (Figure. 9) indicated that caveolin-1 is required for the early stage of EMCV infection.

Either overexpressed dominant-negative mutants of dynamin or disrupted actin assembly can block caveolae-mediated endocytosis [29, 60]. Therefore, we supposed whether dynamin and actin involved in EMCV infection in BHK-21 cells. Two inhibitors of dynamin (dynasore and MiTMAB) were used. Both inhibitors affected virus replication when added before infection (Figure 11), it might be suggested that dynamin had a role in EMCV replication. However, neither dynasore nor MiTMAB blocked EMCV infection when added after infection (Supplementary Figure 2), this showed that there are some other possible pathways involved in virus entry process.

Lastly, we studied the role of the cytoskeleton during EMCV infection using Cytochalasin D and jasplakinolide. Cytochalasin D inhibits actin subunits the polymerization, whereas jasplakinolide inhibits the polymerization to stabilize filaments [39, 61, 62]. We discovered that virus replication was decreased in cells pretreated with cytochalasin D and jasplakinolide (Figure 12) but their effect was limited when added after infection (Supplementary Figure 2). Our results suggested that both actin filaments and actin reorganization are required for EMCV infection/entry.

In conclusion, our study disclosed for the first time that EMCV replication in BHK-21 cells via Caveolin-1, dynamin, and actin-dependent endocytosis pathways. Both confocal image and biochemical assays endorsed it. Comprehensive understanding of the mechanism of interaction between the EMCV and host cell is important to understand the viral pathogenesis. Further Functional studies investigating mechanisms of EMCV binding and entry into host cell response to EMCV infection are needed.

EMCV: Encephalomycarditis virus; DMEM: Dulbecco’s Modified Eagle medium; FBS: fetal bovine serum; MEM: minimum essential medium; PFU: plaque-forming unit; WB: Western Blotting; mAb: monoclonal antibody; pAb: polyclonal antibody; qRT-PCR: Quantitative reverse transcription polymerase chain reaction; IFA: indirect immunofluorescence assay; DAPI: 4,6-diamidino-2-phenylindole; MOI: multiplicity of infection; hpi: hour post infection.

Acknowledgements

We thank Dr. Enqi Du (Northwest A&F University, China) for providing the replication-defective lentivirus system; Dr. Juan Bai (Nanjing Agricultural University, China) for his kindly supplied the EMCV-VP1 mAb, Prof. Zulqarnain Baloch for critical reading of our manuscript.

Funding

This work is supported by the National Natural Science Foundation of China (31702234, 31860696), the Fundamental Research Funds for the Central Universities in the Northwest Minzu University (No. 31920180123, 31920190003), the project of Talent introduction for NWMU (No. xbmuyjrc201627); funds from Gansu Education Departmentand (No. 2018B-018); the program for Changjiang Scholars and Innovative Research Team in University (No. IRT_17R88)

Data Availability

All data included in the manuscript and the Supplementary Files are available.

Author Contributions

Jialin Bai and Ruofei Feng were the project leader, Qiongyi Li were responsible for experimental and project design. Qiongyi Li and Yang Liu performed most of the experiments. Shujuan Xu and Kexue Zhao performed some of the experiments. Ying Ling and Rongxiu Liu prepared the samples. Data analysis was performed by Xiangrong Li and Haixia Zhang. The paper was written by Qiongyi Li.

Conflicts of Interest

The authors declare that there is no conflict of interest.

Matthews RE: The classification and nomenclature of viruses. Summary of results of meetings of the International Committee on Taxonomy of Viruses in The Hague, September 1978. Intervirology 1979, 11(3):133-135.
Carocci M, Bakkali-Kassimi L: The encephalomyocarditis virus. Virulence 2012, 3(4):351-367.
Helwig FC, Schmidt CH: A Filter-Passing Agent Producing Interstitial Myocarditis In Anthropoid Apes And Small Animals. Science 1945, 102(2637):31-33.
Canelli E, Luppi A, Lavazza A, Lelli D, Sozzi E, Martin AM, Gelmetti D, Pascotto E, Sandri C, Magnone W et al: Encephalomyocarditis virus infection in an Italian zoo. Virology journal 2010, 7:64.
Maurice H, Nielen M, Brocchi E, Nowotny N, Kassimi LB, Billinis C, Loukaides P, O'Hara RS, Koenen F: The occurrence of encephalomyocarditis virus (EMCV) in European pigs from 1990 to 2001. Epidemiology and infection 2005, 133(3):547-557.
Reddacliff LA, Kirkland PD, Hartley WJ, Reece RL: Encephalomyocarditis virus infections in an Australian zoo. Journal of zoo and wildlife medicine : official publication of the American Association of Zoo Veterinarians 1997, 28(2):153-157.
Billinis C: Encephalomyocarditis virus infection in wildlife species in Greece. Journal of wildlife diseases 2009, 45(2):522-526.
Bazzone LE, King M, MacKay CR, Kyawe PP, Meraner P, Lindstrom D, Rojas-Quintero J, Owen CA, Wang JP, Brass AL et al: A Disintegrin and Metalloproteinase 9 Domain (ADAM9) Is a Major Susceptibility Factor in the Early Stages of Encephalomyocarditis Virus Infection. mBio 2019, 10(1).
Zhu Q, Tan P, Li Y, Lin M, Li C, Mao J, Cui J, Zhao W, Wang HY, Wang RF: DHX29 functions as an RNA co-sensor for MDA5-mediated EMCV-specific antiviral immunity. PLoS pathogens 2018, 14(2):e1006886.
Burkard C, Verheije MH, Wicht O, van Kasteren SI, van Kuppeveld FJ, Haagmans BL, Pelkmans L, Rottier PJ, Bosch BJ, de Haan CA: Coronavirus cell entry occurs through the endo-/lysosomal pathway in a proteolysis-dependent manner. PLoS pathogens 2014, 10(11):e1004502.
Marsh M, Helenius A: Virus entry: open sesame. Cell 2006, 124(4):729-740.
Heikkila O, Susi P, Tevaluoto T, Harma H, Marjomaki V, Hyypia T, Kiljunen S: Internalization of coxsackievirus A9 is mediated by {beta}2-microglobulin, dynamin, and Arf6 but not by caveolin-1 or clathrin. Journal of virology 2010, 84(7):3666-3681.
Pietiainen V, Marjomaki V, Upla P, Pelkmans L, Helenius A, Hyypia T: Echovirus 1 endocytosis into caveosomes requires lipid rafts, dynamin II, and signaling events. Molecular biology of the cell 2004, 15(11):4911-4925.
Bergelson JM: New (fluorescent) light on poliovirus entry. Trends in microbiology 2008, 16(2):44-47.
Brandenburg B, Lee LY, Lakadamyali M, Rust MJ, Zhuang X, Hogle JM: Imaging poliovirus entry in live cells. PLoS biology 2007, 5(7):e183.
Coyne CB, Kim KS, Bergelson JM: Poliovirus entry into human brain microvascular cells requires receptor-induced activation of SHP-2. The EMBO journal 2007, 26(17):4016-4028.
Chung SK, Kim JY, Kim IB, Park SI, Paek KH, Nam JH: Internalization and trafficking mechanisms of coxsackievirus B3 in HeLa cells. Virology 2005, 333(1):31-40.
Berryman S, Clark S, Monaghan P, Jackson T: Early events in integrin alphavbeta6-mediated cell entry of foot-and-mouth disease virus. Journal of virology 2005, 79(13):8519-8534.
Dicara D, Burman A, Clark S, Berryman S, Howard MJ, Hart IR, Marshall JF, Jackson T: Foot-and-mouth disease virus forms a highly stable, EDTA-resistant complex with its principal receptor, integrin alphavbeta6: implications for infectiousness. Journal of virology 2008, 82(3):1537-1546.
Johns HL, Berryman S, Monaghan P, Belsham GJ, Jackson T: A dominant-negative mutant of rab5 inhibits infection of cells by foot-and-mouth disease virus: implications for virus entry. Journal of virology 2009, 83(12):6247-6256.
Quinting B, Robert B, Letellier C, Boxus M, Kerkhofs P, Schynts F, Collard A: Development of a 1-step enzyme-linked immunosorbent assay for the rapid diagnosis of bovine respiratory syncytial virus in postmortem specimens. J Vet Diagn Invest 2007, 19(3):238-243.
Huang J, Li J, Cheng C, Tang X, Shen X, Hao B: An amino acid duplication/insertion in the Bm126 gene of Bombyx mori nucleopolyhedrovirus alters viral gene expression as shown by differential gene expression analysis. Archives of virology 2019, 164(3):831-838.
Du E, Tikoo SK: Efficient replication and generation of recombinant bovine adenovirus-3 in nonbovine cotton rat lung cells expressing I-SceI endonuclease. The journal of gene medicine 2010, 12(10):840-847.
Szczepanski A, Owczarek K, Milewska A, Baster Z, Rajfur Z, Mitchell JA, Pyrc K: Canine respiratory coronavirus employs caveolin-1-mediated pathway for internalization to HRT-18G cells. Veterinary research 2018, 49(1):55.
Li Q, Wang X, Wang C, Yu Y, Wang G, Gao J, Liu H, Xie H, Huang B, Li Z et al: Intracellular expression of an anti-idiotypic antibody single-chain variable fragment reduces porcine reproductive and respiratory syndrome virus infection in MARC-145 cells. Antiviral therapy 2016, 21(2):161-170.
Van Gorp H, Van Breedam W, Delputte PL, Nauwynck HJ: Sialoadhesin and CD163 join forces during entry of the porcine reproductive and respiratory syndrome virus. J Gen Virol 2008, 89(Pt 12):2943-2953.
Qian Z, Dominguez SR, Holmes KV: Role of the spike glycoprotein of human Middle East respiratory syndrome coronavirus (MERS-CoV) in virus entry and syncytia formation. PloS one 2013, 8(10):e76469.
Bowman EJ, Siebers A, Altendorf K: Bafilomycins: a class of inhibitors of membrane ATPases from microorganisms, animal cells, and plant cells. Proceedings of the National Academy of Sciences of the United States of America 1988, 85(21):7972-7976.
Pelkmans L, Helenius A: Endocytosis via caveolae. Traffic 2002, 3(5):311-320.
Pelkmans L, Helenius A: Insider information: what viruses tell us about endocytosis. Current opinion in cell biology 2003, 15(4):414-422.
Phonphok Y, Rosenthal KS: Stabilization of clathrin coated vesicles by amantadine, tromantadine and other hydrophobic amines. FEBS letters 1991, 281(1-2):188-190.
Wang LH, Rothberg KG, Anderson RG: Mis-assembly of clathrin lattices on endosomes reveals a regulatory switch for coated pit formation. The Journal of cell biology 1993, 123(5):1107-1117.
Lim JP, Gleeson PA: Macropinocytosis: an endocytic pathway for internalising large gulps. Immunology and cell biology 2011, 89(8):836-843.
Owczarek K, Szczepanski A, Milewska A, Baster Z, Rajfur Z, Sarna M, Pyrc K: Early events during human coronavirus OC43 entry to the cell. Scientific reports 2018, 8(1):7124.
Zhang H, Ma Y, Bao X, Xu L, Li X, Xie J, Ma Z, Feng R: Development and Application of a SYBP Green I Real-time PCR for Detection of Annexin A2. Progress in Veterinary Medicine 2015, 36(10):15-19.
Hill TA, Mariana A, Gordon CP, Odell LR, Robertson MJ, McGeachie AB, Chau N, Daniel JA, Gorgani NN, Robinson PJ et al: Iminochromene inhibitors of dynamins I and II GTPase activity and endocytosis. Journal of medicinal chemistry 2010, 53(10):4094-4102.
Preta G, Cronin JG, Sheldon IM: Dynasore - not just a dynamin inhibitor. Cell communication and signaling : CCS 2015, 13:24.
Quan A, McGeachie AB, Keating DJ, van Dam EM, Rusak J, Chau N, Malladi CS, Chen C, McCluskey A, Cousin MA et al: Myristyl trimethyl ammonium bromide and octadecyl trimethyl ammonium bromide are surface-active small molecule dynamin inhibitors that block endocytosis mediated by dynamin I or dynamin II. Molecular pharmacology 2007, 72(6):1425-1439.
Dietzel E, Kolesnikova L, Maisner A: Actin filaments disruption and stabilization affect measles virus maturation by different mechanisms. Virology journal 2013, 10:249.
Samson F, Donoso JA, Heller-Bettinger I, Watson D, Himes RH: Nocodazole action on tubulin assembly, axonal ultrastructure and fast axoplasmic transport. The Journal of pharmacology and experimental therapeutics 1979, 208(3):411-417.
Hernaez B, Alonso C: Dynamin- and clathrin-dependent endocytosis in African swine fever virus entry. Journal of virology 2010, 84(4):2100-2109.
Daecke J, Fackler OT, Dittmar MT, Krausslich HG: Involvement of clathrin-mediated endocytosis in human immunodeficiency virus type 1 entry. Journal of virology 2005, 79(3):1581-1594.
Wang K, Huang S, Kapoor-Munshi A, Nemerow G: Adenovirus internalization and infection require dynamin. Journal of virology 1998, 72(4):3455-3458.
O'Donnell V, LaRocco M, Duque H, Baxt B: Analysis of foot-and-mouth disease virus internalization events in cultured cells. Journal of virology 2005, 79(13):8506-8518.
Maginnis MS, Mainou BA, Derdowski A, Johnson EM, Zent R, Dermody TS: NPXY motifs in the beta1 integrin cytoplasmic tail are required for functional reovirus entry. Journal of virology 2008, 82(7):3181-3191.
Patel A, Mohl BP, Roy P: Entry of Bluetongue Virus Capsid Requires the Late Endosome-specific Lipid Lysobisphosphatidic Acid. The Journal of biological chemistry 2016, 291(23):12408-12419.
Forzan M, Marsh M, Roy P: Bluetongue virus entry into cells. Journal of virology 2007, 81(9):4819-4827.
Mercer J, Schelhaas M, Helenius A: Virus entry by endocytosis. Annual review of biochemistry 2010, 79:803-833.
Triantafilou K, Triantafilou M: Lipid raft microdomains: key sites for Coxsackievirus A9 infectious cycle. Virology 2003, 317(1):128-135.
Lamaze C, Tardif N, Dewulf M, Vassilopoulos S, Blouin CM: The caveolae dress code: structure and signaling. Current opinion in cell biology 2017, 47:117-125.
Henkhaus RS, Roy UK, Cavallo-Medved D, Sloane BF, Gerner EW, Ignatenko NA: Caveolin-1-mediated expression and secretion of kallikrein 6 in colon cancer cells. Neoplasia 2008, 10(2):140-148.
Parton RG, Simons K: The multiple faces of caveolae. Nature reviews Molecular cell biology 2007, 8(3):185-194.
Uemura T, Tsaprailis G, Gerner EW: GSTPi stimulates caveolin-1-regulated polyamine uptake via actin remodeling. Oncotarget 2019, 10(55):5713-5723.
Mergia A: The Role of Caveolin 1 in HIV Infection and Pathogenesis. Viruses 2017, 9(6).
Zhang F, Guo H, Zhang J, Chen Q, Fang Q: Identification of the caveolae/raft-mediated endocytosis as the primary entry pathway for aquareovirus. Virology 2018, 513:195-207.
Kim JY, Wang L, Lee J, Ou JJ: Hepatitis C Virus Induces the Localization of Lipid Rafts to Autophagosomes for Its RNA Replication. Journal of virology 2017, 91(20).
Ludwig A, Nguyen TH, Leong D, Ravi LI, Tan BH, Sandin S, Sugrue RJ: Caveolae provide a specialized membrane environment for respiratory syncytial virus assembly. Journal of cell science 2017, 130(6):1037-1050.
Ning P, Gao L, Zhou Y, Hu C, Lin Z, Gong C, Guo K, Zhang X: Caveolin-1-mediated endocytic pathway is involved in classical swine fever virus Shimen infection of porcine alveolar macrophages. Veterinary microbiology 2016, 195:81-86.
Mazzon M, Marsh M: Targeting viral entry as a strategy for broad-spectrum antivirals. F1000Research 2019, 8.
Conner SD, Schmid SL: Regulated portals of entry into the cell. Nature 2003, 422(6927):37-44.
Wang JL, Zhang JL, Chen W, Xu XF, Gao N, Fan DY, An J: Roles of small GTPase Rac1 in the regulation of actin cytoskeleton during dengue virus infection. PLoS neglected tropical diseases 2010, 4(8).
Zhang J, Wu N, Gao N, Yan W, Sheng Z, Fan D, An J: Small G Rac1 is involved in replication cycle of dengue serotype 2 virus in EAhy926 cells via the regulation of actin cytoskeleton. Science China Life sciences 2016, 59(5):487-494.

Download PDF

Version 1

posted

You are reading this latest preprint version

EMCV Replication in BHK-21 in Vitro is Mediated by Caveolin-1, Actin, Dynamin-Dependent Endocytic Pathway

Status:

Version 1

Abstract

Figures

1. Background

2. Methods

2.1. Cells, viruses, and antibodies.

2.2. qRT-PCR

2.3. Gene overexpression and RNA interference

2.4. Chemical inhibitors and Cell viability Determination

2.5. Virus infectivity assays, Post-entry inhibitory effects and detection of virus internalization

2.6. IFA and Confocal microscopy

2.7. Western Blotting (WB)

2.8. Statistical analyses

3. Results

3.1. The role of endocytosis in EMCV replication in BHK-21 cells

3.2. Clathrin-mediated endocytosis is not involved in EMCV replication in BHK-21 cells

3.3. EMCV replication in BHK-21 cells does not depend on macropinocytosis

3.4. Caveolae is required for EMCV replication in BHK-21 cells.

3.5. Caveolin-1 expression is positively correlated with the infection of EMCV

3.6. Caveolin-1 is required for EMCV replication in BHK-21 cells.

3.7. Caveolin-1 is essential for EMCV infection by involving in internalization

3.8. Dynamin is needed for EMCV replication in BHK-21 cells

3.9. Role of actin in EMCV infection in BHK-21 cells

4. Discussion

5. Conclusion

List Of Abbreviations

Declaration

Acknowledgements

Funding

Data Availability

Author Contributions

Conflicts of Interest

References

Supplementary Files

Status:

Version 1