FcRn regulates antigen presentation downstream of dendritic cell receptor-targeted vaccination.

doi:10.21203/rs.3.rs-3212012/v1

Download PDF

Article

FcRn regulates antigen presentation downstream of dendritic cell receptor-targeted vaccination.

https://doi.org/10.21203/rs.3.rs-3212012/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 09 Apr, 2024

Read the published version in npj Vaccines →

You are reading this latest preprint version

Dendritic cell (DC)-targeted vaccination is a new model of antigen delivery that relies on the use of monoclonal antibodies (mAb) to target antigen to specific DC subsets. The neonatal Fc receptor (FcRn) is a non-classical Fc receptor that binds to immunoglobulins G (IgG) in acidified endosomes and controls their intracellular transport and recycling. FcRn is known to participate in the antigen presentation of immune complexes, however its contribution to the presentation of DC-targeted vaccination has not previously been examined. Here we have investigated the role of FcRn in antigen presentation using antigen conjugated to IgG mAb which target specific DC receptors, including DEC205 and Clec9A specific for the conventional DC 1 (cDC1) subset. We show that FcRn is expressed at high levels by cDC1, both at steady-state and following activation and plays a significant role in MHC I cross-presentation and MHC II presentation of antigens that are targeted to cDC1 via mAb specific for DEC205. This effect of FcRn is intrinsic to cDC1 and it impacts the efficacy of anti-DEC205-mediated vaccination against lymphoma. In contrast, FcRn does not impact the presentation of antigens targeted to Clec9A and does not regulate the presentation of cell-associated antigen These data highlight a new and unique role of FcRn in controlling the immunogenicity of anti-DEC205-based vaccination, with consequences for exploiting this pathway to improve DC-targeted vaccine outcomes.

Biological sciences/Immunology/Adaptive immunity/Cellular immunity/Antigen presentation

Biological sciences/Immunology/Tumour immunology

FcRn

dendritic cells

antigen presentation

Dendritic cells (DCs) are unique in their ability to capture and present antigen on major histocompatibility complex (MHC) molecules to T cells, making them an attractive cellular platform for vaccine development. DC-targeted vaccination is a strategy that relies on delivering the antigen directly to DCs in situ via conjugation to IgG mAbs specific to DC surface receptors^1,2. Several receptors have been explored for DC targeting and two of them, DEC205 and Clec9A, are particularly effective at priming immune responses. DEC205 is a C-type lectin receptor that is highly expressed by conventional DC 1 (cDC1) and also expressed by dermal and interstitial DCs, Langerhans cells, B cells and cortical thymic epithelial cells³. It acts as a receptor for type B oligonucleotide, transporting it to late endosomes for Toll like receptor (TLR)-9 stimulation⁴. Clec9A, also known as DC natural killer lectin group receptor 1 (DNGR1), is a C-type lectin displayed at high levels on the surface of cDC1, with low expression by pDCs^5,6. Clec9A binds to F-actin exposed by necrotic cells and traffics to intracellular locations that enables associated cargo to access the MHC I presentation pathway^6–8. DC-targeted vaccination using mAbs specific for DEC205 and Clec9A induces cytotoxic T cell immunity^5,9−11 that contributes to tumor eradication in prophylactic and therapeutic settings^12–14. In addition, DEC205 and Clec9A-targeted vaccine antigen is efficiently processed for MHC II presentation, resulting in efficient CD4⁺ T cell responses^{9–11, 15}. DC-targeted vaccines are now used in clinical treatment^16,17, and efforts to further boost their efficacy of major interest.

The neonatal Fc receptor (FcRn) is an Fc binding receptor that belongs to the MHC I superfamily, forming a heterodimer encompassing a heavy α chain and a β-2-microglobulin chain¹⁸. FcRn is predominantly located in endosomal compartments where it interacts with two ligands, IgG and serum albumin via independent binding sites¹⁹. This receptor-ligand interaction is pH dependent, with relatively strong binding affinity below pH 6.5 but low affinity at neutral pH²⁰. FcRn protects IgG and albumin from intracellular catabolism by transporting ligands in transport carriers for release at the cell surface, and diverting them away from proteases-containing late endosomes/lysosomes²¹. Another function of FcRn is to deliver IgG from mother to neonates across the intestinal and/or placental epithelia by transcytosis^22,23. In DCs, FcRn interacts with endocytosed IgG immune complexes and shuttles them to intracellular compartments that enable MHC I and MHC II presentation for priming of CD8⁺ and CD4⁺ T cell responses^24–26.

Given the role for FcRn in intracellular IgG trafficking and presentation of IgG-associated antigen, we investigated whether FcRn contributes to immune responses downstream of IgG mAb-based DC-targeted vaccines. Here we show that FcRn plays a critical role in the MHC I cross-presentation and MHC II presentation of DEC205-targeted, but not Clec9A-targeted antigen. Our data highlight a critical role for FcRn in settings of DC-targeted vaccination that can be exploited to boost their efficacy.

FcRn expression by splenic DCs.

We first examined FcRn expression in primary mouse cDCs compared to other immune cell types. Total cellular FcRn was detected by western blot for bone marrow-derived macrophages, cDC1, cDC2 and B cells. Low levels of FcRn were detected in CD8⁺ T cells whereas CD4⁺ T cells expressed very little (Fig. 1A). Activation of cDC1 or cDC2 by exposure to TLR9 agonist CpG did not significantly alter FcRn levels for either subset (Fig. 1B).

We next characterized the phenotype of Fcgrt^−/− mice. In line with previous reports²¹, Fcgrt^−/− mice develop hypogammaglobulinemia, as evidenced by the absence of IgG1, IgG2c, IgG3 and a strong reduction in IgG2b levels in the serum. In contrast, IgA, IgE and IgM were detected at normal levels (Fig. 1C). Both the cDC1 and cDC2 subsets are present at normal numbers in the absence of FcRn (Fig. 1D).

FcRn is required for effective tumor immunity in response to DEC205 and Clec9A-targeted vaccination.

The effectiveness of DC receptor-targeted vaccines in eliminating B cell lymphoma was examined using a mouse model of B cell lymphoma. This model consists of Eµ-myc transformed lymphoma cells that express the model antigen, ovalbumin (OVA)²⁷. DC vaccines were designed to target whole OVA to DC receptors DEC205 and Clec9A through a genetic fusion of the protein to the Fc region of rat IgG2a specific to the two receptors. Murine FcRn binds rat IgG2a with high affinity²⁸. WT mice were intravenously immunized with either DEC205 or Clec9A-targeted OVA adjuvanted with LPS. Five days later, mice were inoculated with B cell lymphoma and the number of B cell lymphoma cells in the spleen evaluated 4 days later (Fig. 2A). Vaccination with either DEC205 and Clec9A-targeted OVA elicited a significant reduction in tumor cell number, indicating successful anti-tumor therapy for this mode of immunization (Fig. 2B). A role for FcRn was evaluated by undertaking the same analysis in Fcgrt^−/− mice. In the absence of FcRn, the ability to eradicate tumors was lost and there was no significant reduction in tumor cell numbers when mice were immunized with DEC205 or Clec9A-targeted OVA (Fig. 2B). A second measurement of successful tumor immunization was included, whereby evidence of tumor immunoediting in response to vaccination was assessed. In the B cell lymphoma model used here, green fluorescent protein (GFP) is linked by an internal ribosome entry site to the tumor antigen OVA²⁷. Therefore, the tumor GFP signal provides a surrogate read out of OVA expression and is a useful marker of tumor antigen expression. In WT mice, DEC205 and Clec9A-targeted OVA immunization results in a significant reduction in tumor GFP. This is likely due to the tumors reducing OVA expression to avoid anti-OVA CD8⁺ T cells. In contrast, tumors in Fcgrt^−/− mice, had a higher GFP signal, suggesting that in the absence of FcRn there was less pressure on the tumor to edit OVA following immunization (Fig. 2C). Taken together, this data suggests that FcRn is required for a robust anti-tumor response elicited by DEC205 and/or Clec9A-directed DC-targeted vaccination.

FcRn regulated MHC I and MHC II antigen presentation in response to DEC205-targeted DC vaccination.

We next examined how FcRn participates in DEC205-targeted DC vaccination. Surface DEC205 was unaltered on splenic cDC1 and cDC2 in the absence of FcRn (Fig. 3A). This finding indicates that similar amounts of DEC205-targeted OVA antigen is delivered to cDCs in both WT and Fcgrt^−/− mice. Next, the capacity of Fcgrt^−/− mice to present DEC205-targeted antigen by MHC I and MHC II was examined. To do this, Cell Trace Violet (CTV)-labelled OT-I or OT-II T cells were transferred into WT and Fcgrt^−/− mice. One day later, mice were immunized with DEC205-targeted OVA intravenously and the number of dividing T cells in the spleen was evaluated by flow cytometry after three days. In the absence of FcRn, DEC205-targeted OVA elicited significantly reduced numbers of divided OT-I, and significantly more divided OT-II cells (Fig. 3B). Presentation of OVA-coated splenocytes, used as mAb-independent cell-associated antigen model, to OT-I and OT-II was not impacted by FcRn deficiency (Supplementary Fig. 1A). To determine if the reductions in MHC I and MHC II antigen presentation were intrinsic to FcRn-deficient cDCs, WT and Fcgrt^−/− mice were intravenously immunized with DEC205-targeted OVA. Twenty hours later cDC1 were sorted to purity by flow cytometry and equal numbers of WT or Fcgrt^−/− cDC1s incubated in the presence of CTV labelled OT-I or OT-II T cells. Fcgrt^−/− cDC1 displayed a significantly reduced capacity to stimulate OT-I and OT-II cells in response to in vivo targeting with DEC205-targeted OVA (Fig. 3C). This suggested reduced MHC I presentation, and in contrast to in vivo adoptive transfer experiments, reduced MHC II presentation in response to in vivo targeting with DEC205-targeted OVA.

To examine if FcRn impacted presentation of DC-targeted antigens other than OVA, we targeted the self-epitope Eα_{46 − 72} to DEC205 and examined the presence of Ea_{52 − 68} peptide-loaded I-Ab MHC II molecules at the surface of cDC1 using the Yae mAb²⁹. WT or Fcgrt^−/− mice were injected intravenously with DEC205-targeted Eα_{46 − 72} and cDCs isolated from spleen 20 hours later. Significantly reduced MHC II presentation of DEC205-targeted Eα_{52 − 68} was detected at the surface of Fcgrt^−/− compared to WT cDC1 (Fig. 3D). To further confirm this finding, the Fcgrt gene was deleted in the cDC1 cell line MutuDCs³⁰ using CRISPR/Cas9 (Supplementary Fig. 2A). Following delivery of the Eα_{46 − 72} peptide to DEC205 in vitro, Fcgrt^−/− MutuDCs were significantly impaired in the MHC II presentation of Eα_{52 − 68} (Supplementary Fig. 2B). Altogether, this data show that FcRn is an important contributor to the response elicited by anti-DEC205-targeted vaccination by promoting MHC I cross-presentation and MHC II presentation of the delivered antigen.

The role of FcRn in DEC205-targeted DC vaccination is DC-intrinsic.

One possibility for defects in DC antigen presentation following DC-targeted vaccination in vivo, is that FcRn is required to promote circulating DC-targeted vaccine half-life. To address this, we used mixed bone marrow chimeras where WT mice were lethally irradiated and reconstituted with a 1:1 ratio of CD45.1 WT or CD45.2 Fcgrt^−/− bone marrow. This created a scenario where CD45.1 WT or Fcgrt^−/− CD45.2 DCs are both in a WT environment with similar levels of circulating DC-targeted vaccines. 6–8 weeks after reconstitution, mice were immunized with anti-DEC205-OVA and 20 hours later CD45.1⁺ WT or Fcgrt^−/− cDC1 were isolated from spleens and incubated with CTV labelled OT-I or OT-II. In comparison to WT, Fcgrt^−/− cDC1 displayed significantly reduced MHC I and MHC II presentation of DEC205-targeted OVA (Fig. 4). This rules out that differences in vaccine half-life were responsible for the defects in Fcgrt^−/− cDC presentation of DEC205-targeted antigen and highlights an intrinsic role of FcRn in DCs during anti-DEC205-targeted vaccination.

FcRn does not regulate MHC I and MHC II antigen presentation in response to Clec9A-targeted DC vaccination.

Next, we examined how FcRn impacts anti-Clec9A-targeted OVA immunization. Similar to DEC205, surface Clec9A on cDC1 was not altered by the deficiency in FcRn (Fig. 5A). In contrast to anti-DEC205-OVA, MHC I and MHC II antigen presentation following immunization with anti-Clec9A-OVA was not significantly impacted by the absence of FcRn. This was the case as measured by T cell responses following adoptive OT-I and OT-II T cell transfer into anti-Clec9A-OVA Fcgrt^−/− mice (Fig. 5B), extrinsic isolation and culture of WT or Fcgrt^−/− cDC1s from anti-Clec9A-OVA immunized mice (Fig. 5C) and analysis of Fcgrt^−/− cDC1 compared to WT cDC1 isolated from WT mice reconstituted with 1:1 ratio of WT and Fcgrt^−/− bone marrow (Fig. 5D). In contrast, MHC II presentation of Clec9A-targeted Eα₄₆₋₋₇₂ peptide on cDC1 was significantly reduced in the absence of FcRn (Fig. 5E). Therefore, in contrast to anti-DEC205-targeted vaccination, FcRn does not have a prominent role in regulating presentation of antigen targeted via Clec9A but can participate under some conditions.

FcRn is required for CTL immunity to DEC205 but not Clec9A-targeted DC vaccination.

Elimination of Eµ-myc-OVA B cell lymphoma in response to DC-targeted vaccination likely involves the generation of anti-OVA cytotoxic T lymphocytes (CTL). We therefore examined whether FcRn is required for eliciting CTL in response to anti-DEC205 or Clec9A-OVA. WT or Fcgrt^−/− mice were immunized, intravenously immunized with DC-targeted anti-DEC205 or Clec9A-OVA and six days later the presence of OVA-specific CTL detected by the intravenous injection of OVA_{257 − 264} peptide-pulsed, or not, target cells. In the absence of FcRn, immunization with anti-DEC205-OVA elicited a significant reduction in CTL lysis compared to WT mice (Fig. 6A). In contrast, anti-Clec9A-OVA elicited similar CTL in both WT and Fcgrt^−/− mice (Fig. 6B). CTL immunity elicited by OVA-coated splenocytes was not impacted by FcRn-deficiency (Supplementary Fig. 1B). Hence, these results demonstrate that priming a robust CTL response following DC-targeted vaccination requires FcRn when delivering antigen to DEC205, but not Clec9A.

DC-targeted vaccination using antigen-conjugated DC-receptor specific IgG mAb allows efficient and precise delivery of vaccine antigen to DC subsets specialized in antigen presentation and T cell priming. The success of this immune therapy relies on the intracellular trafficking pathways inside DCs, that will dictate whether, or not, the vaccine antigen and accompanying targeting IgG can access a compartment that is favourable for antigen presentation. Here we show that mAb-conjugated antigen targeted to DEC205 requires FcRn, a receptor of emerging therapeutic interest³¹, for efficient MHC I cross-presentation and MHC II presentation. In contrast, Clec9A-targeted antigen is presented via a mechanism that is independent of FcRn.

Our study highlights a role for FcRn in cDC1. Previously, FcRn was identified as critical for MHC I cross-presentation of immune complex-derived antigen in cDC2, but not cDC1^24,25. In these systems, the alkaline pH of the cDC1 cross-presentation compartment was not permissive for FcRn binding. In contrast, when antigen is delivered via anti-DEC205 mAb, it accesses late endosomes^32,33 with a luminal pH that is sufficiently acidic for FcRn binding to the Fc domain of the targeting mAb. In addition to cDC1, other antigen presenting cell populations that express DEC205 may also use FcRn to effectively present DEC205-targeted antigen. For example, B cells which express FcRn, have high surface expression of DEC205³ and respond to DEC205 mAb-targeting in vivo by presenting the associated antigen in the context of MHC II^34,35. Langerhans cells and a subset of dermal DCs also exhibit high surface levels of DEC205. After subcutaneous immunization, these skin DCs capture and transport anti-DEC205 mAbs to the draining lymph nodes for presentation of the conjugated antigen to T cells^36,37. It remains to be determined if FcRn regulates the presentation of DEC205-targeted antigen by these cell types.

FcRn impacts immunization with mAb-conjugated antigen to DEC205, but not Clec9A. Why is this the case? Both DEC205 and Clec9A are expressed at high levels by cDC1, an antigen presenting cell type that we observe expresses high levels of FcRn. Therefore, the different roles for FcRn likely stem from differences in the intracellular trafficking properties of the two receptors. DEC205 and Clec9A exhibit similar plasma membrane internalization patterns in cDC1, with rapid and high surface turnover³⁸. Inside the cell, however, their pathways diverge. Anti-DEC205 mAbs traffic to late endosomes in immature and mature bone marrow-derived DCs^32,33 and the highly acidic lumen of these compartments may favour FcRn binding to the Fc-domain of anti-DEC205 IgG. In contrast, Clec9A mAbs transit through early and recycling endosomes^8,39, compartments without an acidic lumen that may not permit FcRn-IgG binding. Another difference between the two receptors is that mAb binding to Clec9A induces spleen tyrosine kinase (Syk) phosphorylation and endosomal rupture³⁹. This has not been reported for DEC205. Therefore, endosomes with antigen-conjugated anti-Clec9A mAb may rupture instead of routing to FcRn-containing endosomes. Regardless, the impaired presentation of DEC205-targeted antigen when FcRn is absent is likely due to altered trafficking and processing. In cDC2, FcRn directs captured immune complexes to endosomes that are enriched with components of the cross-presentation machinery. These include the translocon Sec61, which mediates the transfer of antigen from the endosomal lumen to the cytosol, and transporter associated with antigen processing 1 (TAP1), which reimports proteasomal generated peptides into the endosome²⁴. Interestingly, DEC205-targeted antigen is also cross-presented via a TAP-dependent mechanism^9,40, suggesting that FcRn may divert anti-DEC205 mAbs to similar cross-presenting compartments in cDC1.

Currently, two anti-DEC205 targeting mAbs are in clinical trials. CDX-1401 is a human IgG1 conjugated to the tumor antigen NY-ESO1 that has been evaluated in six phase I and phase II trials. Another DEC205-specific mAb, DCVax-001 has been conjugated to the human immunodeficiency virus (HIV) antigen Gag p24 and tested in a phase I clinical trial^2,16,17. Although these vaccines have shown promising results with robust B cell and T cell immunity, their efficiency may be further enhanced by harnessing FcRn to extend their half-life and activity in vivo. Several therapeutic mAbs have been modified in their Fc domain to introduce mutations near the key FcRn-binding residues in order to increase the IgG-FcRn binding affinity at low pH. For example, inserting the LS (M428L, N434S) mutation into anti-vascular endothelial growth factor (VEGF) IgG1 Bevacizumab greatly extended the mAb half-life in vivo by approximately four fold, resulting in increased anti-tumor activity⁴¹. YTE (M252Y/S254T/T256E) is another mutation introduced into mAbs specific for viral proteins. This modification enhanced the half-life of the anti-respiratory syncytial virus IgG1 Motalizumab up to 100 days post-injection⁴². This mAb engineering approach represents a straightforward strategy applicable to DEC205-targeted DC vaccination to improve FcRn affinity and immunogenicity.

In conclusion, our study demonstrates the crucial role of FcRn in the efficient presentation of antigen targeted to DEC205 by DCs. We have shown that FcRn mediates the presentation of DEC205-targeted antigen, while Clec9A-targeted antigen presentation is independent of FcRn. The differential trafficking and processing of these receptors likely contribute to the distinct roles of FcRn in antigen presentation of DC-targeted mAb. The clinical trials of anti-DEC205 mAbs underscore the potential of utilizing FcRn to enhance the efficacy of DC-targeted vaccines. By engineering the Fc domain of these mAbs to increase their affinity for FcRn, the half-life and activity of the vaccines can be extended, leading to improved immunogenicity. These findings provide valuable insights into the development of DC-targeted vaccination strategies and highlight the importance of FcRn in modulating immune responses for effective antigen presentation by DC subsets.

Mice

C57BL/6, Fcgrt^tm1Dcr (Fcgrt^−/−), B6.CH-2^bm − 1 (BM-1), Ly5.1, OT-II x Ly5.1 and OT-I x Ly5.1, mice were used at 6–12 weeks of age. All mice were bred and maintained in specific pathogen–free conditions at the Melbourne Bioresources Platform at Bio21 Molecular Science and Biotechnology Institute. Experimental procedures were approved by the Animal Ethics Committee of the University of Melbourne.

Isolation of immune cells

For purification of DCs, spleens were finely chopped and digested in the presence of DNase I (Roche) and collagenase type 3 (Worthington Biochemicals). Intercellular clusters were disrupted by addition of 10 mM EDTA. Light density cells were isolated by density gradient separation in 1.077 g/cm³ Nycodenz (Nycomed Pharma). Upper fractions were collected, washed and subject to further enrichment by resuspending in a depletion cocktail containing the following rat anti-mouse mAbs specific for: CD3 (KT3-1.1), CD90 (T24/31.7), red blood cells (Ter119), B220 (RA3-6B2), Ly6G/Ly6C (RB68C5). Cells were incubated with antibodies, washed, and incubated with BioMag anti-rat IgG-coupled magnetic beads (Qiagen). The DC-enriched supernatant was recovered by magnetic separation. Where required, DCs were sorted to purity by flow cytometry on a Becton Dickinson Influx (Murdoch Children’s Research Institute Flow Cytometry and Imaging facility). cDC1 were defined as CD11c⁺ CD8⁺ CD11b⁻, cDC2: CD11c⁺ CD8⁻ CD11b⁺. For in vitro activation, cDCs were isolated and incubated overnight in complete RPMI with 0.5 µM CpG 1668 ODN (Bioneer) at 37ºC or 4ºC. Following activation, cDC subsets were sorted by flow cytometry and analysed by immunoblotting.

For T cell isolation, single cell suspensions were generated from lymph nodes. Cells were stained with rat anti-mouse mAbs specific for: CD11b (M1/70), red blood cells (TER119), Ly6G (1A8), MHC II (M5/114), B220 (RA3-6B2) and CD4 (GK1.5) for CD8⁺ T cells or CD8 (YTS 169.4) for CD4⁺ cells. Cells were washed and incubated with BioMag anti-rat IgG-coupled magnetic beads (Qiagen). After magnetic depletion, the CD4⁺ or CD8⁺ T cell-enriched supernatant was recovered. Purity, determined by flow cytometry, was > 90%. For B cell isolation, whole-splenocyte suspensions were subjected to gradient centrifugation (at 2237g) with Ficoll-Paque Plus (GE Healthcare) and subsequent negative depletion using FITC-conjugated mAb against CD4 (GK1.5), Ly76 (TER119), CD43 (S7) and magnetic anti-FITC MicroBeads (Miltenyi Biotec). The purity of the B cell preparation, as measured by flow cytometry, was > 95%.

Bone-marrow-derived macrophages

Bone marrow was isolated from the femur and tibia of 6-12-week-old C57Bl/6 mice and non-adherent bone marrow cells cultured for 5–7 days in the presence of conditioned media harvested from L-929 cells as a source of M-CSF. Purity was assessed by flow cytometry as ~ 95% of live cells expressing both CD11b and F4/80.

Immunoblotting

Immune cells were isolated as previously described and were denatured in 1x reducing LDS sample buffer; 25% (v/v) 4x NuPAGE LDS Sample Buffer (Invitrogen) and 10% (v/v) 10x NuPAGE Reducing Agent (Invitrogen) in distilled water, at 100°C and analysed by SDS-PAGE using 4–12% gradient NuPAGE Bis-Tris polyacrylamide gels (Invitrogen). Proteins were transferred onto Immobilon-P PVDF membranes (Merck Millipore) and stained with primary antibodies against FcRn (R&D Systems), GAPDH (6C5, Millipore) followed by HRP-conjugated secondary antibodies.

Serum antibody analysis

For quantification of total serum antibodies, sandwich ELISA was performed by coating high protein-binding 96-well plates (Corning) with 20 ug/ml of goat mAb specific for mouse IgA (clone MOPC315), IgG1 (MOPC31c), IgG2b (MOPC141), IgG2a/c (UPC10), IgG3 (Y5606), and IgM (MOPC104E) (all Sigma-Aldrich). Coated plates were subsequently incubated with diluted serum or standards, followed by detection with horseradish peroxidase (HRP)-conjugated polyclonal mAbs against mouse IgG1, IgA, IgG1, IgG2b, IgG2a/c, IgG3, and IgM (all SouthernBiotech) and 1-Step Ultra3,3’,5,5’-Tetramethylbenzidine ELISA Substrate (Thermo Fisher Scientific). Absorbance at 440 nm was measured with a FLUOstar Omega PlateReader, and 4PL analysis was performed with GraphPad Prism software.

Prophylactic vaccination assay and analysis of killing of Eµ-myc-OVA lymphoma

The Eµ-myc lymphoma expressing GFP-OVA was described previously²⁷. Mice were immunized i.v. with 1 µg of anti-DEC205-OVA or Clec9A-OVA mAb or 20 x 10⁶ OVA-coated splenocytes, all adjuvanted with 1 µg of LPS. Five days later, mice were challenged with 10⁶ Eµ-myc-OVA lymphoma cells and spleens were harvested after 4 days. Single-cell splenocyte suspensions were treated with RBC removal buffer, stained with a mAb specific for B220 (RA3-6B2, BioLegend) and analysed by flow cytometry.

In vivo antigen presentation assay

Single-cell suspensions were generated from lymph nodes of OT-I x Ly5.1or OT-II x Ly5.1 mice and the CD8⁺ or CD4⁺ T cells were purified as before. Purified OT-I or OT-II cells were washed with PBS supplemented with 0.1% BSA and labelled with Cell Trace Violet (CTV; Thermo Fisher Scientific). To enable accurate quantification of the number of OT-II or OT-I cells, mice also received transfer of a control population of carboxyfluorescein succinimidyl ester (CFSE) (Thermo Fisher Scientific)-labelled splenocytes. Single-cell suspensions were treated with red blood cell (RBC) removal buffer. Cells were washed with PBS, 0.1% BSA, and labelled with CFSE. Equal numbers of CTV-labelled OT-II or OT-I cells and CFSE-labelled splenocytes were pooled and resuspended in RPMI 1640, 2% FCS at 1 x 10⁷ cells/ml, respectively, and injected i.v. Twenty-four hours later, mice received 20 x 10⁶ OVA-coated splenocytes, or 0.2 µg anti-DEC205-OVA or anti-Clec9A-OVA mAb via i.v. injection¹¹. For OVA-coated splenocytes, single-cell splenocyte suspensions were treated with RBC removal buffer, washed, and incubated with 10 mg/ml OVA protein (Sigma-Aldrich) in FCS-free RPMI 1640 at 37 C. Sixty-four hours after immunization, spleens were harvested, single-cell suspensions were generated, and RBCs were lysed. Cells were stained with mAbs specific for CD8α (53 − 6.7, BioLegend) or CD4 (GK1.5; Walter and Eliza Hall Antibody Facility) and Ly-5.1 (A20; BioLegend). The number of divided OT-II and OT-I was determined as the number of CD4⁺ or CD8⁺ Ly-5.1⁺ cells that had undergone CTV dilution. The number of cells was normalized to the number of CFSE-labelled splenocytes recovered.

Ex vivo antigen presentation assay

Mice were immunized i.v. with 1 µg of anti-DEC205-OVA or Clec9A-OVA mAb or anti-DEC205-Eα_{46 − 72} peptide. After 22 to 24 hours, splenic cDCs were either examined for Eα_{52 − 68}–loaded I-Ab surface expression by flow cytometry using biotinylated YAe mAb²⁹ (Thermo Fisher Scientific) and streptavidin-PE (BioLegend) or sorted to purity. Sorted cDC1 or cDC2 were cultured in vitro with 5 x 10⁴ CTV-labelled OT-II or OT-I cells in complete medium. Four or five days later, the number of divided OT cells was determined.

In vitro targeting of MutuDCs and analysis of antigen presentation

MuTu DCs stably expressing Cas9⁴³ were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM)-GlutaMax™ (Thermo Fisher Scientific) supplemented with 10% (v/v) FBS (University of Melbourne Media Preparation Unit), 100 µM β-mercaptoethanol (Thermo Fisher), 100 µg/mL penicillin and 100 µg/mL streptomycin at 37°C, 10% CO₂. To knockout FcRn, the LV04 vector containing the sgRNA was used (Sigma Aldrich). sgRNA sequences were as follows: non-targeting control: 5’ CGCGATAGCGCGAATATATT 3’; FcRn: 5’ CCGTCGGCCCCTCTCCAGG 3’. To produce lentivirus, HEK293T were transfected using polyethylenimine (Polysciences) with sgRNA vector, pMDL (Addgene #12251), pRSV-REV (Addgene #12253), pMD2.G (Addgene #12259). Lentivirus were subsequently used to transduced Cas9⁺ MuTu DCs by spinfection in the presence of polybrene (Sigma-Aldrich). Transduced cells were then selected by culturing them for three days with puromycin (Thermo Fisher Scientific).

Mixed bone marrow chimera

Recipient mice (C57BL/6) were irradiated twice at 550 cGy (rad), three hours apart before being injected i.v. with 50:50 mixed bone marrow cells from Ly5.1 WT mice and Fcgrt-/- mice. Recipient mice were intraperitoneally injected with anti-Thy1 (T24) to eliminate radio-resistant host T cells the day after irradiation. Mice were reconstituted for six weeks before analysis.

In vivo CTL killing assay

Mice were injected with 1 µg of anti-DEC205-OVA mAb or anti-Clec9A-OVA mAb, or with 2 x 10⁷ OVA-coated splenocytes, all mixed with 1 ug of LPS as adjuvant. Six days later, single-cell suspensions of target cells (splenocytes) were prepared from spleens of WT mice. Half of the suspension (OVA⁺ splenocytes pulsed with OVA_{257 − 264} labelled with a high concentration of CTV [CTV^hi]) was pulsed with 1 µg of OVA_{257 − 264} (Worthington Biochemical) and labelled with 5 mM CTV (Thermo Fisher Scientific). The other half of the suspension (OVA splenocytes labelled with a low concentration of CTV [CTV^lo]) was labelled with 0.5 mM CTV only. An equal number of OVA⁺ CTV^hi and OVA⁻ CTV^lo target cells were pooled, and 10 x 10⁶ target cells were injected i.v; 36–42 h later, spleens were harvested and the percentage of OVA-specific lysis was determined as follows: R = (%CTV^lo / %CTV^hi). %OVA-specific lysis = [1 - (r_unprimed / r_primed)]100.

COMPETING INTERESTS

The authors declare no competing interest.

DATA AVAIBILITY

Data from this study will be made available upon request to the corresponding author (Justine D. Mintern, [email protected])

Macri, C., Dumont, C., Johnston, A. P. & Mintern, J. D. Targeting dendritic cells: a promising strategy to improve vaccine effectiveness. Clin Transl Immunology 5, e66 (2016). https://doi.org:10.1038/cti.2016.6
Macri, C., Jenika, D., Ouslinis, C. & Mintern, J. D. Targeting dendritic cells to advance cross-presentation and vaccination outcomes. Semin Immunol 68, 101762 (2023). https://doi.org:10.1016/j.smim.2023.101762
Witmer-Pack, M. D., Swiggard, W. J., Mirza, A., Inaba, K. & Steinman, R. M. Tissue distribution of the DEC-205 protein that is detected by the monoclonal antibody NLDC-145. II. Expression in situ in lymphoid and nonlymphoid tissues. Cell Immunol 163, 157–162 (1995). https://doi.org:10.1006/cimm.1995.1110
Lahoud, M. H. et al. DEC-205 is a cell surface receptor for CpG oligonucleotides. Proc Natl Acad Sci U S A 109, 16270–16275 (2012). https://doi.org:10.1073/pnas.1208796109
Caminschi, I. et al. The dendritic cell subtype-restricted C-type lectin Clec9A is a target for vaccine enhancement. Blood 112, 3264–3273 (2008). https://doi.org:10.1182/blood-2008-05-155176
Sancho, D. et al. Identification of a dendritic cell receptor that couples sensing of necrosis to immunity. Nature 458, 899–903 (2009). https://doi.org:10.1038/nature07750
Zhang, J. G. et al. The dendritic cell receptor Clec9A binds damaged cells via exposed actin filaments. Immunity 36, 646–657 (2012). https://doi.org:10.1016/j.immuni.2012.03.009
Zelenay, S. et al. The dendritic cell receptor DNGR-1 controls endocytic handling of necrotic cell antigens to favor cross-priming of CTLs in virus-infected mice. J Clin Invest 122, 1615–1627 (2012). https://doi.org:10.1172/JCI60644
Bonifaz, L. et al. Efficient targeting of protein antigen to the dendritic cell receptor DEC-205 in the steady state leads to antigen presentation on major histocompatibility complex class I products and peripheral CD8 + T cell tolerance. J Exp Med 196, 1627–1638 (2002). https://doi.org:10.1084/jem.20021598
Bonifaz, L. C. et al. In vivo targeting of antigens to maturing dendritic cells via the DEC-205 receptor improves T cell vaccination. J Exp Med 199, 815–824 (2004). https://doi.org:10.1084/jem.20032220
Lahoud, M. H. et al. Targeting antigen to mouse dendritic cells via Clec9A induces potent CD4 T cell responses biased toward a follicular helper phenotype. J Immunol 187, 842–850 (2011). https://doi.org:10.4049/jimmunol.1101176
Liu, Z., Zhou, H., Wang, W., Fu, Y. X. & Zhu, M. A novel dendritic cell targeting HPV16 E7 synthetic vaccine in combination with PD-L1 blockade elicits therapeutic antitumor immunity in mice. Oncoimmunology 5, e1147641 (2016). https://doi.org:10.1080/2162402X.2016.1147641
Silva, M. O. et al. Antigen Delivery to DEC205(+) Dendritic Cells Induces Immunological Memory and Protective Therapeutic Effects against HPV-Associated Tumors at Different Anatomical Sites. Int J Biol Sci 17, 2944–2956 (2021). https://doi.org:10.7150/ijbs.57038
Sancho, D. et al. Tumor therapy in mice via antigen targeting to a novel, DC-restricted C-type lectin. J Clin Invest 118, 2098–2110 (2008). https://doi.org:10.1172/JCI34584
Kato, Y. et al. Targeting Antigen to Clec9A Primes Follicular Th Cell Memory Responses Capable of Robust Recall. J Immunol 195, 1006–1014 (2015). https://doi.org:10.4049/jimmunol.1500767
Dhodapkar, M. V. et al. Induction of antigen-specific immunity with a vaccine targeting NY-ESO-1 to the dendritic cell receptor DEC-205. Sci Transl Med 6, 232ra251 (2014). https://doi.org:10.1126/scitranslmed.3008068
Griffiths, E. A. et al. NY-ESO-1 Vaccination in Combination with Decitabine Induces Antigen-Specific T-lymphocyte Responses in Patients with Myelodysplastic Syndrome. Clin Cancer Res 24, 1019–1029 (2018). https://doi.org:10.1158/1078-0432.CCR-17-1792
Burmeister, W. P., Gastinel, L. N., Simister, N. E., Blum, M. L. & Bjorkman, P. J. Crystal structure at 2.2 A resolution of the MHC-related neonatal Fc receptor. Nature 372, 336–343 (1994). https://doi.org:10.1038/372336a0
Chaudhury, C. et al. The major histocompatibility complex-related Fc receptor for IgG (FcRn) binds albumin and prolongs its lifespan. J Exp Med 197, 315–322 (2003). https://doi.org:10.1084/jem.20021829
Raghavan, M., Bonagura, V. R., Morrison, S. L. & Bjorkman, P. J. Analysis of the pH dependence of the neonatal Fc receptor/immunoglobulin G interaction using antibody and receptor variants. Biochemistry 34, 14649–14657 (1995). https://doi.org:10.1021/bi00045a005
Roopenian, D. C. et al. The MHC class I-like IgG receptor controls perinatal IgG transport, IgG homeostasis, and fate of IgG-Fc-coupled drugs. J Immunol 170, 3528–3533 (2003). https://doi.org:10.4049/jimmunol.170.7.3528
Firan, M. et al. The MHC class I-related receptor, FcRn, plays an essential role in the maternofetal transfer of gamma-globulin in humans. Int Immunol 13, 993–1002 (2001). https://doi.org:10.1093/intimm/13.8.993
Simister, N. E. & Rees, A. R. Isolation and characterization of an Fc receptor from neonatal rat small intestine. Eur J Immunol 15, 733–738 (1985). https://doi.org:10.1002/eji.1830150718
Baker, K. et al. Neonatal Fc receptor for IgG (FcRn) regulates cross-presentation of IgG immune complexes by CD8-CD11b + dendritic cells. Proc Natl Acad Sci U S A 108, 9927–9932 (2011). https://doi.org:10.1073/pnas.1019037108
Baker, K. et al. Neonatal Fc receptor expression in dendritic cells mediates protective immunity against colorectal cancer. Immunity 39, 1095–1107 (2013). https://doi.org:10.1016/j.immuni.2013.11.003
Qiao, S. W. et al. Dependence of antibody-mediated presentation of antigen on FcRn. Proc Natl Acad Sci U S A 105, 9337–9342 (2008). https://doi.org:10.1073/pnas.0801717105
Prato, S., Mintern, J. D., Lahoud, M. H., Huang, D. C. & Villadangos, J. A. Induction of antigen-specific effector-phase tolerance following vaccination against a previously ignored B-cell lymphoma. Immunol Cell Biol 89, 595–603 (2011). https://doi.org:10.1038/icb.2010.131
Ober, R. J., Radu, C. G., Ghetie, V. & Ward, E. S. Differences in promiscuity for antibody-FcRn interactions across species: implications for therapeutic antibodies. Int Immunol 13, 1551–1559 (2001). https://doi.org:10.1093/intimm/13.12.1551
Rudensky, A., Rath, S., Preston-Hurlburt, P., Murphy, D. B. & Janeway, C. A., Jr. On the complexity of self. Nature 353, 660–662 (1991). https://doi.org:10.1038/353660a0
Fuertes Marraco, S. A. et al. Novel murine dendritic cell lines: a powerful auxiliary tool for dendritic cell research. Front Immunol 3, 331 (2012). https://doi.org:10.3389/fimmu.2012.00331
Pyzik, M., Kozicky, L. K., Gandhi, A. K. & Blumberg, R. S. The therapeutic age of the neonatal Fc receptor. Nat Rev Immunol, 1–18 (2023). https://doi.org:10.1038/s41577-022-00821-1
Platt, C. D. et al. Mature dendritic cells use endocytic receptors to capture and present antigens. Proc Natl Acad Sci U S A 107, 4287–4292 (2010). https://doi.org:10.1073/pnas.0910609107
Mahnke, K. et al. The dendritic cell receptor for endocytosis, DEC-205, can recycle and enhance antigen presentation via major histocompatibility complex class II-positive lysosomal compartments. J Cell Biol 151, 673–684 (2000). https://doi.org:10.1083/jcb.151.3.673
Gitlin, A. D. et al. HUMORAL IMMUNITY. T cell help controls the speed of the cell cycle in germinal center B cells. Science 349, 643–646 (2015). https://doi.org:10.1126/science.aac4919
Pasqual, G., Angelini, A. & Victora, G. D. Triggering positive selection of germinal center B cells by antigen targeting to DEC-205. Methods Mol Biol 1291, 125–134 (2015). https://doi.org:10.1007/978-1-4939-2498-1_10
Flacher, V. et al. Skin langerin + dendritic cells transport intradermally injected anti-DEC-205 antibodies but are not essential for subsequent cytotoxic CD8 + T cell responses. J Immunol 188, 2146–2155 (2012). https://doi.org:10.4049/jimmunol.1004120
Flacher, V. et al. Epidermal Langerhans cells rapidly capture and present antigens from C-type lectin-targeting antibodies deposited in the dermis. J Invest Dermatol 130, 755–762 (2010). https://doi.org:10.1038/jid.2009.343
Reuter, A. et al. Criteria for dendritic cell receptor selection for efficient antibody-targeted vaccination. J Immunol 194, 2696–2705 (2015). https://doi.org:10.4049/jimmunol.1402535
Canton, J. et al. The receptor DNGR-1 signals for phagosomal rupture to promote cross-presentation of dead-cell-associated antigens. Nat Immunol 22, 140–153 (2021). https://doi.org:10.1038/s41590-020-00824-x
Ngu, L. N. et al. In vivo targeting of protein antigens to dendritic cells using anti-DEC-205 single chain antibody improves HIV Gag specific CD4(+) T cell responses protecting from airway challenge with recombinant vaccinia-gag virus. Immun Inflamm Dis 7, 55–67 (2019). https://doi.org:10.1002/iid3.151
Zalevsky, J. et al. Enhanced antibody half-life improves in vivo activity. Nat Biotechnol 28, 157–159 (2010). https://doi.org:10.1038/nbt.1601
Robbie, G. J. et al. A novel investigational Fc-modified humanized monoclonal antibody, motavizumab-YTE, has an extended half-life in healthy adults. Antimicrob Agents Chemother 57, 6147–6153 (2013). https://doi.org:10.1128/AAC.01285-13
Wilson, K. R. et al. MARCH1-mediated ubiquitination of MHC II impacts the MHC I antigen presentation pathway. PLoS One 13, e0200540 (2018). https://doi.org:10.1371/journal.pone.0200540

Supplementary Figure 1 and 2 are not included with this version

(Not answered)

Download PDF

Journal Publication

published 09 Apr, 2024

Read the published version in npj Vaccines →

Editorial decision: revise
13 Sep, 2023
Review #3 received at journal
05 Sep, 2023
Reviewer #3 agreed at journal
05 Sep, 2023
Review #2 received at journal
01 Sep, 2023
Reviewer #2 agreed at journal
01 Sep, 2023
Review #1 received at journal
28 Aug, 2023
Reviewer #1 agreed at journal
28 Aug, 2023
Reviewers invited by journal
22 Aug, 2023
Editor assigned by journal
08 Aug, 2023
Submission checks completed at journal
28 Jul, 2023
First submitted to journal
28 Jul, 2023

You are reading this latest preprint version

FcRn regulates antigen presentation downstream of dendritic cell receptor-targeted vaccination.

Status:

Journal Publication

Version 1

Abstract

Figures

INTRODUCTION

RESULTS

DISCUSSION

MATERIALS AND METHODS

Mice

Isolation of immune cells

Bone-marrow-derived macrophages

Immunoblotting

Serum antibody analysis

Prophylactic vaccination assay and analysis of killing of Eµ-myc-OVA lymphoma

In vivo antigen presentation assay

Ex vivo antigen presentation assay

Mixed bone marrow chimera

In vivo CTL killing assay

Declarations

References

Supplementary Figure

Additional Declarations

Status:

Journal Publication

Version 1