Zinc overload induces mitochondrial dysfunction and ROS-mediated mitophagy

doi:10.21203/rs.3.rs-3213158/v1

Download PDF

Research Article

Zinc overload induces mitochondrial dysfunction and ROS-mediated mitophagy

https://doi.org/10.21203/rs.3.rs-3213158/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 16 Oct, 2023

Read the published version in Cardiovascular Toxicology →

You are reading this latest preprint version

Zinc homeostasis is essential for maintaining redox balance, cell proliferation, and apoptosis. However, excessive zinc exposure is toxic and leads to mitochondrial dysfunction. In this study, we established a zinc overload model by treating rat cardiomyocyte H9c2 cells with ZnCl₂ at different concentrations. Our results showed that zinc overload increased LDH and reactive oxygen species (ROS) levels, leading to cell death, mitochondrial membrane potential decrease and impaired mitochondrial function and dynamics. Furthermore, zinc overload activated the PINK1/Parkin signaling pathway and induced mitochondrial autophagy via ROS, while NAC inhibited mitophagy and weakened the activation of PINK1/Parkin pathway, thereby preserving mitochondrial biogenesis. In addition, our data also showed that Mfn2 deletion increased ROS production and exacerbated cytotoxicity induced by zinc overload. Our results therefore suggest that ZnCl₂-induced ROS generation causes mitochondrial autophagy and mitochondrial dysfunction, damaging H9c2 cardiomyocytes. Additionally, Mfn2 may play a key role in zinc ion-mediated endoplasmic reticulum and mitochondrial interactions.

Zinc overload

Reactive oxygen

Mitophagy

Mitofusin-2

H9c2

Zinc is an essential trace element that plays a vital role in various physiological processes, but excessive exposure to zinc can have toxic effects on the body, including the cardiovascular system. Zinc homeostasis in cells is essential for the balance between health and disease. Long-term exposure to zinc in the environment such as air, water, soil and food, can have toxic effects on the digestive, respiratory, nervous and cardiovascular systems [1]. Zinc overload is associated with the occurrence of cardiovascular diseases [2], including coronary heart disease and atherosclerosis. Zinc overload also causes mitochondrial stress and eventually cell death in Hela cell culture [3].

Mitochondria are the main site of cell function and energy production and the primary source of ROS in cells. Mitochondrial autophagy (mitophagy) is a mechanism by which cells selectively remove damaged mitochondria. Mitochondria play a crucial role in cell metabolism, energy and ROS production [4]. Excessive ROS can cause mitochondrial oxidative damage and dysfunction, leading to diabetes, neurodegenerative diseases and cancer [5, 6]. Meanwhile, ROS production and mitochondrial dysfunction are crucial to trigger mitochondrial autophagy [7].

Cells selectively remove damaged mitochondria through autophagy, which is called mitophagy [8]. Many stimuli can trigger mitochondrial autophagy and cell death. When some mitochondria are damaged, selective removal through mitochondrial autophagy has a protective effect on cells. However, once stress becomes severe, the number of damaged mitochondria increases, and cell death occurs when mitochondrial autophagy fails to maintain mitochondrial homeostasis [9]. PINK1/Parkin-mediated mitochondrial autophagy has become a research hotspot. Additionally, Mfn2 is a key regulator of the mitochondrial-endoplasmic reticulum contact site and its deficiency can lead to mitochondrial damage. Studies have shown that Parkin-induced mitophagy enhances cyclophilin D (CypD) -induced mPTP opening and is therefore fatal to reperfused hearts [10]. In cardiac I/R injury models, Parkin-induced mitophagy leads to excessive mitochondrial elimination and insufficient ATP supply, thus transmitting death promoting signals to cardiac microvascular endothelial cells [11]. In addition, adriamycin-induced mitophagy and mitochondrial damage are also associated with dysregulation of the PINK1/Parkin pathway [12].

Mitochondria-associated endoplasmic reticulum membranes are involved in the regulation of biogenesis and proteins related to mitochondrial fission and fusion are significantly enriched in MAMs. Mitochondrial fusion proteins are mainly MFN1, MFN2 and OPA1. MFN2 is located in both the outer mitochondrial membrane and the endoplasmic reticulum membrane and is key for mitochondrial-endoplasmic reticulum contact [13]. Mfn2 silencing activates PERK pathway, reduces MAMs, causing mitochondrial dysfunction and apoptosis [14]. Deletion of the mitochondrial fusion protein Mfn1 has little effect on cardiac function under physiological or pathological conditions [15], whereas Mfn2-deficient hearts exhibit extensive mtDNA breaks and mitochondrial damage [16]. However, the role of Mfn2 in zinc overload induced cardiomyocyte injury is unclear.

In this study, we investigated whether zinc overload mediates mitochondrial autophagy and dynamics through ROS production to damage cardiomyocytes. We further examined whether Mfn2 deficiency induces increased ROS production and exacerbates the cytotoxicity induced by zinc overload.

Chemicals and Reagents

ZnCl₂ (Cat#: H6377), 3-Methyladenine (Cat#: 9281) were purchased from Sigma-Aldrich. N-acetyl-L-cysteine (Cat#: S0077) was purchased from Beyotime Biotechnology. Tetramethylrhodamine ethylester (TMRE) (Cat#: T669), Mito-tracker Green (Cat#: M7514), Hoechst 33342 (Cat#: H3570), MitoSOX (Cat#: M36009) were purchased from Thermo Fisher Scientific. DCFH-DA (Cat#: S0033S-1) and Lyso tracker (Cat#: C1046) were purchased from Beyotime Biotechnology. Mounting Medium, antifading (with DAPI) was purchased from Solarbio Life Sciences. Lipofectamine 3000 Transfection Kit (Cat#: L3000015) and Opti-MEM (Cat#: 11058021) medium were purchased from Invitrogen Life Technologies. SignalSilences Control siRNA, SignalSilences Mfn2 siRNA were purchased from Zhongshi Tontru. Antibodies including anti-LC3 (Cat#: 3868), anti-P62 (Cat#: 5114), anti-Beclin-1 (Cat#: 3495), anti-Mfn1 (Cat#: 14739), anti-Mfn2 (Cat#: 9482), anti-OPA1 (Cat#: 80471), anti-Drp1 (Cat#: 8570), the Anti-rabbit IgG, HRP-linked Antibody (Cat#: 7074) and the Anti-rabbit IgG(H + L), F(ab’)2 Fragment (Alexa Fluor 488 Conjugate) (Cat#: 4412) were obtained from Cell Signaling Technology. Anti-PINK1 (Cat#: 23274-1-AP), anti-Parkin (Cat#: 14060-1-AP), anti-TOM20 (Cat#: 11802-1-AP), anti-COX4 (Cat#: 11242-1-AP), anti-Fis1 (Cat#: 10956-1-AP) and anti-GAPDH (Cat#: 10494-1-AP) was purchased from Proteintech Group.

Cell culture

Rat heart derived H9c2 cardiac myoblast cells (ATCC, Manassas, VA) were cultured in DMEM (4.5g/L D-Glucose) containing 10% fetal bovine serum and 1% penicillin-streptomycin at 37°C. The medium was changed every 2 to 3 days and the cells are passaged using 0.25% trypsin when the cell density reaches approximately 90%.

Cell viability assay

To assess cell viability, the MTT assay (Solarbio, Beijing, China) was performed according to kit instructions. Cells were seeded at a density of 5×10³ cells/well in a 96-well plate and incubated at 37°C in a 5% CO₂ incubator for 24 hr. Treating H9c2 cells with 10 µmol/L ZnCl₂ for 20 min has protective effect on myocardial cells[17], so this experiment treated cells with 12.5, 25 and 50 µmol/L ZnCl₂ for 20, 40 and 60min, and established zinc overload model by MTT assay. Next, 10 µl of MTT solution was added to each well, and the cells were incubated for 4 hr. The supernatant was then aspirated, and 110 µl of Formazan solution was added to each well to dissolve the crystals completely. The absorbance value of each well was measured at 490nm using a plate reader.

LDH assay

Commercial LDH assay kit (Jiancheng, Nanjing, China) was used to detect LDH enzyme activity in H9c2 cells for evaluating cellular injury according to the manufacturer’s instructions.

Western Blot Analysis

Cell lysis Buffer (1×) containing PMSF (Cell Signaling Tech, USA) was used to lyse the cells for 10 minutes. The lysed cells were centrifuged at 12,000 rpm for 15 min at 4°C, and the protein concentration of each sample was measured using the BCA kit (Beyotime, Shanghai, China). The total proteins were separated on 10–15% SDS-PAGE and transferred to PVDF membranes (Bio-Rad, USA). Primary antibodies for LC3, P62, Beclin1, GAPDH, Mfn2, Mfn1 (Cell Signaling Tech, USA), PINK1, Parkin, COX IV, Tom20, OPA1, Drp1, Fis1 (Proteintech Group) were incubated overnight at 4°C, followed by the Anti-rabbit IgG, HRP-linked Antibody (Cell Signaling Tech, USA) for 2 hr at room temperature. The blots were developed using an ultrasensitive ECL chemiluminescence kit (Beyotime, Shanghai, China) and analyzed for densitometry using ImageJ software.

Immunofluorescence and fluorescence microscopy

Cells were seeded in confocal dishes and incubated until 80%-90% confluency was achieved. Cells to be incubated with LC3 antibody were washed three times with PBS, and fixed in ice-cold 100% methanol at -20˚C for 15 minutes, while other cells incubated with Tom20, PINK1, Mfn2, Mfn1, Fis1 antibodies were fixed in 4% tissue cell fixative (Solarbio, Beijing, China) for 15 min, followed by three washes in PBS. Cells were blocked in immunofluorescent blocking solution for 1 hr. Primary antibodies were diluted with immunofluorescent photoantibody dilution buffer (Beyotime, Shanghai, China) and incubated overnight at 4˚C, with following dilution primary antibodies (1:50 for Mfn1 and Mfn2, 1:100 for LC3, and 1:200 for Tom20, PINK1 and Fis1) were added. The Anti-rabbit IgG(H + L), F(ab’)2 Fragment (Alexa Fluor 488 Conjugate) (Cell Signaling Tech, USA) was diluted at 1:1000 with immunofluorescent antibody diluent. Cells were incubated for 2 hr at room temperature in dark and then blocked with DAPI-containing anti-fluorescence attenuating blocker (Solarbio, Beijing, China). The change in fluorescence intensity of each group of cells was observed using Olympus FLUOVIEW-1000.

Confocal imaging of cell and mitochondrial ROS

To determine the levels of reactive oxygen species in cells and mitochondria, H9c2 cardiomyocytes were incubated with DCFH-DA (Beyotime, Shanghai, China) and MitoSOX (Invitrogen, USA) fluorescent dyes, respectively. When the cell density reached 70%, cells were grouped and incubated with DCFH-DA (10 µM) for 20 min and MitoSOX (5 µM) in Tyrode solution for 30 min. After washing the cells three times with Tyrode solution, images were obtained using the Olympus FLUOVIEW FV-1000 (Olympus Corporation, Tokyo, Japan) laser scanning confocal microscope.

Real-Time Quantitative PCR

Total mRNA was extracted from each group using Trizol reagent (Solarbio, Beijing, China). Reverse transcription was performed to generate 2 µg cDNA. Primers for Mfn2 and PINK1 were used as follows: Mfn2-F: ACGCTGAACTTCTTACTG, Mfn2-R: CTCTAACTCTACCTGTCCTA; PINK1-F: AATGCCGCTGTGTATGAA, PINK1-R: TCCTGCCGAGATATTCCA. GAPDH-F: GATGCTGGTGCTGAGTATGRCG, GAPDH-R: GTGGTGCAGGATGCATTGCTCTGA. Gene expression was measured using 2× qPCR Mix (Solarbio, Beijing, China) and PCR system for quantitative RT-PCR to detect mRNA expression.

siRNA transfection

H9c2 cells were transfected with siRNA (Zhongshi Tontru, TianJin, China) when they reached approximately 80% confluence in DMEM containing 10% fetal bovine serum. The siRNA and Lipofectamine 3000 (Invitrogen, USA) were prepared in 100 µl of serum-free OPTI-MEM medium (Gibco, USA) and applied to the cells. Subsequent experiments were performed after incubation in the incubator for 48–72 hours.

Confocal imaging of the mitochondrial membrane potential

To measure the mitochondrial membrane potential, H9c2 cardiomyocytes were stained with Tetramethyl rhodamine, ethyl ester (TMRE) fluorescent dye (Thermo Fisher Scientific, USA). When the cell density reached 70%, cells were grouped and incubated in Tyrode solution with TMRE (100 nM) for 20 minutes. Cells were washed three times with Tyrode solution, and imaged Using an Olympus FLUOVIEW FV-1000 (Olympus Corporation, Tokyo, Japan) laser scanning confocal microscopy.

Quantification and Statistical Analysis

Data are presented as mean ± SEM. Tukey's test was used to determine statistical differences after t-test or ANOVA. p < 0.05 was considered statistically significant. Statistical analysis was performed using SPSS 26.0.

Zinc overload reduces cell viability while induces LDH Release in cardiomyocyte H9c2 cells

The MTT assay was used to detect the effect of zinc chloride on cell viability at different concentrations. As shown in Fig. 1, the H9c2 cell viability decreased with increasing concentrations of zinc chloride and treatment time (Figs. 1a and b). Myocardial cell injury was assessed by measuring the level of LDH in the extracellular fluid using a microplate assay. The level of LDH increased with increasing concentrations of ZnCl₂ (Fig. 1c). These results indicate the toxic effect of zinc overload on cells.

Zinc overload induces mitophagy via the PINK1/parkin pathway

We assessed the expression of autophagy and mitochondrial autophagy related proteins by western blotting. The expressions of LC3 and Beclin-1 protein and the expressions of PINK1 and Parkin total protein and mitochondrial protein increased significantly with the increase of ZnCl₂ concentration. In addition, the expression of P62 decreased (Figs. 2a and c). Confocal microscopy revealed an increase in green fluorescence intensity of LC3 following treatment with ZnCl₂ (Fig. 2b). These results suggested that zinc overload induces mitochondrial autophagy through the PINK1/parkin pathway.

3MA inhibits mitophagy induced by zinc overload

Cells were pretreated with the autophagy inhibitor 3MA (10µM) for 2 hr before being treated for 1 hr with ZnCl₂ (25µM), which significantly increased the expressions of LC3, Beclin-1, PINK1 and parkin, while decreasing the expressions of P62 and Tom20 (Figs. 3a and b). ZnCl2 also increased the green fluorescence intensity of LC3 (Fig. 3c) and decreased the green fluorescence intensity of Tom20 (Fig. 3d). Additionally, ZnCl₂ enhanced the red fluorescence intensity of lysosome lyso-Tracker red and increased mitochondrial and lysosome colocalization (Fig. 3e). These effects were reversed by 3MA, confirming that zinc overload induces mitophagy.

ROS is involved in mitophagy induced by zinc overload

Since ROS is closely related to mitophagy, we treated cells with ROS inhibitor NAC. Treatment with 25µM ZnCl₂ significantly increased the expressions of LC3, Beclin-1, PINK1 and parkin, while decreasing the expression of P62 (Figs. 4a and b). ZnCl₂ also increased the expression of PINK1 mRNA and enhanced the green fluorescence intensity of PINK1 (Figs. 4c and d).

Zinc overload increases cellular and mitochondria ROS level

Previous studies show that metal toxicity increases ROS production. Confocal microscopy showed that the fluorescence intensities of both DCFH-DA and MitoSOX Red increased with the increase concentration of ZnCl₂ (Figs. 5a and b). The effects of ZnCl₂ were inhibited by NAC (Figs. 5c). These results confirmed that zinc overload increases intracellular and mitochondrial ROS.

Zinc overload induces MAMs through ROS

MAMs play a vital role in various cellular processes, including mitochondrial autophagy, apoptosis and closely related mitochondrial death pathways. ZnCl₂ treatment led to a reduction in the expressions of mitochondrial fusion proteins, such as Mfn2, Mfn1 and OPA1, while increasing the expressions of mitochondrial fission proteins Drp1 and Fis1 (Figs. 6a and b). Furthermore, ZnCl₂ treatment decreased the mRNA expression and green fluorescence intensity of Mfn2 (Figs. 6c and d). NAC, a ROS inhibitor, reversed the effects of ZnCl₂ on MAMs. These results indicate that zinc overload affects MAMs by inducing ROS and thus affects mitochondrial quality.

Zinc overload promotes mitophagy by inducing ROS through Mfn2

Mfn2 is present in both the endoplasmic reticulum and mitochondria, where it mediates mitochondrial autophagy and fusion. To explore the role of Mfn2 in zinc-induced mitophagy, we used Mfn2 siRNA and western blotting to detect the expression of autophagy and mitochondrial autophagy- related proteins (Fig. 7a). ZnCl₂ treatment significantly increased the expression of LC3, PINK1 and Parkin, while decreasing the expression of P62 (Fig. 7b). Additionally, the green fluorescence intensity of LC3 and PINK1 was enhanced by ZnCl₂ treatment under confocal microscopy (Figs. 7c and d). NAC blocked the effect of ZnCl₂ and Mfn2 siRNA reversed the effect of NAC, confirming that confirming that zinc overload promotes mitochondrial autophagy by inducing ROS through Mfn2.

Zinc overload affects MAMs by inducing ROS through Mfn2

We investigated the effect of ZnCl2 on mitochondrial fusion and fission proteins using western blotting. ZnCl₂ treatment decreased the expression of Mfn2, Mfn1 and OPA1, while increasing the expression of Drp1 and Fis1 proteins (Fig. 8a). Moreover, confocal microscopy showed that ZnCl₂ treatment decreased the green fluorescence intensity of Mfn1 (Fig. 8b) and increased the green fluorescence intensity of Fis1 (Fig. 8c). NAC inhibited the effect of ZnCl₂, while Mfn2 siRNA reversed the effect of NAC, confirming that zinc overload affects MAMs through ROS induction by Mfn2.

Zinc overload induces the opening of mPTP via Mfn2 induction of ROS

mPTP opening is a crucial event of mitochondrial death pathway. Confocal microscopy revealed that the red fluorescence intensity of TMRE decreased with the increase concentration of ZnCl₂ (Fig. 9a). NAC inhibited the effect of ZnCl₂, while Mfn2 siRNA reversed the effect of NAC (Fig. 9b). These findings suggest that zinc overload induces ROS through Mfn2 and activates the mitochondrial death pathway by opening mPTP.

Our study sheds new light on the toxicology of zinc and its impact on the environment and public health. Zinc is an essential trace element that plays a critical role in maintaining homeostasis in the human body, with more than 90% distributed in most tissues. However, high concentrations of zinc can be detrimental to cells [18, 19]. We investigated the effects of different concentrations of zinc chloride on cell survival and found that it decreased with increasing zinc chloride concentration and treatment time compared to the control group. Additionally, we evaluated myocardial injury using LDH, which is mainly derived from myocardium, and significant for diagnosing heart diseases. LDH is released into extracellular fluid from damaged cardiomyocytes and serves as a common index used to access myocardial injury, and it becomes an auxiliary diagnostic index in the later stage of acute myocardial infarction [20, 21]. The extracellular fluid LDH level of H9c2 increased with the increase of ZnCl₂ concentration, indicating the severity of cell damage These results suggest the toxic effect of zinc overload on cells. Overall, our study provides important insights into the toxicology of zinc and highlights the need to protect the environment and public health from zinc-induced toxicity.

Autophagy is a cellular process that is activated under stress conditions such as hypoxia, starvation, oxidative stress and infection [22]. While autophagy has a protective effect on cells in most cases, it can also lead to cell death, making it a double-edged sword in the pathogenesis of human diseases [23]. Recent studies have shown that excessive autophagy activation can be harmful to the heart under stress conditions such as reperfusion injury [24]. Additionally, anticancer drugs DOX can dose-dependently increase myocardial cell death by down-regulating GATA4 and activating autophagy, whereas 2-deoxyglucose can antagonize s DOX-induced myocardial cell death by inhibiting autophagy [25].

To understand the role of autophagy in zinc-induced toxicity, we examined the expression of autophagy-related proteins in H9c2 cardiomyocytes exposed to increasing concentrations of ZnCl₂. We found that the expression of LC3 and Beclin-1 proteins increased, while the expression of P62 decreased, indicating that autophagy was activated by zinc overload. Confocal microscopy results also showed that ZnCl₂ enhanced the green fluorescence intensity of LC3, further suggesting that zinc overload damages cardiomyocytes through autophagy.

Mitochondrial autophagy plays a crucial role in the clearance of damaged mitochondria and is associated with cardiovascular diseases such as heart failure and coronary atherosclerosis [26, 27]. In damaged mitochondria, an E3 ubiquitin ligase Parkin is phosphorylated by PINK1, which induces a transfer of Parkin from the cytoplasm to the mitochondria and subsequently ubiquitinates other proteins such as Mfn2 and Mfn1 in the outer mitochondrial membrane, further causing mitochondrial autophagy [28–30]. We investigated whether zinc overload caused mitochondrial autophagy in H9c2 cardiomyocytes via the PINK1/Parkin pathway. Our results showed that the expression of both total and mitochondrial proteins of PINK1 and Parkin significantly increased with increasing ZnCl₂ concentrations. Subsequent experiments were performed using 25 µmol/L ZnCl₂ and cells were pretreated with the autophagy inhibitor 3MA to verify whether zinc overload caused mitochondrial autophagy. We found that ZnCl₂ significantly increased the expression of LC3, Beclin-1, PINK1 and parkin, and decreased the expression of P62 and Tom20. In addition, ZnCl₂ increased the red fluorescence of lysosomal lyso-Tracker red and increased the co-localization of mitochondria with lysosomes. These effects were reversed by 3MA, further confirming that zinc overload caused mitochondrial autophagy. Our study provides new insights into the mechanism of zinc-induced toxicity and highlights the role of autophagy, particularly mitochondrial autophagy via the PINK1/Parkin pathway, in the pathogenesis of zinc overload-induced cardiomyocyte damage.

Reactive oxygen species (ROS) have been found to induce the activation of mitochondrial autophagy [31]. Dysregulation of cellular zinc can lead to mitochondrial stress, excessive mitochondrial autophagy, and increased ROS production, resulting in dysfunctional metabolism [32]. In this study, we treated cells with the ROS inhibitor NAC and found that ZnCl₂ significantly increased the expression of LC3, Beclin-1, PINK1 and parkin, while decreasing the expression of P62. We also observed an increase in PINK1 mRNA expression and intensity of PINK1 green fluorescence, which were each reversed by NAC. These results suggest that ROS are involved in mitochondrial autophagy induced by zinc overload. Studies have shown that metal toxicity may increase ROS production [33, 34]. Therefore, we used the intracellular ROS fluorescent probe DCFH-DA and the mitochondrial ROS fluorescent probe MitoSOX Red to stain H9c2 cardiomyocytes. Confocal microscopy revealed that both DCFH-DA green and MitoSOX Red fluorescence intensity increased with increasing ZnCl₂ concentration, and NAC inhibited the effect of ZnCl₂. These results confirmed that zinc overload increases intracellular and mitochondrial ROS.

Mitochondria-associated membranes (MAMs) play an important role in regulating mitochondrial autophagy and apoptosis, as well as mitochondrial dynamics and biogenesis [35]. ROS are required for the maintenance of cellular homeostasis, but their overproduction in mitochondria can lead to oxidative damage to proteins, lipids and DNA [36]. Excessive calcium transfer from MAMs can be induce mitochondrial ROS, highlighting the relevance of MAMs to mitochondrial ROS [37]. We examined the expression of MAMs related proteins to investigate whether zinc overload affects MAMs via ROS. ZnCl₂ decreased the expression of mitochondrial fusion proteins Mfn2, Mfn1 and OPA1, increased the expression of mitochondrial splitting proteins Drp1 and Fis1, decreased the expression of Mfn2 mRNA, and decreased the intensity of Mfn2 green fluorescence. These effects were reversed by NAC, suggesting that zinc overload affects MAMs via ROS and mitochondrial quality control.

Mfn2 GTPase located in both the endoplasmic reticulum and mitochondria to mediate mitochondrial autophagy and fusion of the outer membrane [38]. We utilizedMfn2 siRNA to detect the expression of autophagy and mitochondrial autophagy-related proteins. ZnCl₂ significantly increased the expression of LC3, PINK1, and Parkin while decreasing the expression of P62. Confocal microscopy also observed that ZnCl₂ enhanced the green fluorescence intensity of LC3 and PINK1. The ROS inhibitor NAC inhibited the effect of ZnCl₂, while Mfn2 siRNA reversed the effect of NAC. These results confirm that zinc overload promotes mitochondrial autophagy through Mfn2 induced ROS. We further investigated whether zinc overload affects MAMs through Mfn2-induced ROS production. ZnCl₂ decreased the expression of Mfn2, Mfn1 and OPA1, while increasing the expression of Drp1 and Fis1. Confocal microscopy observed that ZnCl₂ reduced the green fluorescence intensity of Mfn1 and enhanced the green fluorescence intensity of Fis1. Importantly, the effect of ZnCl₂ on mitochondrial autophagy was found to be dependent on Mfn2-induced ROS, as the ROS inhibitor NAC inhibited this effect, while Mfn2 siRNA reversed it. These results confirm that zinc overload affects MAMs through ROS induction by Mfn2.

Studies have shown that silencing Mfn2 induces H9c2 cells to promote mPTP opening and apoptosis in an in vitro I/R injury model [39]. We investigated the effect of zinc overload on the mitochondrial death pathway induced by mPTP opening. We found that ZnCl₂ reduces the red fluorescence intensity of TMRE when Mfn2 was silenced, and this effect was significantly inhibited by NAC. Importantly, Mfn2 siRNA reversed the effect of NAC, confirming that zinc overload induces ROS through Mfn2 and opens the mitochondrial death pathway induced by mPTP.

In summary, zinc overload induced ROS-mediated mitophagy and mitochondrial dysfunction, damaging H9c2 cardiomyocytes. Mfn2 deficiency increased ROS production and exacerbated the cytotoxicity induced by zinc overload.

Conflicts of interest

No conflicts of interest are declared by the authors.

Author contribution

Ying Yang: conception, procedure, writing - original draft; Pei Wang: data organization, writing - review; Jiabao Guo: formal analysis, data organization; Tingting Ma: validation, survey; Youcheng Hu: formal analysis, data organization; Huang Luyao and Bohan Xing: resources, visualization. Jinkun Xi and Yonggui He: project management, writing-original draft.

Acknowledgements

This work was supported by the Natural Science Foundation of China (No.82270303); the Natural Science Foundation of Hebei Province (No. H2020209172, H2021209061); the Department of Education of Hebei Province (No. ZD2020110); Hebei Province Funding Program for Returning scholars (No. A20200508).

Rahimzadeh, M. R., Rahimzadeh, M. R., Kazemi, S., & Moghadamnia, A. A. (2020). Zinc Poisoning - Symptoms, Causes, Treatments. Mini reviews in medicinal chemistry, 20, 1489–1498. http://doi.org/10.2174/1389557520666200414161944.
Zhao, T., Huang, Q., Su, Y., Sun, W., Huang, Q., & Wei, W. (2019). Zinc and its regulators in pancreas. Inflammopharmacology, 27, 453–464. http://doi.org/10.1007/s10787-019-00573-w.
Knies, K. A., & Li, Y. V. (2021). Zinc cytotoxicity induces mitochondrial morphology changes in hela cell line. International journal of physiology pathophysiology and pharmacology, 13, 43–51.
Di Meo, S., & Venditti, P. (2020). Evolution of the Knowledge of Free Radicals and Other Oxidants. Oxidative medicine and cellular longevity 2020: 9829176. http://doi.org/10.1155/2020/9829176.
Chen, G., Kroemer, G., & Kepp, O. (2020). Mitophagy: An Emerging Role in Aging and Age-Associated Diseases. Frontiers in cell and developmental biology, 8, 200. http://doi.org/10.3389/fcell.2020.00200.
Luo, Y., Ma, J., & Lu, W. (2020). The Significance of Mitochondrial Dysfunction in Cancer. International journal of molecular sciences 21. http://doi.org/10.3390/ijms21165598.
Xiao, B., Kuruvilla, J., & Tan, E. K. (2022). Mitophagy and reactive oxygen species interplay in Parkinson's disease. NPJ Parkinson's disease, 8, 135. http://doi.org/10.1038/s41531-022-00402-y.
Ashrafi, G., & Schwarz, T. L. (2013). The pathways of mitophagy for quality control and clearance of mitochondria. Cell death and differentiation, 20, 31–42. http://doi.org/10.1038/cdd.2012.81.
Mekala, N. K., Kurdys, J., Depuydt, M. M., Vazquez, E. J., & Rosca, M. G. (2019). Apoptosis inducing factor deficiency causes retinal photoreceptor degeneration. The protective role of the redox compound methylene blue. Redox biology, 20, 107–117. http://doi.org/10.1016/j.redox.2018.09.023.
Sun, T., Ding, W., Xu, T., Ao, X., Yu, T., Li, M., Liu, Y., Zhang, X., Hou, L., & Wang, J. (2019). Parkin Regulates Programmed Necrosis and Myocardial Ischemia/Reperfusion Injury by Targeting Cyclophilin-D. Antioxidants & redox signaling, 31, 1177–1193. http://doi.org/10.1089/ars.2019.7734.
Zhou, H., Zhang, Y., Hu, S., Shi, C., Zhu, P., Ma, Q., Jin, Q., Cao, F., Tian, F., & Chen, Y. (2017). Melatonin protects cardiac microvasculature against ischemia/reperfusion injury via suppression of mitochondrial fission-VDAC1-HK2-mPTP-mitophagy axis. Journal of pineal research, 63. http://doi.org/10.1111/jpi.12413.
Yin, J., Guo, J., Zhang, Q., Cui, L., Zhang, L., Zhang, T., Zhao, J., Li, J., Middleton, A., Carmichael, P. L., & Peng, S. (2018). Doxorubicin-induced mitophagy and mitochondrial damage is associated with dysregulation of the PINK1/parkin pathway. Toxicology in vitro: an international journal published in association with BIBRA, 51, 1–10. http://doi.org/10.1016/j.tiv.2018.05.001.
de Brito, O. M., & Scorrano, L. (2008). Mitofusin 2 tethers endoplasmic reticulum to mitochondria. Nature, 456, 605–610. http://doi.org/10.1038/nature07534.
Cao, Y., Chen, Z., Hu, J., Feng, J., Zhu, Z., Fan, Y., Lin, Q., & Ding, G. (2021). Mfn2 Regulates High Glucose-Induced MAMs Dysfunction and Apoptosis in Podocytes via PERK Pathway. Frontiers in cell and developmental biology, 9, 769213. http://doi.org/10.3389/fcell.2021.769213.
Chen, Y., Csordás, G., Jowdy, C., Schneider, T. G., Csordás, N., Wang, W., Liu, Y., Kohlhaas, M., Meiser, M., Bergem, S., Nerbonne, J. M., Dorn, G. W., & Maack, C. (2012). Mitofusin 2-containing mitochondrial-reticular microdomains direct rapid cardiomyocyte bioenergetic responses via interorganelle Ca(2+) crosstalk. Circulation research, 111, 863–875. http://doi.org/10.1161/circresaha.112.266585.
Chen, Y., Sparks, M., Bhandari, P., Matkovich, S. J., & Dorn, G. W. 2nd (2014). Mitochondrial genome linearization is a causative factor for cardiomyopathy in mice and Drosophila. Antioxidants & redox signaling, 21, 1949–1959. http://doi.org/10.1089/ars.2013.5432.
He, Y., Fu, Y., Xi, M., Zheng, H., Zhang, Y., Liu, Y., Zhao, Y., Xi, J., & He, Y. (2020). Zn(2+) and mPTP mediate resveratrol-induced myocardial protection from endoplasmic reticulum stress. Metallomics: integrated biometal science, 12, 290–300. http://doi.org/10.1039/c9mt00264b.
King, J. C., Shames, D. M., & Woodhouse, L. R. (2000). Zinc homeostasis in humans. The Journal of nutrition 130: 1360s-1366s. http://doi.org/10.1093/jn/130.5.1360S.
Liuzzi, J. P., & Cousins, R. J. (2004). Mammalian zinc transporters. Annual review of nutrition, 24, 151–172. http://doi.org/10.1146/annurev.nutr.24.012003.132402.
Zilinyi, R., Czompa, A., Czegledi, A., Gajtko, A., Pituk, D., Lekli, I., & Tosaki, A. (2018). The Cardioprotective Effect of Metformin in Doxorubicin-Induced Cardiotoxicity: The Role of Autophagy. Molecules (Basel, Switzerland) 23. http://doi.org/10.3390/molecules23051184.
Botelho, A. F. M., Miranda, A. L. S., Freitas, T. G., Milani, P. F., Barreto, T., Cruz, J. S., & Melo, M. M. (2020). Comparative Cardiotoxicity of Low Doses of Digoxin, Ouabain, and Oleandrin. Cardiovascular toxicology, 20, 539–547. http://doi.org/10.1007/s12012-020-09579-1.
Klionsky, D. J. (2007). Autophagy: from phenomenology to molecular understanding in less than a decade. Nature reviews Molecular cell biology, 8, 931–937. http://doi.org/10.1038/nrm2245.
Mizushima, N., Levine, B., Cuervo, A. M., & Klionsky, D. J. (2008). Autophagy fights disease through cellular self-digestion. Nature, 451, 1069–1075. http://doi.org/10.1038/nature06639.
Sciarretta, S., Maejima, Y., Zablocki, D., & Sadoshima, J. (2018). The Role of Autophagy in the Heart. Annual review of physiology, 80, 1–26. http://doi.org/10.1146/annurev-physiol-021317-121427.
Chen, K., Xu, X., Kobayashi, S., Timm, D., Jepperson, T., & Liang, Q. (2011). Caloric restriction mimetic 2-deoxyglucose antagonizes doxorubicin-induced cardiomyocyte death by multiple mechanisms. The Journal of biological chemistry, 286, 21993–22006. http://doi.org/10.1074/jbc.M111.225805.
Kundu, M., Lindsten, T., Yang, C. Y., Wu, J., Zhao, F., Zhang, J., Selak, M. A., Ney, P. A., & Thompson, C. B. (2008). Ulk1 plays a critical role in the autophagic clearance of mitochondria and ribosomes during reticulocyte maturation. Blood, 112, 1493–1502. http://doi.org/10.1182/blood-2008-02-137398.
Javidi, M., Zarei, M., Naghavi, N., Mortazavi, M., & Nejat, A. H. (2014). Zinc oxide nano-particles as sealer in endodontics and its sealing ability. Contemporary clinical dentistry, 5, 20–24. http://doi.org/10.4103/0976-237x.128656.
Manzanillo, P. S., Ayres, J. S., Watson, R. O., Collins, A. C., Souza, G., Rae, C. S., Schneider, D. S., Nakamura, K., Shiloh, M. U., & Cox, J. S. (2013). The ubiquitin ligase parkin mediates resistance to intracellular pathogens. Nature, 501, 512–516. http://doi.org/10.1038/nature12566.
Diao, R. Y., & Gustafsson, Å., B (2022). Mitochondrial quality surveillance: mitophagy in cardiovascular health and disease. American journal of physiology Cell physiology, 322, C218–c230. http://doi.org/10.1152/ajpcell.00360.2021.
Ajoolabady, A., Chiong, M., Lavandero, S., Klionsky, D. J., & Ren, J. (2022). Mitophagy in cardiovascular diseases: molecular mechanisms, pathogenesis, and treatment. Trends in molecular medicine, 28, 836–849. http://doi.org/10.1016/j.molmed.2022.06.007.
Chen, Y. R., & Zweier, J. L. (2014). Cardiac mitochondria and reactive oxygen species generation. Circulation research, 114, 524–537. http://doi.org/10.1161/circresaha.114.300559.
Xu, R., Chen, M. Y., Liang, W., Chen, Y., & Guo, M. Y. (2021). Zinc Deficiency Aggravation of ROS and Inflammatory Injury Leading to Renal Fibrosis in Mice. Biological trace element research, 199, 622–632. http://doi.org/10.1007/s12011-020-02184-x.
Cao, X., Fu, M., Bi, R., Zheng, X., Fu, B., Tian, S., Liu, C., Li, Q., & Liu, J. (2021). Cadmium induced BEAS-2B cells apoptosis and mitochondria damage via MAPK signaling pathway. Chemosphere, 263, 128346. http://doi.org/10.1016/j.chemosphere.2020.128346.
Genchi, G., Sinicropi, M. S., Lauria, G., Carocci, A., & Catalano, A. (2020). The Effects of Cadmium Toxicity. International journal of environmental research and public health, 17. http://doi.org/10.3390/ijerph17113782.
Barazzuol, L., Giamogante, F., & Calì, T. (2021). Mitochondria Associated Membranes (MAMs): Architecture and physiopathological role. Cell calcium, 94, 102343. http://doi.org/10.1016/j.ceca.2020.102343.
Gupta, M. K., Tahrir, F. G., Knezevic, T., White, M. K., Gordon, J., Cheung, J. Y., Khalili, K., & Feldman, A. M. (2016). GRP78 Interacting Partner Bag5 Responds to ER Stress and Protects Cardiomyocytes From ER Stress-Induced Apoptosis. Journal of cellular biochemistry, 117, 1813–1821. http://doi.org/10.1002/jcb.25481.
Wu, S., Lu, Q., Wang, Q., Ding, Y., Ma, Z., Mao, X., Huang, K., Xie, Z., & Zou, M. H. (2017). Binding of FUN14 Domain Containing 1 With Inositol 1,4,5-Trisphosphate Receptor in Mitochondria-Associated Endoplasmic Reticulum Membranes Maintains Mitochondrial Dynamics and Function in Hearts in Vivo. Circulation, 136, 2248–2266. http://doi.org/10.1161/circulationaha.117.030235.
Hu, Y., Chen, H., Zhang, L., Lin, X., Li, X., Zhuang, H., Fan, H., Meng, T., He, Z., Huang, H., Gong, Q., Zhu, D., Xu, Y., He, P., Li, L., & Feng, D. (2021). The AMPK-MFN2 axis regulates MAM dynamics and autophagy induced by energy stresses. Autophagy, 17, 1142–1156. http://doi.org/10.1080/15548627.2020.1749490.
Zhu, H., Tan, Y., Du, W., Li, Y., Toan, S., Mui, D., Tian, F., & Zhou, H. (2021). Phosphoglycerate mutase 5 exacerbates cardiac ischemia-reperfusion injury through disrupting mitochondrial quality control. Redox biology, 38, 101777. http://doi.org/10.1016/j.redox.2020.101777.

No competing interests reported.

Download PDF

Journal Publication

published 16 Oct, 2023

Read the published version in Cardiovascular Toxicology →

Editorial decision: Major revision
10 Aug, 2023
Reviews received at journal
01 Aug, 2023
Reviewers agreed at journal
30 Jul, 2023
Reviewers invited by journal
30 Jul, 2023
Editor assigned by journal
30 Jul, 2023
Submission checks completed at journal
29 Jul, 2023
First submitted to journal
28 Jul, 2023

You are reading this latest preprint version

Zinc overload induces mitochondrial dysfunction and ROS-mediated mitophagy

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and Methods

Chemicals and Reagents

Cell culture

Cell viability assay

LDH assay

Western Blot Analysis

Immunofluorescence and fluorescence microscopy

Confocal imaging of cell and mitochondrial ROS

Real-Time Quantitative PCR

siRNA transfection

Confocal imaging of the mitochondrial membrane potential

Quantification and Statistical Analysis

Results

Zinc overload reduces cell viability while induces LDH Release in cardiomyocyte H9c2 cells

Zinc overload induces mitophagy via the PINK1/parkin pathway

3MA inhibits mitophagy induced by zinc overload

ROS is involved in mitophagy induced by zinc overload

Zinc overload increases cellular and mitochondria ROS level

Zinc overload induces MAMs through ROS

Zinc overload promotes mitophagy by inducing ROS through Mfn2

Zinc overload affects MAMs by inducing ROS through Mfn2

Zinc overload induces the opening of mPTP via Mfn2 induction of ROS

Discussion

Conclusion

Declarations

Conflicts of interest

Author contribution

Acknowledgements

References

Additional Declarations

Status:

Journal Publication

Version 1