A rapid point-of-care population-scale dipstick assay to identify and differentiate SARS-CoV-2 variants in COVID-19-positive patients

doi:10.21203/rs.3.rs-3217832/v1

Download PDF

Research Article

A rapid point-of-care population-scale dipstick assay to identify and differentiate SARS-CoV-2 variants in COVID-19-positive patients

https://doi.org/10.21203/rs.3.rs-3217832/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Delta and Omicron variants of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) are remarkably contagious, and have been recognized as variants of concern (VOC). The acquisition of spontaneous substitutions or insertion–deletion mutations (indels) in the spike protein-encoding gene substantially increases the binding affinity of the receptor binding domain (RBD)-hACE2 complex and upsurges the transmission of both variants. In this study, we analyzed thousands of genome sequences representing 30 different SARS-CoV-2 variants and identified the Delta and Omicron variants specific nucleic acid signatures in the spike gene. Based on the variant-specific nucleic acid sequences, we synthesized different oligos and optimized a multiplex PCR (mPCR) assay that can identify and differentiate the Delta and Omicron variants of SARS-CoV-2. We further extended our work on this mPCR and translated it into a dipstick assay by adding a tag linker sequence to the 5’ end of the forward primer and biotin to the 3’ end of the oligos. Streptavidin-coated latex beads and the dipstick imprinted with a probe for the tag linker sequence in the test strips were used for the detection assay. Our dipstick-based assay, developed as a rapid point-of-care test for identifying and differentiating SARS-CoV-2 variants has the potential to be used in low-resource settings and scaled up to the population level.

SARS-CoV-2

COVID-19

Next-Generation Sequencing

Multiplex-PCR

Dipstick assay

Rapid detection

Following the first SARS-CoV-2 cases in China in late 2019, there was a major outbreak that was recorded, and the World Health Organization later declared this newly emerging human infectious illness to be a pandemic. As of June 2023, more than 750 million cumulative cases have been registered in more than 220 nations and territories, resulting in over 6.9 million deaths [1]. SARS-CoV-2, the coronavirus disease 2019 (COVID-19) causal agent, triggered an outbreak infecting millions of people globally. An enveloped virus with a single-stranded positive-sense RNA genome of about 30 kb is responsible for the illness, which is characterized by acute respiratory distress, fever, sore throat, muscle pain that can worsen into potentially fatal respiratory insufficiency while also having an impact on the neurological, heart, renal, and liver systems [2]. In contrast to earlier coronaviruses like the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) and the Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV), the patient with the SARS-CoV-2 infection may experience a variety of clinical manifestations, from asymptomatic or mild infection to severe or critical illness like acute lung inflammation and pneumoniae [3]. The upper and lower respiratory tracts are primarily targeted by this pathogenic SARS-CoV-2, which also has a very high rate of human-to-human transmission, particularly in elderly and immunocompromised patients [4, 5]. Due to the symptoms' resemblance to those of seasonal upper respiratory tract infections, accurate diagnostic techniques are required to identify viral nucleic acids, viral antigens, or serological assays that confirm SARS-CoV-2 infection.

The SARS-CoV-2 has tremendous competency to evolve rapidly by changing its genome sequences through accumulating substitutions or insertion–deletion mutations (indels) [6]. There have been several waves in the continuing epidemic brought on by novel SARS-CoV-2 variants. The genetic alterations brought on by various sorts of mutations, particularly in the spike protein, have resulted in the emergence of various lineages of the virus. The novel SARS-CoV-2 lineages have several fitness benefits, including increased virulence, infectivity, transmission, pathogenicity, immune evasion, and other fitness advantages, which could put a significant burden on public health systems. As a result, there is an unmet need for SARS-CoV-2 variants surveillance. The severity of COVID-19, the effectiveness of virus transmission, and the symptoms of sickness are all highly varied and strongly related to the different variants of SARS-CoV-2 [7]. Additionally, there are significant variations in the SARS-CoV-2 incubation time and sustainability in the host. In order to impede the virus's spread and stop the pandemic, community-level testing is crucial for identifying those who are infected and carrying the variant of concern (VOC) at an early stage. Viral transmission should always be stopped through contact tracing, clinical evaluation, and virus detection. To reduce the spread of SARS-CoV-2, a number of strategies including face masks, hand cleanliness, contact isolation, and social seclusion have already been implemented [8].

One of the primary causes of the virus's quick spread is the lack of accessible, affordable diagnostic tools at the community level; as a result, the present pandemic crisis urgently requires widespread, quick, economical, and simple detection. Currently, the most typical test samples utilized in the real-time reverse transcription polymerase chain reaction (RT-PCR) assay to identify the infected persons are the total RNA collected from the nasopharyngeal and/or oropharyngeal swabs samples of the suspected individuals [9]. However, the RT-PCR-based detection assay has several limitations including the availability of expensive thermal cyclers and the incapability to predict the virus variants. For a rapid and wide-scale test at the community level in developing countries, the test should be rapid, accurate, scalable, economical, and easy to interpret the outcomes and requires minimal resources. Monitoring of SARS-CoV-2 lineages is often based on the sequencing of the entire viral genome or a subset of relevant regions. This method calls for costly resources, technological know-how, and more time to process the data, which could result in a delayed result. Few laboratories have specialized equipment and knowledge, which restricts the genomic surveillance of variants in a densely populated nation like India. In this situation, identifying different and frequent minor indel mutations in the spike protein-encoding gene could be a valuable target for screening techniques. Based on these mutations, we have developed a quick point-of-care test in our study that can identify the SARS-CoV-2 virus in a patient as well as its variant. The developed test can be utilized in low-resource settings as a substitute for RT-PCR. The results can be interpreted without the need for any sophisticated instrument in just 3–5 minutes after the amplification reaction.

2.1 Sample collection and total RNA extraction

The total RNA was isolated from the oronasopharyngeal swab samples of SARS-CoV-2 positive patients using the QIAamp Viral RNA Mini Kit (Qiagen Cat. No.: 52906) to purify viral RNA for subsequent cDNA preparation and qRT-PCR. The sample was first lysed under highly denaturing conditions to inactivate RNases to ensure the isolation of intact viral RNA. Briefly, 140µl of sample volume was lysed using 560 µl lysis buffer. Viral RNA was adsorbed onto the QIAamp silica membrane during 2 brief centrifugation steps. The RNA binds to the membrane, and contaminants were efficiently washed away in two steps using 2 different wash buffers AW1 and AW2. High-quality RNA was eluted in nuclease-free water, ready for direct use or safe storage at -80°C. All the steps were performed strictly according to the manufacturer’s protocol.

2.2 Detection of SARS-CoV-2 by RT-PCR assay from respiratory specimen

The COVIDsure Multiplex real-time RT-PCR Kit (Labsystems diagnostics, Cat No.:30201282) is a qualitative RT-PCR assay based on Taqman chemistry intended to be used for in vitro detection of SARS-CoV-2 (COVID-19) virus RNA in total RNA isolated from respiratory specimens (like nasopharyngeal swab, oropharyngeal swab) of suspected cases of COVID-19 disease. The labelled primer-probe mix is specific to the SARS-CoV-2 genome (FAM labelled primer-probe set specific to Orf1ab and HEX labelled primer-probe set specific to E gene region). A signal in the FAM and/or HEX channel suggests presence of the SARS-CoV-2 virus in the sample. ROX labelled primer-probe set specific to RPP30 human gene was used as an internal control for RNA isolation, possible RT-PCR inhibition and to confirm the integrity of reagents of the kit. The assay was performed as per the manufacturer's guidelines.

2.3 SARS-CoV-2 cultivation and Viral RNA extraction

The virus culture experiments were carried out at the BSL-3 facility as approved by the Biosafety Committee of our research institute Translational Health Science & Technology Institute (THSTI). Vero C1008 (Vero E6) cells (ATCC CRL-1586) were cultured in DMEM (Dulbecco's Modified Eagle Medium) supplemented with 10% fetal bovine serum (FBS), MEM non-essential amino acids, 2mM L-glutamine, 100 U ml^− 1 penicillin, 0.1 mg ml^− 1 streptomycin, 12.5 U ml^− 1 nystatin (Biological Industries)[12]. The Vero E6 monolayers were washed once with DMEM without FBS and infected with SARS-CoV-2 virus, at a multiplicity of infection (MOI) of 0.2. After 1 h of infection, cells were cultured in DMEM medium supplemented with 2% FBS, MEM non-essential amino acids, L-glutamine and penicillin–streptomycin–nystatin at 37°C with 5% CO₂. After 4 passages, titration was done on Vero E6 cells followed by isolation of viral RNA from the infected cells and sequenced (details below).

2.4 Sequencing of SARS-CoV-2 genome

The pure virus isolates were harvested and RNA isolation was done using the QIAamp Viral RNA Mini Kit (Qiagen Cat. No.: 52906). The viral genome from pure viral cDNA and clinical viral cDNA (Ct value < 28) were sequenced accordingly as mentioned:

2.4.1 Library construction

The isolated RNA was quantified using RNA HS Kit (Qubit, Cat No.: Q32855). 10–100 ng of purified total RNA was used as a starting material for the library construction. Briefly, the RNA was first denatured at 65°C for 5 minutes followed by priming of the random hexamers, which was followed by synthesis of the first strand of cDNA using RVT (reverse transcriptase). The RNA template was then removed followed by further synthesis of a replacement strand to generate blunt-ended, double stranded cDNA fragments at 16°C for 1 hour. The synthesized double-stranded cDNA was cleaned up and tagmented using bead-linked transposomes at a temperature of 55°C for 5 minutes. The tagmentation process fragments the cDNA and adds index adapters to it. Illumina DNA/RNA UD indexes were used to index libraries. The tagmented DNA was further amplified by a specific PCR cycle, followed by clean-up using Agencourt Ampure XP beads (Make: Beckman Coulter, Cat No: A63881) and 80% ethanol. All the above methods were performed using Illumina® RNA Prep with Enrichment, (L) Tagmentation (Cat.no-20040537), IDT® for Illumina® DNA/RNA UD Indexes Set A, Tagmentation (Cat.no. − 20027213).

2.4.2 Next-generation sequencing

The prepared libraries were then quantified using Qubit dsDNA BR assay kit and each library was normalized to 80 ng/µl. 3 plex enrichment was followed, which required 2.5µl of each of the 3 samples to be combined in one pool based on their Ct values (Ct values which were close to each other were chosen to make one single pool). Results were optimized for 200 ng of each library in a total volume of 7.5 µl. Next, the probes were added to the pooled libraries to target regions of interest using the Respiratory Virus Oligo Panel (RVOP) enrichment. This enables the probes to get hybridized by incubating the reaction mixture overnight at 58°C (Respiratory Virus Oligos Panel V2 Cat.no – 20044311, Make: Illumina). Streptavidin magnetic beads were used to capture the hybridized probes ligated to the library fragments of interest. To remove any nonspecific binding, the beads were washed in a heated environment. Finally, the enriched library was then eluted from the beads. The amplification of the enriched library was done via a 14-cycle PCR program and finally the cleanup was performed using Agencourt Ampure XP magnetic beads. Each of the prepared libraries was checked firstly by Qubit quantification using Qubit dsDNA HS Kit. For the average library size, 1µl enriched library was analyzed using the High sensitivity DNA Reagents (Make: Agilent, Cat No.: 5067 − 4626) and run in Agilent 2100 Bioanalyzer. The molarity value of the pooled libraries was calculated to prepare 4nM libraries. All the 3-plexed libraries were pooled together, denatured and diluted as per the manufacturer’s protocol. The final 10pM denatured pooled library was loaded in the sample well of the Miseq reagent Kit V3 (150 cycles PE) (Make: Illumina, Cat No.: MS-102-3001).

2.4.3 Assembly and annotation of the SARS-CoV-2 Genome

All SARS-CoV-2 genome was assembled based on reference-based assembling in which the Wuhan genome (GenBank ID: NC_045512) was used as a reference sequence. Three steps were followed during assembling the SARS-CoV-2 genome. (i) cleaning and merging the reads: All reads are quality checked by (Q_phred ≥ 30); checking and removal of the adapter and merging paired end reads to get longer raw reads by PEAR program (https://cme.h-its.org/exelixis/web/software/pear/). (ii) the reference-based assembling was performed by using the following tools viz. Hisat2(http://daehwankimlab.github.io/hisat2/), Samtools (http://www.htslib.org/), bamToFastq (https://bedtools.readthedocs.io/en/latest/content/tools/bamtofastq.html),bcftools(https://samtools.github.io/bcftools/bcftools.html) and seqtk (https://github.com/lh3/seqtk). (iii) Annotation of the assembled SARS-CoV-2 genome by Prokka program (https://github.com/tseemann/prokka) based on the Wuhan genome (GenBank ID: NC_045512). All procedures and commands were available on the github link (https://github.com/shakti83kumar/VGAP).

2.5 Optimization of mPCR coupled dipstick assay conditions

The designed sets of primers specific for the SARS-CoV-2 and its variants were utilized to set up multiplex PCR in two distinct PCR sets (Set A & Set B). The two sets of PCR would differentiate between the Delta and Omicron (BA.1 & BA.2) variants. RdRp primers (RdRp-F& -R), BA.1 specific primer (BD3F &-R), and Delta specific primers (BD4-F & -R) were included in Set A of the mPCR mixture, along with other PCR reagents. Set B of the mPCR mixture included RdRp primers (RdRp- F& -R), Delta specific primers (BD4-F & -R), and BA.2 specific primers (BD6-F & -R) along with the PCR reagents. The PCR conditions were optimized as follows: initial denaturation of 95℃ for 2 min followed by 28 cycles of denaturation at 95℃ for 30 sec, annealing at 55℃ for 25 sec and extension at 72 ℃ for 45 sec. After performing the final extension at 72°C for 2 minutes, the amplicon was collected and put through a dipstick assay.

2.6 Optimization of dipstick assay conditions

C-PAS (4)test strips (TBA Co., Ltd) for nucleic acid chromatography help in easy visualization of the amplified nucleic acid. Tagged and biotinylated primers were used for the amplification of the target genes. Amplicons were then mixed with the streptavidin-coated blue-coloured latex beads and the developing solution. The immersion of the dipstick in the resulting solution generates a coloured line (blue), which is specific to each tag and enables the detection of target genes easily. The volume of the developing solution and the latex beads were optimized to prevent any false positive results

2.7 Screening of SARS-CoV-2 using the PCR-coupled dipstick method

A total of 75 samples were screened for SARS-CoV-2 using the PCR-coupled dipstick method. Four different sets of primers targeting the RdRp (positive control) and distinct regions of the spike protein encoding gene of Delta and Omicron (BA.1 and BA.2) variants were used for the screening. The screening involved PCR set-up followed by dipstick assay.

3.1 Analysis of SARS-CoV-2 variants genome and identification of Delta and Omicron specific genomic signature

The genome sequences from different SARS-CoV-2 variants were obtained from GISAID (Global Initiative on Sharing Avian Influenza Data) [13] and from our in-house Whole Genome Sequencing (WGS) facility. The sequences were analyzed using the Geneious software and the specific genomic signatures were identified for the prevalent Delta and Omicron variants. Detailed sequence analysis was performed and the characteristic Delta mutations and deletions were identified. The characteristic Omicron BA.1 ‘EPE’ insertion site was identified in the translated Spike protein. Furthermore, S-protein mutations of Omicron sublineage BA.2 were analyzed. The specific genomic signatures from the Delta, Omicron BA.1 and BA.2 spike protein-encoding genes were analyzed as shown in Fig. 1.

3.2 Oligos designing and In-silico genome amplification

Alignment of the spike protein-encoding gene sequences of the different SARS-CoV-2 variants was done and the specific genomic signatures of Delta, Omicron BA.1 and BA.2 variants were identified to design the specific oligos. The primers specific to the RdRp region were kept as a positive control. The designed oligos were checked for their specificity by in-silico genome amplification and were found to amplify the specific target region. The nucleotide sequence and the specificity of the designed oligos is shown in Table 1.

Table 1

Oligos designed for the SARS-CoV-2 variants
Primer ID	Sequence	Amplicon size (bp)	Specificity	Reference
RdRp-F RdRp-r	GTGARATGGTCATGTGTGGCGG CARATGTTAAASACACTATTAGCATA	100	All SARS-CoV-2 variants	[14]
BD3-F BD3-R	GTTGGATGGAAAGTGAGTTCA GATCTTCTGGCTCACGCACTA	201	Omicron BA.1	This study
BD4-F BD4-R	GGTTCCATGCTATACATGT TGTTTTTGTGGTAATAAACAT	255	Delta & BA.2	This study
BD6-F BD6-R	AAAGTTGGATGGAAAGTGAG AACCCTGAGGGAGATCACG	210	Omicron BA.2	This study

3.3 Screening of SARS-CoV-2 positive samples and sequencing confirmation of the primer specificity

The designed sets of 4 primers were initially optimized for the amplification conditions in uniplex PCR using the respective control templates (pure virus cDNA and whole genome sequenced clinical samples). The specificity of the primers was determined by using the different viral cDNAs as the template. The primers successfully amplified the desired amplicon in optimized uniplex and multiplex PCR (m-PCR) assays (Supplementary Fig. 1). Optimal concentrations of each oligonucleotide primer set were optimized along with the cycle number for m-PCR assays. The optimized conditions are mentioned in the Materials and Methods section.

To establish the complete specificity of the oligos created for this investigation a total of 250 SARS-CoV-2 samples that were whole genome sequenced were screened using the designed oligos. The amplicon obtained was sequenced by Sanger sequencing and the sequence was examined. The sequencing results matched with the WGS results and hence confirmed the 100% specificity of the oligos designed in this study. The different samples screened and verified by these two methods have been mentioned in Table 2. The primer BD6, specific for Omicron BA.2 was also checked for the binding of Omicron XBB variant and was found to amplify all the tested clinical samples which were confirmed as XBB 1.16 variant by Miseq Illumina sequencing.

Table 2

Samples submitted to WGS and further Sanger sequencing verification of the designed primer's specificity
Primer ID	Specificity	MiSeq (n = 250)	Sanger sequencing (n = 250)
RdRp- F & R	All SARS CoV-2 viruses	250	-
BD3- F & R	BA.1	23	23
BD4- F & R	Delta & BA.2	21 & 53	21 & 53
BD6- F & R	BA.2	206	206

3.4 Development of the probe and the dipstick assay

The primers designed for the specific SARS-CoV-2 variants: RdRp-F, BD3-F, BD4-F and BD6-F were labeled with the tag linker sequence (Tohoku Bio-array, Japan), complementary to the probe imprinted on the dipstick. The reverse primers: RdRp-R, BD3-R, BD4-R and BD6-R were labelled with biotin (Tohoku Bio-array) that binds to the streptavidin-coated blue latex beads (Tohoku Bio-array). Therefore, amplicons of the target gene will appear blue during the dipstick readout. For our PCR-coupled dipstick assay, PCR was performed with the labeled primers and 10 µl (5-fold diluted) of the amplicon was mixed with 10 µl of developing buffer containing 0 mM NaCl (Tohoku Bio-Array) and 1.2 µl of streptavidin-coated blue latex beads. Then, the dipstick was dipped into the reaction mixture for ~ 3–5 min. Since the dipstick is imprinted with the probe for the tag-linker sequence, the positive result was evident by the appearance of a blue line on the dipstick, which is easily visualized with the naked eye. The location of the blue line is distinct for the Delta, BA.1 and BA.2 variants. An overview of the whole procedure is shown in Fig. 2.

3.5 Performance evaluation of RT-PCR coupled dipstick assay

The dipstick assay was used to examine 75 clinical specimens of SARS-CoV-2, which were whole genome sequenced and further verified by Sanger sequencing. The tagged oligos were utilized to screen the SARS-CoV-2 samples and their respective amplicons were used for the dipstick assay. The SARS-CoV-2 variants and positive samples were successfully identified by RT-PCR-coupled dipstick, hence, the dipstick readout was found to be totally specific. The presence of an RdRp-specific signal confirms the presence of SARS-CoV-2 and the other lines at distinct locations helps to infer the variant of SARS-CoV-2. The dipstick assay results of uniplex and multiplex PCR of SARS-CoV-2 samples have been shown in Figs. 3A & B.

More than two years have passed since the first detection of SARS-CoV-2 and the World Health Organization's declaration of the pandemic, but COVID-19 has not yet been contained, and instead, the emergence and spread of new variants brought on by particular mutations is growing day by day, further worsening the situation. We have designed our assay based on the specific mutation of each variant like the presence of either DEF156-157 or ins214EPE respectively to detect and differentiate the Delta and Omicron BA.1 respectively. The presence of this specific 214EPE insert has been successfully able to detect Omicron (B.1.1.529) in clinical samples [15]. However, the upsurge in the number of cases and the emergence of BA.2 sub-lineage in many countries including India, significantly impelled to monitor its local transmission and this BA.2 differs from BA.1 by the absence of a specific signature for BA.1 ins214EPE and also additionally the presence of DLPP24-26.

Therefore, it is crucial for the quick and early detection of SARS-CoV-2 mutations to limit and slow its spread. In the current work, a quick point-of-care test for the early detection of the SARS-CoV-2 virus was developed. In contrast to the traditional real-time-based approach, which is complex and time-consuming (taking about 2–3 hours), this standardized dipstick-based test is quick and straightforward. The developed test not only validates infection in a patient, but also identifies the variant of SARS-CoV-2 simultaneously. In contrast the usual approach, can only determine whether SARS-CoV-2 is present or absent in the sample. Recently, the latest twist of SARS-CoV-2 gained a new recombinant Omicron XBB variant which is believed to have emerged from the combination of two lineages of BA.2 viz. BJ.1 and BM.1.1.1 [16]. This variant is known to exhibit high fitness and is likely to spread globally. Hence, the detection of this new lineage with our designed primer for Omicron BA.2 variant could successfully able to assess the risk of SARS-CoV-2 infection.

Recently, several rapid tests have been developed that guarantee the quick and resource-constrained identification of SARS-CoV-2 [17]. All of these tests, however, have some drawbacks, including the antigen-based tests' lack of specificity, some of the tests' inability to function in the presence of low viral loads, their lack of specificity, and some of the tests' technical difficulties. The tests that use nucleic acids are the most popular because they are extremely specific and can be used even when there is a low viral load [18]. These tests need greater time, expensive lab supplies, and apparatus. Efforts have been made to simplify the nucleic acid-based tests by decreasing the time for RNA isolation, and cDNA conversion or eliminating these steps [19] [20], use of thermal incubators for isothermal amplification [21], use of CRISPR-Cas technology [22], potentiometric biosensors [23] and final readout using a colorimetric based assay with mobile application [24] or the dipstick based results [21]. The rapid point-of-care test mentioned in this study outperforms the others since it aids in variant identification (Delta, Omicron-BA.1 & BA.2) while also being accurate, robust, inexpensive, and quick. The test uses nucleic acid chromatography-based detection combined with tagged and labelled primers (Tohoku Bio-array, Japan). The results are clearly observable and interpretable to the naked eye. This method is apt for monitoring VOCs in environments with limited resources and is adaptable to include new emerging variants.

The ongoing COVID-19 pandemic requires surveillance and testing for the effective management of the disease. The tests employed should be cost-effective, rapid, specific and sensitive, as well as amenable to be used in low resource settings. This study describes a rapid point-of-care testing for SARS-CoV-2 infection, which can simultaneously identify different variants of SARS-CoV-2 in the patient. The designed test is a nucleic-acid based dipstick assay, which is 100% specific and could be used as an alternative to qRT-PCR in low resource settings. The minimum requirement of the test includes the normal thermal cycler and its reagents along with the dipsticks. The results can be obtained in less time as compared to qRT-PCR without the need of any sophisticated instruments in just 3–5 minutes after the amplification reaction.

MERS-CoV-Middle East Respiratory Syndrome Coronavirus

SARS-CoV-Severe Acute Respiratory Syndrome Coronavirus

VOC-Variants of concern

Indels- Insertion and deletions

RBD-Receptor Binding Domain

mPCR- Multiplex PCR

RT-PCR- Reverse Transcription Polymerase Chain Reaction

MOI- Multiplicity of Infection

RVOP-Respiratory Virus Oligo Panel

RVT- Reverse Transcriptase

DMEM-Dulbecco's Modified Eagle Medium

FBS- Fetal bovine serum

GISAID- Global Initiative on Sharing Avian Influenza Data

Study Approval

Institutional Biosafety Committee of THSTI approved the study (THS/394/2022).

Availability of data and materials

The whole genome SARS-CoV-2 sequences have been submitted in Indian Biological Data Centre (IBDC) and Global Initiative on Sharing Avian Influenza Data (GISAID).

Competing interests

The authors declare that they have no competing interests.

Funding

This work was funded by the Department of Biotechnology (DBT), Government of India (RAD-22017/19/2022-KGD-DBT and No.102/IFD/SAN/5603/2018-2019).

Authors' contributions

BD and PKG were involved in the conceptualization of the study. DP, JV, SK, DT, PJ, LN, SPK, RK, MP, SM, MG, SC, PK, BD, performed experiments. PK, NW, SB, PKG, contributed in cohort establishment and resource generation. DP, JV, SK, DT, BD generated genome sequence data, curated the data, performed genome analysis, and deposited DNA sequences in the database. DP, JV, SK, DT, and BD have access to all the WGS raw data. DP, JV, and BD wrote the manuscript. All authors had access to the main tables and supplementary tables. PKG and BD arranged funds for this study.

Acknowledgements

We thank all the technical staff of the Bioassay Laboratory, and Advanced Nucleotide Sequencing Facility at THSTI for their technical support. All the frontline workers and patients who have contributed to the sample collection are acknowledged for their service. Dr. Deepjyoti Paul, & Dr. Lekshmi Narendrakumar MK Bhan Fellows, THSTI acknowledges the support of the Department of Biotechnology, Govt. of India and the MK Bhan fellowship program. Dr. Jyoti Verma and Dr. Daizee Talukdar acknowledge the Translational Research Program (No.102/IFD/SAN/5603/2018-2019) for research support. The work was presented at the International Congress on Infectious Diseases, Kuala Lumpur, Malaysia 2022 (Oral 7.6 ‘A rapid point-of-care dipstick assay for differentiation of SARS-CoV-2 variants in COVID-19 patients’). Abstract of the work has been published in International Journal of Infectious Diseases, volume 130, Supplement 2, May 2023, Page S24.

WHO Coronavirus (COVID-19) Dashboard [Internet]. [cited 2023 June 7]. Available from: https://covid19.who.int
Wang D, Hu B, Hu C, Zhu F, Liu X, Zhang J, et al. Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus-Infected Pneumonia in Wuhan, China. JAMA. 2020;323:1061–9.
V’kovski P, Kratzel A, Steiner S, Stalder H, Thiel V. Coronavirus biology and replication: implications for SARS-CoV-2 [Internet]. Nature Reviews Microbiology. 2021. p. 155–70. Available from: http://dx.doi.org/10.1038/s41579-020-00468-6
Wölfel R, Corman VM, Guggemos W, Seilmaier M, Zange S, Müller MA, et al. Virological assessment of hospitalized patients with COVID-2019 [Internet]. Nature. 2020. p. 465–9. Available from: http://dx.doi.org/10.1038/s41586-020-2196-x
Guan W-J, Ni Z-Y, Hu Y, Liang W-H, Ou C-Q, He J-X, et al. Clinical Characteristics of Coronavirus Disease 2019 in China [Internet]. New England Journal of Medicine. 2020. p. 1708–20. Available from: http://dx.doi.org/10.1056/nejmoa2002032
Harvey WT, Carabelli AM, Jackson B, Gupta RK, Thomson EC, Harrison EM, et al. SARS-CoV-2 variants, spike mutations and immune escape [Internet]. Nature Reviews Microbiology. 2021. p. 409–24. Available from: http://dx.doi.org/10.1038/s41579-021-00573-0
Tao K, Tzou PL, Nouhin J, Gupta RK, de Oliveira T, Kosakovsky Pond SL, et al. The biological and clinical significance of emerging SARS-CoV-2 variants [Internet]. Nature Reviews Genetics. 2021. p. 757–73. Available from: http://dx.doi.org/10.1038/s41576-021-00408-x
Kevadiya BD, Machhi J, Herskovitz J, Oleynikov MD, Blomberg WR, Bajwa N, et al. Diagnostics for SARS-CoV-2 infections [Internet]. Nature Materials. 2021. p. 593–605. Available from: http://dx.doi.org/10.1038/s41563-020-00906-z
Guglielmi G. Rapid coronavirus tests: a guide for the perplexed [Internet]. Nature. 2021. p. 202–5. Available from: http://dx.doi.org/10.1038/d41586-021-00332-4
Meredith LW, Hamilton WL, Warne B, Houldcroft CJ, Hosmillo M, Jahun AS, et al. Rapid implementation of SARS-CoV-2 sequencing to investigate cases of health-care associated COVID-19: a prospective genomic surveillance study. Lancet Infect Dis. 2020;20:1263–72.
Ko K, Takahashi K, Nagashima S, E B, Ouoba S, Hussain MRA, et al. Mass Screening of SARS-CoV-2 Variants using Sanger Sequencing Strategy in Hiroshima, Japan. Sci Rep. 2022;12:2419.
Finkel Y, Mizrahi O, Nachshon A, Weingarten-Gabbay S, Morgenstern D, Yahalom-Ronen Y, et al. The coding capacity of SARS-CoV-2 [Internet]. Nature. 2021. p. 125–30. Available from: http://dx.doi.org/10.1038/s41586-020-2739-1
Gisaid, GISAID. GISAID [Internet]. Available from: http://dx.doi.org/10.55876/gis8.220609re
Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DK, et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill [Internet]. 2020;25. Available from: http://dx.doi.org/10.2807/1560-7917.ES.2020.25.3.2000045
Phan T, Boes S, McCullough M, Gribschaw J, Marsh J, Harrison LH, et al. Development of a One-Step Qualitative RT-PCR Assay to Detect the SARS-CoV-2 Omicron (B.1.1.529) Variant in Respiratory Specimens. J Clin Microbiol. 2022;60:e0002422.
Tamura T, Ito J, Uriu K, Zahradnik J, Kida I, Anraku Y, et al. Virological characteristics of the SARS-CoV-2 XBB variant derived from recombination of two Omicron subvariants. Nat Commun. 2023;14:2800.
Song W, Zhang T, Lin H, Yang Y, Zhao G, Huang X. Conventional and Microfluidic Methods for the Detection of Nucleic Acid of SARS-CoV-2. Micromachines (Basel) [Internet]. 2022;13. Available from: http://dx.doi.org/10.3390/mi13040636
Udugama B, Kadhiresan P, Kozlowski HN, Malekjahani A, Osborne M, Li VYC, et al. Diagnosing COVID-19: The Disease and Tools for Detection. ACS Nano. 2020;14:3822–35.
Jørgensen RL, Pedersen MS, Chauhan AS, Andreasson LM, Kristiansen GQ, Lisby JG, et al. An in-well direct lysis method for rapid detection of SARS-CoV-2 by real time RT-PCR in eSwab specimens. J Virol Methods. 2021;289:114062.
Lai MY, Suppiah J, Thayan R, Ismail I, Mustapa NI, Soh TST, et al. RNA purification-free detection of SARS-CoV-2 using reverse transcription loop-mediated isothermal amplification (RT-LAMP). Trop Med Health. 2022;50:2.
Shanmugakani RK, Wu M. An isothermal amplification-coupled dipstick for the rapid detection of COVID-19 [Internet]. Journal of Medical Microbiology. 2022. Available from: http://dx.doi.org/10.1099/jmm.0.001519
Liu X, Li Y, Wang X, Song Y, Wu L, Yu B, et al. Rapid and Specific Detection of Active SARS-CoV-2 With CRISPR/Cas12a. Front Microbiol. 2021;12:820698.
Lee W-I, Subramanian A, Mueller S, Levon K, Nam C-Y, Rafailovich MH. Potentiometric Biosensors Based on Molecular-Imprinted Self-Assembled Monolayer Films for Rapid Detection of Influenza A Virus and SARS-CoV-2 Spike Protein. ACS Appl Nano Mater. 2022;5:5045–55.
Londono-Avendano MA, Libreros G, Osorio L, Parra B. A Rapid RT-LAMP Assay for SARS-CoV-2 with Colorimetric Detection Assisted by a Mobile Application. Diagnostics (Basel) [Internet]. 2022;12. Available from: http://dx.doi.org/10.3390/diagnostics12040848

No competing interests reported.

Supp.Figure1.png
Supplementary Figure 1: (A) An agarose gel image of a uniplex PCR utilising primers that were specifically designed to target the RdRp gene and the spike protein-encoding gene of the Delta and Omicron (BA.1) variants. (B) Image of a multiplex PCR on an agarose gel using primers that were specifically designed to target the RdRp gene and the gene that codes for the spike protein in the Delta and Omicron (BA.1) variants.

Download PDF

Version 1

posted

You are reading this latest preprint version

A rapid point-of-care population-scale dipstick assay to identify and differentiate SARS-CoV-2 variants in COVID-19-positive patients

Status:

Version 1

Abstract

Figures

1. INTRODUCTION

2. MATERIALS AND METHODS

2.1 Sample collection and total RNA extraction

2.2 Detection of SARS-CoV-2 by RT-PCR assay from respiratory specimen

2.3 SARS-CoV-2 cultivation and Viral RNA extraction

2.4 Sequencing of SARS-CoV-2 genome

2.4.1 Library construction

2.4.2 Next-generation sequencing

2.4.3 Assembly and annotation of the SARS-CoV-2 Genome

2.5 Optimization of mPCR coupled dipstick assay conditions

2.6 Optimization of dipstick assay conditions

2.7 Screening of SARS-CoV-2 using the PCR-coupled dipstick method

3. RESULTS

3.1 Analysis of SARS-CoV-2 variants genome and identification of Delta and Omicron specific genomic signature

3.2 Oligos designing and In-silico genome amplification

3.3 Screening of SARS-CoV-2 positive samples and sequencing confirmation of the primer specificity

3.4 Development of the probe and the dipstick assay

3.5 Performance evaluation of RT-PCR coupled dipstick assay

4. DISCUSSION

5. CONCLUSION

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1