c-Myc Knockout as a Model for Gene Editing for Training Healthcare Professional Students

doi:10.21203/rs.3.rs-3218108/v1

Download PDF

Research Article

c-Myc Knockout as a Model for Gene Editing for Training Healthcare Professional Students

https://doi.org/10.21203/rs.3.rs-3218108/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 19 Oct, 2023

Read the published version in American Journal of Molecular Biology →

Version 1

posted

You are reading this latest preprint version

Correction of genetic errors, commonly known as gene editing, holds promise to treat diseases with unmet medical needs. However, several gene therapy trials have encountered unwanted outcomes, because of the incomplete understanding of the disease states and gene therapy processes. This situation encourages a concept that healthcare professionals receiving laboratory research will not only identify inadequacies in basic biomedical knowledge in gene therapy but also provide tangible refinements. We thus have undertaken the PharmD student-training program in gene editing in a basic research laboratory setting. As a model, MYC gene was chosen for knockout using CRISPR-Cas9 method in HT29 and OVCAR8 cells. Students were involved in the design of MYC-specific gRNAs, subcloning into Cas9-carrying plasmid, and selection of knockout clones from the transfected cells. Students were involved in the genomic DNA isolation, analysis of DNA sequences from the clones using online bioinformatics tools, western blotting, cell proliferation and cell division cycle, to characterize the knockout clones. Observations made during this training are presented. In this process, students have gained a better understanding of the disease mechanisms, gene therapy protocols, limitations of gene therapies, abilities to evaluate the literature and transfer laboratory training to the practice of gene therapies in clinic.

CRISPR-Cas

MYC

gene disruption

Healthcare professional

laboratory training

genome editing

The Human Genome Project elicited enormous influence on the development of newer and more efficient cost-effective technologies for DNA sequencing, bioinformatics, molecular diagnostics, genetic manipulations, and disease treatments. Bioinformatics, for instance, has uncovered various abnormalities in the human genome, including single nucleotide polymorphisms, indels, gene copy number variation, and alternative splicing, which are being extrapolated to various human diseases and disorders (1, 2). These developments have revolutionized the practice of medicine. For example, the freely available online genotype-phenotype databases are accessible to clinicians to interpret the patient DNA sequence abnormalities for disease risk assessment and drug therapy management. Similarly, advanced genetic manipulation methods, such as CRISPR-Cas editing, are now being actively explored in correcting genetic defects, paving the way to address the hereto untreatable genetic diseases and disorders (reviewed in (3)). Thus, gene editing has elicited keen interest in clinicians, researchers, and patients, which is evident from the large number of clinical trials that are currently undertaken (4, 5). While gene therapies are welcoming developments, inadequate training of healthcare professionals may have contributed to the previously unanticipated health deterioration and death among the study participants (6). To predict and effectively address such unforeseen consequences, all stakeholders, including clinical professionals, pharmacists and nurse practitioners, require foundational knowledge in genome editing procedures, critical evaluation of literature, and comprehension of the associated ethical issues. In fact, the Food and Drug Administration requires that the healthcare personnel involved in prescribing, dispensing, and administrating gene therapies have training in all facets of this therapy.

Hands-on laboratory research training undoubtedly reinforces the knowledge gained in the classroom (7). Those who receive laboratory training in genome editing are better equipped with knowledge and insights into the complex issues associated with this method, enabling them to take part in the clinic effectively. Thus, we have recently introduced a didactic Elective course on genome editing as a part of our PharmD curriculum. A few students who completed this Elective have enrolled in the laboratory research rotation as a part of our Advanced Pharmacy Practice Education (APPE). As a part of training, MYC was selected as a target for gene disruption in two different cancer cell lines. Details of planning and execution of the experiments, unbiased interpretations of the data, and critical analysis of the published works are presented in this report. We expect that knowledge and problem-solving skills gained in this training will promote active participation of these students in future gene therapies with confidence. Finally, this training program may serve as a model for medical and other professional schools in preparing healthcare professionals competent in gene therapies.

Research Ethics Committee approval. This research study and the purchase of cell lines used in this study were reviewed by the Institutional Biosafety Committee and the Institutional Research Review Board of the Appalachian College of Pharmacy and approved with Exempt Status as this study does not involve small laboratory animals.

Cancer Cell Lines and Culturing Conditions. The human colorectal carcinoma cell line, HT-29 and the high grade human ovarian serous adenocarcinoma cell line, OVCAR8 were purchased from the National Cancer Institute cancer cell line repository. Authentication of cell lines was done by the supplier by the DNA-short tandem repeat profiling. Soon after receiving, the cell lines were cultured, aliquoted and frozen at -80 ^oC until use. All the experiments reported here were carried out within two years from the time the cells were pulled out from the − 80 ^oC freezer. Cells were cultured in the Supplier-recommended growth media containing 10% (v/v) fetal bovine serum (Cytiva, Marlborough, MA) in a 37 ^oC incubator containing 5% CO₂, as reported (8).

Selection of knockout gene. The MYC, a well-characterized oncogene in a large number of cancers, was chosen as a target for knockout using CRISPR-Cas9 method.

Synthesis of MYC-specific gRNA. Although numerous online bioinformatics platforms are available (https://zlab.bio/guide-design-resources), the Synthego-based bioinformatics tool (design.synthego.com) was used in designing small guide RNA (gRNA), setting the following parameters: Genome: Homo sapiens (Genome Reference Consortium Human Build 38.p10); Gene MYC (Ensembl link: ENST00000621592); Nuclease: SpCas9 (Streptococcus pyogenes CRISPR-assocated-9). These tools have identified four gRNA sequences in exon 2 of the MYC. Among these one gRNA (gRNA1) with the following sequence, ACGUUGAGGGGCAUCGUCGC was used in these studies. The corresponding DNA sequence ACGTTGAGGGGCATCGTCGC to which a CACCG, was added to its 5’-end, resulting in 5’-CACCGACGTTGAGGGGCATCGTCGC-3’. The reverse complementary oligo to this was designed with an additional AAAC sequence to the 5’-end, and a C at the 3’-end. These bases were added to enable subcloning into the pX459 plasmid (see below). Thus, the reverse complementary sequence is as follows: 5’-AAACGCGACGATGCCCCTCAACGTC-3’. The PAM sequence was omitted as required by the gRNA design guidelines (9), which is however present at the 5’- of this gRNA sequence in the reverse strand of exon 2 (3’-GGGCGCTGCTACGGGGAGTTGCA-5’, where PAM sequence is underscored). These oligos were synthesized at IDT DNA Technologies, Coralville, Iowa.

Subcloning of gRNA duplexes in pX459 plasmid. The forward and the corresponding reverse-complementary DNA oligoes were mixed, annealed and their 5’-ends were phosphorylated using polynucleotide kinase by following these steps: incubation at 37^o C for 30 min, followed by 95^o C for 5 min, and then cooling down slowly (5 ^oC/min) to 25^o C. This oligo duplex was cloned into the pSpCas9(BB)-2A-Puro plasmid (pX459) (Addgene, Addgene.org) that was previously digested with Bbs I (New England Biolabs, Ipswich, MA), dephosphorylated with calf intestine alkaline phosphatase and then ligated with T4 DNA ligase. This reaction mixture was then transformed into E.coli, by following the standard molecular biological procedures. Plasmid DNAs were isolated from ampicillin-resistant E.coli colonies and the incorporation of MYC gRNA sequences was confirmed by DNA sequencing.

Cell Transfection, Genomic DNA isolaton, and Sequencing. Cells growing in 6-well plates were transfected with pX459/MYC-gRNA plasmids (2.5µg each) using Lipofectamine 2000 reagent (Invitrogen, CA). As controls, cells were transfected with pX459 plasmid vector. The transfected cells were grown for 48 h in the complete growth medium, which was then replaced with puromycin (EMD Millipore, Billerica, MA) (0.3 µg/ml) supplemented growth medium and incubated for an additional 10 days. Single cell colonies observed in the plates were marked and then carefully collected using a sterile pipette tip and transferred to 12-well plates. Clones were propagated in regular growth media without puromycin and used in further analysis.

Genomic DNA was extracted from several clones obtained from transfection with the vector-, and pX459/MYC plasmids using PureLink Genomic DNA kit (Invitrogen), according to the manufacturer’s instructions. Using the genomic DNA as template, regions surrounding the gRNA target sites in MYC gene were amplified using specific primer sets (forward primer: 5’-CTTTAGGGGATAGCTCTGCAA-3’, reverse primer: 5’-TTCTTCCAGATATCCTCGCTG-3’) by polymerase chain reaction (PCR) (Fisher Scientific, Waltham, MA). The PCR amplification conditions were as follows: 95 ^oC for 2 min, followed by 30 cycles of 95 ^oC for 20 sec, 55 ^oC for 20 sec, and 72 ^oC for 20 sec, and 3’-extension at 72 ^oC for 3 min.

The PCR products were separated on agarose gels (1% w/v) containing ethidium bromide (10 mg/ml) and the expected size DNA fragments were excised and purified using PureLink Gel Extraction Kit (Invitrogen, CA). The PCR-amplified DNA fragments were sequenced using the forward primers used in the PCR, at the Genomic Sequencing Center, Biocomplexity Institute, Virginia Tech, Blacksburg, VA on pay-for-service basis.

Cell proliferation. The effect of gene knockout on cell proliferation was evaluated by the 3-(4,5-dimethylthazol-2-yl)-2,5diphenyltetrazolium bromide) MTT assay, as described by others (10). Briefly, cells were seeded in 96-well plates in octaplicates (10,000 cells per well) and allowed to attach to the plates in a phenol red-free RPMI culture medium overnight at 37 ^oC/5% CO₂ in a cell culture incubator. To establish the 0-time cell content, MTT assay was carried out 5 h after cells were attached to the plates. At regular time intervals, cell growth was quantified.

Cell cycle analysis: Cells (100,000 /well) were plated in 12-well plates and grown for 48 h. Cells were then collected after trypsinization, fixed in ice-cold 70% (v/v) ethanol and stored overnight at 4 ^oC. The cells were then washed in PBS and incubated in Guava Cell Cycle Reagent (Lumenix, Austin, TX) in dark for 30 min, and then analyzed by flow cytometry using Guava Flow Cytometer (11). Data were collected using Incyte data acquisition software (Millipore Guava Instruments) and the cell cycle phases were quantified by Modfit 5.0 software (Verity Software House, Topsham, ME).

Western blotting. Preparation of whole cell lysates and protein estimation were carried out using BioRad DC protein assay kit using bovine serum albumin as standard, as described previously (12). Proteins (10 µg) in cell lysates were separated on mini-acrylamide gels (BioRad Laboratories) and transferred onto PVDF membranes. The western blots were developed using specific antibodies mentioned in the Results Section (Cell Signaling Technology, Danvers, MA) and WesternSure PREMIUM reagents (Li-COR, Lincoln, NE). The blots were scanned using Li-COR c-DIGIT equipment.

Materials and reagents. All materials and reagents used in this study were obtained as reported (8, 11, 13).

Statistical analysis. Each cell proliferation experiment was carried out in octaplicates and repeated a minimum of three times. The data points presented in Fig. 1D and 2C represent mean ± s.e.m. Similarly, each of the cell cycle analysis was carried out in triplicates and repeated a minimum of three times. Data presented in Fig. 1E and 2D represent the mean of three measurements ± s.e.m.

Selection of gRNA for MYC disruption.

Using the online bioinformatics tools, four gRNA sequences that could disrupt the human MYC were identified. Among these gRNA1 with sequence, ACGUUGAGGGGCAUCGUCGC was chosen as it was predicted to bind to exon 2 with zero mismatches. This gRNA1 could potentially bind several genes with three or four mismatches. However, the cellular function of these genes is unknown. Since binding of a gRNA to DNA regions with multiple mismatches is an inefficient process, gRNA1 is a strong candidate for targeting MYC disruption. Thus, we have chosen gRNA1 in these studies.

Disruption of MYC in HT29 cells.

Bioinformatics tools, mentioned under Materials and Methods, have identified four overlapping guide RNA (gRNA) sequences at the 5’-end of the exon 2 in MYC (Fig. 1A). We selected gRNA1 (Fig. 1A) for this study. The gRNA1 was subcloned into pX459 plasmid, transfected into human colorectal cancer HT29 cells and several puromycin-resistant clones were isolated for further characterization, according to Ran et al. (9). The c-Myc expression and β-actin levels in these clones was determined by western blotting using 10 µg of total cellular protein lysates from these samples as mentioned in the Materials and Methods and the results were shown in Fig. 1B. The data shows that these clones contained variable amounts of c-Myc protein. Clone 4 contained similar amounts of c-Myc as in the vector control, suggesting that MYC in clone 4 was not disrupted. Importantly, the c-Myc protein was nearly absent in clones 5 and 7, suggesting that all MYC copies in these clones were likely disrupted. Finally, clones 1, 2, 3, 6 and 8 contained lower amounts of c-Myc when compared to control, suggesting that at least one copy of the MYC was intact.

To confirm knockout, genomic MYC DNA encompassing the gRNA1 region was amplified by PCR from all clones and subjected to sequencing. The DNA sequences thus obtained were aligned with MYC exon 2 using bioinformatics tools mentioned in the Materials and Methods. Figure 1C shows that the DNA sequences from clones 1, 4, 5, 7 and 8 aligned perfectly with the wild-type MYC exon 2 sequence, although c-Myc levels in these clones were lower than in the control. The exon 2 sequence from clones 2, 3, and 6 was disrupted with indels, transitions and transversions, which was evident from the gaps and mismatches in the sequence alignments (Fig. 1C). Comparison of the peptide sequences predicted (web.expasy.org/translate) from these DNA sequences was shown below:

Vector control: …PPATMPLNVSFTNRNYDLDYD…

Clone 1: …PPATMPLNVSFTNRNYDLDYD…

Clone 2: …PPAKYHLPYDSLHP…(premature stop)…

Clone 3: …PPANDPPHCSLPQEKL…(premature stop)…

Clone 4: …PPATMPLNVSFTNRNYDLDYD…

Clone 5: …PPATMPLNVSFTNRNYDLDYD…

Clone 6: …PPAKAPLHGFFNKKKYHLHHHAV…(premature stop)…

Clone 7: …PPATMPLNVSFTNRNYDLDYD…

Clone 8: …PPATMPLNVSFTNRNYDLDYD…

The above protein sequences clearly indicate that clones 2, 3, and 6 are completely altered due to frameshift mutations in the DNAs, when compared to the normal c-Myc amino acid sequence. This analysis provided evidence for the reduced levels of c-Myc detection in these clones by the western blotting analysis. However, loss of c-Myc in clones 5 and 7 could not be explained by the DNA sequence analysis which indicated that MYC was intact in these clones. Interestingly, it is known that colorectal cancers contain multiple pseudogenes of MYC (14), and one of these happened to be sequenced, yielding wild-type sequence in these clones.

To determine the functional consequences of MYC knockout in clones 5 and 7, cell proliferation assays were carried out as described under Materials and Methods. Figure 1D shows that the cell proliferation rates of these clones were nearly identical to that of the control, suggesting that the cell proliferation was unaffected with MYC disruption. To further analyze the MYC knockout, cell division cycle analysis was also carried out on these clones as described under Materials and Methods. Figure 1E shows that the distribution of cell population in G0/G1, S and G2/M phases in both clones was identical to that in the control. These results suggested that MYC is not involved in the regulation of cell division cycle in this cancer cell line. These results together suggest that c-Myc may not be the only cellular protein regulating these cellular processes in HT29 cells.

Disruption of MYC in OVCAR8 cell line.

In the absence of any functional alterations upon MYC disruption in HT29 cells, we performed these experiments on the human ovarian carcinoma OVCAR8 cell line. The OVCAR8 cells were transfected with the gRNA1 carrying pX459 plasmid and 24 puromycin-resistant clones were collected, as described under Materials and Methods. However, many of these clones could not be propagated due to extremely slow proliferation. The c-Myc expression and β-actin levels in 7 of these clones was determined by western blotting using 10 µg of total cellular protein lysates from these samples as mentioned in the Materials and Methods. Figure 2A shows the results. Among these clones, c-Myc expression was minimal in clones 9 and 21 when compared to other clones and vector, suggesting that MYC was likely disrupted in these clones. To establish MYC disruption, the MYC exon 2 segment encompassing the gRNA1 region from clones 9, 21 and the vector control, was PCR-amplified, sequenced and aligned with exon 2 sequence, as described under Materials and Methods. Figure 2B shows that the DNA from clones 9 and 21 contained widespread mismatches with indels. Comparison of the peptide sequences predicted (web.expasy.org/translate) from these DNA sequences was shown below:

Vector control: … PPATMPLNVSFTNRNYDLDYD…

Clone 9: … PPAICLSMWFSHINYNTVPPSLCSYISCD(premature stop)

Clone 21: … PPALCAPLQHAPAN(premature stop)

These data showed that c-Myc protein in clones 9 and 21 was prematurely truncated with stop codons introduced by indels and other alterations in exon 2, when compared to control, suggesting that MYC was disrupted. These data provided an evidence for the decreased expression of c-Myc in these clones.

To further characterize the effect of MYC disruption, cell proliferation was carried out as described under Materials and Methods. Figure 2C shows that clones 9 and 21 exhibited decreased rates of cell proliferation when compared to control. Although not shown, clones 1, 2, 4 and 8 exhibited normal cell proliferation, similar to controls. Together, these data suggested that c-Myc is an important protein, playing a key role in OVCAR8 cell proliferation, corroborating the well-established role of MYC in this cellular process (15). As performed on HT29 cells, the cell division cycle analysis was carried out on clones 9 and 21, and the results were shown in Fig. 2D. These data show that clones 9 and 21 contained a significantly increased percent of cells in G0/G1 phase, with a concomitant decrease in cells in G2/M phase, when compared to controls. These data indicated that MYC disruption leads to slow progression of cells from G0/G1 to S phase, suggesting that MYC regulates the cell division cycle in OVCAR8 cells.

To determine the mechanism of MYC-regulated cell division cycle, we analyzed the expression of phospho-cdc2 and p21 proteins in clones 9 and 21. Figure 3 shows that the phospho-cdc2 level was nearly similar in clones 9 and 21, to that in control cells. Interestingly, there was a significant increase in p21 levels in these clones, when compared to control. These data supports the well established observations that MYC represses the p21 expression (16). Together, these data suggested that MYC is an important gene in OVCAR8 cells regulating the cell proliferation and cell division cycle, and its disruption leads to downregulation of these processes.

Several clinical gene therapy trials conducted over the past four decades to treat various genetic defects met with limited success. The initial optimism at each gene therapy trial about restoring gene function was plagued by the unforeseen safety issues due to vector-triggered immune responses, off-target gene editing, insertional mutagenesis, patient selection criteria and others (17–22). These failures, although have raised doubts about the clinical efficacy of gene therapy, could be prevented with better understanding of diseases, clinical trial designs, and patient selection. Pharmacists, who receive education in all fields of basic sciences, are suitably qualified for training in genome editing research. Such training prepares these healthcare professionals to take part in developing policies and protocols for gene replacement, identifying risk levels, post-therapy care and in resolving ethical issues. Thus, we have undertaken training of PharmD students in gene editing in our research laboratory and the results are presented here.

Our laboratory has been training PharmD students in cancer biomarker validation (23, 24), and pharmacogenetics (25). This is our first attempt to train students in genome editing research. We chose MYC, hereto a non-druggable oncogene highly expressed in nearly 50 percent of all cancers, as a target for gene disruption. To compare the c-Myc expression levels among the clones and controls, we used both the estimates of total cellular protein as well as β-actin staining methods. Since β-actin is known to be susceptible to changes in response to various biochemical stimuli (26), we relied on total protein loading estimates to interpret the western blotting. As noted in the Results section, MYC was disrupted in several clones isolated from both cell lines. However, the amounts of c-Myc were variable in the isolated clones, suggesting that these cell lines carry more than two copies of MYC. Students were thus challenged to review the literature and then interpret the western blotting data in deriving the number of MYC copies in these cell lines. The general assumption is that the amount of c-Myc in controls is due to the transcriptional activity of two MYC copies and the clones would express either half or nil amounts of c-Myc. Contrary to this expectation, the clones in Fig. 1B and Fig. 2A contained more than or less than half the amount of c-Myc. The students thus recognized that cancers may harbor additional genetic alterations leading to the existence of additional copies of MYC.

The results presented here support the view that these cell lines contained greater than two copies of MYC. To validate this interpretation, the DNA fragments covering the CRISPR-Cas9 site from all these clones were sequenced. The data revealed indels, transitions and transversions in exon2 at the gRNA1 binding site, indicating that the predictive algorithms accurately identify gRNA sequence targets for Cas9 cleavage. In addition, indels and other alterations at the CRISPR-Cas9 site suggested that cells, a priori, adapt nonhomologous end joining mechanism of repair, in the absence of homology directed repair sequences. Closer examination of these DNA sequences revealed that MYC gene in HT29 clone 4 was intact, supporting the normal levels of c-Myc expression (Fig. 1B). Importantly, HT29 clones 5 and 7 although do not express c-Myc (Fig. 1B), the MYC DNA was intact. This observation suggested that HT29 cells might contain transcriptionally inactive MYC pseudogenes. To determine this, we carried out karyotyping on HT29 cells which indicated that this cell line contains three copies of chromosome 8 (data not shown) on which MYC was localized at 8q24.21, supporting the previous studies (27). Importantly, earlier studies have shown that the MYC locus on chromosome 8 in the HT29 cells is enriched as a homogeneously staining region (HSR) with many MYC pseudogenes (14). Together, these previous studies suggested that HT29 cells contain a minimum of 3 transcriptionally active copies of MYC.

Previous studies have shown that OVCAR8 cell line carry four copies of chromosome 8 (28), suggesting that this cell line carries 4 copies of MYC. Since clones 9 and 21 obtained from OVCAR8 cell line contained indels (Fig. 2B) leading to premature truncation of c-Myc, it is likely that many of these MYC copies were disrupted. On the other hand, clones 1, 2, 4, 5 and 8 express variable levels of c-Myc, suggesting one or more copies of MYC is transcriptionally active. An important outcome from these analyses is that gene therapy clinical trials must ensure that all gene copies in the target cells are edited to achieve optimum results in the clinic. These observations and interpretations are relevant to student training in gene therapies as these issues demand special attention in the clinical trials.

Since gene knockout must lead to the loss of function in order for clinical benefit, we analyzed cell proliferation and cell division cycle analyses to determine the role of MYC in HT29 and OVCAR8 cell lines. Our data showed that these cellular processes were affected with MYC disruption in OVCAR8 cells, but not HT29 cells, which pointed out that gene function is cell type-dependent. This observation is important because all the cells in an organism, though contain the same gene, its function is likely restricted to specific tissues. Thus, the students learned that gene delivery procedures must be directed to the desired tissue in which the gene is active to achieve maximum benefits of gene therapies. Analysis of cell proliferation and cell division cycle studies emphasized the gene function.

Finally, the students were directed to recognize the possible off-target genes in CRISPR editing using bioinformatics tools (29–33). If any of these off-target genes are functionally important, students were advised to design alternative gRNAs to minimize disruption of such off-target important genes in their clinical gene therapies. In conclusion, students trained in laboratory research gained an in-depth working knowledge and skills useful in forecasting and addressing the unforeseen setbacks continually encountered in gene therapy trials.

Acknowledgements

The authors wish to thank Logan Ferency-Viars, Robert Kudlinski, Alexandra Sturgell and Andrea Yates for their research rotation in the laboratory. We thank Dr. Bhavana Dave at the Department of Genetics, University of Nebraska Medical Center for karyotyping HT29 cells. We thank the College Administration for the financial support. The authors wish to thank Dr. Randy Mullins, for his keen interest and support for this laboratory training.

Author contribution

PSR and USR conceived and designed the study. PSR performed the experiments. PSR and USR analyzed the data and prepared the figures. USR wrote the manuscript and PSR reviewed the manuscript.

Data Availability Statement

The authors declare that all data supporting the findings of this study are available within the paper. The DNA sequence obtained from each clone mentioned in this paper was deposited at https://ncbi.nlm.nih.gov/nuccore/ with identities OQ865414 to OQ865425. Declaration of Interests

The authors declare no competing interests.

Ahmed Z, Zeeshan S, Mendhe D, Dong X. Human gene and disease associations for clinical-genomics and precision medicine research. Clin Transl Med. 2020;10(1):297–318.
Stenson PD, Mort M, Ball EV, Evans K, Hayden M, Heywood S, et al. The Human Gene Mutation Database: towards a comprehensive repository of inherited mutation data for medical research, genetic diagnosis and next-generation sequencing studies. Hum Genet. 2017;136(6):665–77.
Zeballos CM, Gaj T, Next-Generation CRISPR. Technologies and Their Applications in Gene and Cell Therapy. Trends Biotechnol. 2021;39(7):692–705.
Hampton T, With First CRISPR, Trials. Gene Editing Moves Toward the Clinic. JAMA. 2020;323(16):1537–9.
Kan MJ, Doudna JA. Treatment of Genetic Diseases With CRISPR Genome Editing. JAMA. 2022;328(10):980–1.
Kratzer K, Getz LJ, Peterlini T, Masson JY, Dellaire G. Addressing the dark matter of gene therapy: technical and ethical barriers to clinical application. Hum Genet. 2022;141(6):1175–93.
Pieczynski JN, Deets A, McDuffee A, Lynn Kee H. An undergraduate laboratory experience using CRISPR-cas9 technology to deactivate green fluorescent protein expression in Escherichia coli. Biochem Mol Biol Educ. 2019;47(2):145–55.
Satelli A, Rao PS, Thirumala S, Rao US. Galectin-4 functions as a tumor suppressor of human colorectal cancer. Int J Cancer. 2011;129(4):799–809.
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013;8(11):2281–308.
Vistica DT, Skehan P, Scudiero D, Monks A, Pittman A, Boyd MR. Tetrazolium-based assays for cellular viability: a critical examination of selected parameters affecting formazan production. Cancer Res. 1991;51(10):2515–20.
Rao PS, Rao US. Statins decrease the expression of c-Myc protein in cancer cell lines. Mol Cell Biochem. 2021;476(2):743–55.
Satelli A, Rao PS, Gupta PK, Lockman PR, Srivenugopal KS, Rao US. Varied expression and localization of multiple galectins in different cancer cell lines. Oncol Rep. 2008;19(3):587–94.
Rao US, Rao PS. Surface-bound galectin-4 regulates gene transcription and secretion of chemokines in human colorectal cancer cell lines. Tumour Biol. 2017;39(3):1010428317691687.
Alitalo K, Schwab M, Lin CC, Varmus HE, Bishop JM. Homogeneously staining chromosomal regions contain amplified copies of an abundantly expressed cellular oncogene (c-myc) in malignant neuroendocrine cells from a human colon carcinoma. Proc Natl Acad Sci U S A. 1983;80(6):1707–11.
Gabay M, Li Y, Felsher DW. MYC activation is a hallmark of cancer initiation and maintenance. Cold Spring Harb Perspect Med. 2014;4(6).
Gartel AL, Ye X, Goufman E, Shianov P, Hay N, Najmabadi F, et al. Myc represses the p21(WAF1/CIP1) promoter and interacts with Sp1/Sp3. Proc Natl Acad Sci U S A. 2001;98(8):4510–5.
Putman L. Debate grows on safety of gene-therapy vectors. Lancet. 1998;351(9105):808.
Shirley JL, de Jong YP, Terhorst C, Herzog RW. Immune Responses to Viral Gene Therapy Vectors. Mol Ther. 2020;28(3):709–22.
Kelley WN. A personal perspective on the early, early history of in vivo (DNA-based) gene therapy. Hum Gene Ther. 2012;23(6):541–6.
Wirth T, Parker N, Yla-Herttuala S. History of gene therapy. Gene. 2013;525(2):162–9.
Uddin F, Rudin CM, Sen T. CRISPR Gene Therapy: Applications, Limitations, and Implications for the Future. Front Oncol. 2020;10:1387.
Somia N, Verma IM. Gene therapy: trials and tribulations. Nat Rev Genet. 2000;1(2):91–9.
Rao PS, Labhart M, Mayhew SL, Thirumala S, Rao US. Heterogeneity in the expression of receptors in the human breast cancer metastasized to the brain. Tumour Biol. 2014;35(7):7267–73.
Rao US, Hoerster NS, Thirumala S, Rao PS. The influence of metastatic site on the expression of CEA and cellular localization of beta-catenin in colorectal cancer. J Gastroenterol Hepatol. 2013;28(3):505–12.
Rao PS, Endicott R, Mullins R, Rao US. A 6-week laboratory research rotation in pharmacogenomics: a model for preparing pharmacy students to practice precision medicine. Pharmacogenomics J. 2018;18(4):601–8.
Ruan W, Lai M. Actin, a reliable marker of internal control? Clin Chim Acta. 2007;385(1–2):1–5.
Kawai K, Viars C, Arden K, Tarin D, Urquidi V, Goodison S. Comprehensive karyotyping of the HT-29 colon adenocarcinoma cell line. Genes Chromosomes Cancer. 2002;34(1):1–8.
Roschke AV, Stover K, Tonon G, Schaffer AA, Kirsch IR. Stable karyotypes in epithelial cancer cell lines despite high rates of ongoing structural and numerical chromosomal instability. Neoplasia. 2002;4(1):19–31.
Kosicki M, Tomberg K, Bradley A. Repair of double-strand breaks induced by CRISPR-Cas9 leads to large deletions and complex rearrangements. Nat Biotechnol. 2018;36(8):765–71.
Lalonde S, Stone OA, Lessard S, Lavertu A, Desjardins J, Beaudoin M, et al. Frameshift indels introduced by genome editing can lead to in-frame exon skipping. PLoS ONE. 2017;12(6):e0178700.
Mou H, Smith JL, Peng L, Yin H, Moore J, Zhang XO, et al. CRISPR/Cas9-mediated genome editing induces exon skipping by alternative splicing or exon deletion. Genome Biol. 2017;18(1):108.
Rayner E, Durin MA, Thomas R, Moralli D, O'Cathail SM, Tomlinson I, et al. CRISPR-Cas9 Causes Chromosomal Instability and Rearrangements in Cancer Cell Lines, Detectable by Cytogenetic Methods. CRISPR J. 2019;2(6):406–16.
Tuladhar R, Yeu Y, Tyler Piazza J, Tan Z, Rene Clemenceau J, Wu X, et al. CRISPR-Cas9-based mutagenesis frequently provokes on-target mRNA misregulation. Nat Commun. 2019;10(1):4056.

No competing interests reported.

Download PDF

Journal Publication

published 19 Oct, 2023

Read the published version in American Journal of Molecular Biology →

Version 1

posted

You are reading this latest preprint version

c-Myc Knockout as a Model for Gene Editing for Training Healthcare Professional Students

Status:

Journal Publication

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

RESULTS

DISCUSSION

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1