Next generation RNA sequencing analysis of nuclear grapevines to identify viruses and viroids

doi:10.21203/rs.3.rs-3220739/v1

Download PDF

Research Article

Next generation RNA sequencing analysis of nuclear grapevines to identify viruses and viroids

https://doi.org/10.21203/rs.3.rs-3220739/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The use of next generation sequencing technology has allowed for greater elucidation of viruses infecting grapevine, which number more than 85. Many of these viruses can result in disease symptoms and it is therefore vital to the industry that they be supplied with healthy plant material. This is done through grapevine certification schemes. In this study, 97 nuclear grapevine vines subjected to a virus elimination process and maintained in vector-free conditions, were subjected to total RNA sequencing using the Ion-Torrent platform to determine the presence of viruses and viroids. In total, five virus species, four viroid species, and a further putative viroid species were identified in these nuclear grapevines through NGS analysis and confirmed using RT-PCR and Sanger sequencing. Grapevine Rupestris stem pitting-associated virus was identified in six nuclear accessions, while grapevine fleck virus, grapevine Syrah virus, grapevine leafroll-associated virus 4, and grapevine Rupestris vein feathering virus were identified in one nuclear accession each. Viroids were identified in 73 of the 97 nuclear accessions, with hop stunt viroid present in 63 of the 97 samples followed by grapevine yellow speckle viroid 1, present in 52 of the 97 samples, grapevine yellow speckle viroid 2, present in 17 of the 97 samples, Australian grapevine viroid present in three of the 97 samples and grapevine hammerhead viroid-like RNA was identified in two of the 97 samples. These findings suggest that some viruses, especially GRSPaV, and viroids are recalcitrant to currently employed virus elimination techniques, and how advantageous the use of NGS is to grapevine certification schemes.

Viroids

Viruses

RT-PCR

Next Generation Sequencing

Grapevine

Grapevine, Vitis vinifera and various hybrids, are cultivated in more than 115 000 hectares and contribute significantly to the economy of South Africa (James, 2013; SAWIS, 2021). Grapevines are susceptible to a large array of pest and pathogens because they are propagated vegetatively, which allows for the accumulation of pathogens. The most serious of these pathogens are virus and virus-like agents. These infectious agents may lead to yield losses, the shortening of the productive life of vineyards, and shortening the overall lifespan of the vines (Martelli, 2014).

Grapevine has been reported as the host of at least 85 different species of virus and seven species of viroids (Fuchs, 2020). Many of these viruses belong in one of four disease complexes (Martelli, 2017). The grapevine leaf roll disease complex which is associated with grapevine leafroll associated viruses and results in the reddening or yellowing of leaves and down rolling of leaves (Angelini et al., 2017; Burger et al., 2017; Naidu, 2017), the rugose wood complex, which is associated with vitiviruses and grapevine Rupestris stem pitting-associated virus (GRSPaV) and affects the woody cylinder, cambium tissues, and bark of grapevines (Minafra et al., 2017), the fleck disease complex, which is associated with viruses of the Tymoviridae family and result in clearing of small veins, with translucent spots and leaf deformation (Martelli, 2017) and infectious degeneration and decline complex which is associated with various species of nepoviruses and results in malformations, yellow mosaic, vein banding, stunting and decline (Digiaro et al., 2017). Many of these viruses are spread through vectors and infected planting material (Martelli, 2017).

To date, only seven viroid species are known to infect grapevines; Hop stunt viroid (HSVd) is the causal agent of hop stunt in Japan but displays no symptoms in grapevine (Sano et al., 1986). Citrus exocortis viroid (CEVd) is the causal agent of ‘exocortis’ in citrus and was first reported from symptomless grapevine in Spain (Garcia-Arenal et al., 1987). Australian grapevine viroid (AGVd) (Rezaian et al., 1988) is reported only from grapevine and results in asymptomatic infections. Grapevine latent viroid (GLVd) was first reported from asymptomatic grapevines in China (Zhang et al., 2014) as was Japanese Grapevine Viroid (JGVd) (Chiaki & Ito, 2020) from asymptomatic grapevines in Japan. Grapevine yellow speckle viroid 1 (GYSVd-1) (Rezaian et al., 1988) and Grapevine yellow speckle viroid 2 (GYSVd-2) (Koltunow et al., 1989) are the casual agents of yellow speckle disease in grapevine. Both species have a global distribution though GYSVd-1 has a greater level of genetic diversity in comparison to GYSVd-2 (Jiang et al., 2012; Tangkanchanapas et al., 2017). No vector is known for these viroids and dissemination occurs through distribution of infected propagation material and mechanical inoculation (Martelli, 2014).

It is vital to the grapevine industry that these viruses and virus-like agents are controlled. The most effective method of achieving this is through the development and propagation of virus-free (VF) plant material (Martelli and Walter, 1998). This is achieved through grapevine certification schemes across the world, which utilize various techniques to produce VF plant material for industry use. In South Africa the original plants generated through these techniques are termed nuclear plants and from these, millions of plants are produced by vegetative propagation for the industry. Certification schemes use various techniques to generate VF grapevine nuclear material, such as thermotherapy, meristem tip culture, somatic embryogenesis, in-vitro chemotherapy, and cryotherapy of shoot tips (Martelli and Walter, 1998; Varveri et al., 2015). In South Africa, the Vine Improvement Association (VIA) oversees the South African Certification Scheme of Grapevines and makes use of heat therapy and meristem tip culture to produce VF vines.

Deep sequencing, utilizing Next Generation Sequencing technologies, has proven to be a valuable and powerful tool in the identification of novel viruses and viroids. This approach is not hindered in the way traditional diagnostic methods are, where information about the virus/viroid is requisite. Using this method, grapevine Syrah virus 1 (GSyV-1) (Al Rwahnih et al., 2009a), grapevine Pinot Gris-associated virus (Giampetruzzi et al., 2012), grapevine vein clearing virus, the first DNA virus to be described from Vitis (Zhang et al., 2011) and various Vitivirus spp. (Al Rwahnih et al., 2012; Blouin et al., 2017; Candresse et al., 2018; Jo et al., 2017), JGVd, and GLVd have been identified.

Tests performed at the Waite Institute, University of Adelaide, Australia, on some South African nuclear grapevine plants have shown the presence of GFkV and GRSPaV in the past. Given this knowledge, and considering that heat treatment favors viroid replication, led to the aim of this study, which is to investigate the residual viral and viroidal infections present in nuclear grapevines in the South African Certification Scheme for grapevine using NGS technology. This would generally reflect those having escaped heat therapy and meristem tip.

Ninety-seven nuclear grapevine accessions were obtained from three Plant Improvement Organisations (PIO’s) in South Africa over three years. The selection of nuclear accessions was left to the PIO’s. Petiole tissue was harvested at the end of February and cane material was harvested at the end of June of each year. Total RNA was extracted from each sample using a modified CTAB RNA extraction method from (White et al., 2008). Pooling of RNA from any single vines sampled on different occasions was done to compensate for the possibility that certain viruses occur at higher titres at different times in the season (Osman et al., 2012). Concentration and quality of RNA were determined by Nanodrop™ spectrophotometry (Thermo Fisher Scientific). Further quality control was done using reverse transcriptase polymerase chain reaction (RT-PCR) of the actin housekeeping gene (van den Berg et al. 2004). Samples of optimal concentration and quality were sent for Ion Torrent RNA sequencing at the Central Analytical Facility of Stellenbosch University.

These 97 samples were assessed for RNA integrity (RINe) on the TapeStation 4150, using the RNA ScreenTape assay (Agilent Technologies, Waldbronn, Germany) according to the manufacturer’s protocol. The concentration of the RNA was determined with fluorometry on the Qubit 4 using the Qubit RNA high sensitivity assay kit (ThermoFisher Scientific). Ribo-depletion was then performed with the RiboMinus Plant Kit (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. The concentrated, ribo-depleted RNA was quantified on the Agilent TapeStation using the RNA ScreenTape according to the manufacturer’s protocol. Ion Total RNA-Seq Kit v2 (ThermoFisher Scientific) was used to convert expressed RNA transcripts into a representative cDNA library for strand specific RNA sequencing on the Ion Torrent™ S5™ system according to the manufacturer’s protocol, 10µl of RNA was fragmented with RNAseIII for 2min at 37°C. The fragmented RNA was purified, using the magnetic bead clean-up module and eluted in 12µl nuclease-free water. The fragmented RNA was concentrated to a 3µl volume for subsequent hybridization and ligation to adapters at 30°C for 1hr. The RNA, with hybridized adapters, was reverse transcribed to generate a single stranded cDNA library. These cDNA products were amplified using RNA Xpress Barcode adapters (ThermoFisher Scientific), across 14 cycles, to prepare a barcoded cDNA library for each sample. These libraries were assessed for yield and fragment size distribution on the Agilent TapeStation 4150, using the high sensitivity D1000 assay (Agilent Technologies) according to the manufacturer’s protocol. Libraries were then diluted to a target concentration of 60pM for template preparation using the Ion 540™ Chef Kit (ThermoFisher Scientific). Twenty-five microliters of diluted, pooled barcoded library were loaded onto the Ion Chef liquid handler for template preparation and enrichment using Ion 540™ Chef Reagents, Solutions and Supplies according to the manufacturer’s protocol. Enriched ion sphere particles were then loaded onto an Ion 540™ Chip. Massively parallel sequencing was performed on the Ion Torrent™ GeneStudio™ S5 Prime System using sequencing solutions and reagents according to the manufacturer’s protocol. Flow space calibration and base-caller analysis was performed using standard analysis parameters in the Torrent Suite Version 5.18.0 Software.

Sequence data was trimmed, filtered, and assembled using CLC Genomics Workbench (CLC Aarhus Denmark). De novo assembly was done using both default parameters (automatic word size = 23) and optimised parameters for datasets positive for virus infection (word size = 30 and 35). Assembled contigs were subjected to BLAST analysis (e-value cut off: 1e-5; query coverage: ≥ 80%) against the NCBI GenBank RefSeq of viruses and viroids using the CLC BLAST function. Any contigs that matched to known viruses and viroids were then extracted and subjected to BLASTn analysis at NCBI Genbank to confirm identity.

The assembled viral/viroidal contigs were mapped against the NCBI designated reference genomes of identified viruses and viroids (CLC workbench mapping tool). If the full genome could not be obtained, the most closely related genome was used as reference during mapping in place of the reference genome. The full-length consensus sequence, if obtained, after mapping/directly by de novo assembly was considered as the complete/near complete genome for a particular virus/viroid. To confirm the assembly results, using the reference mapping tool in CLC genomics workbench, reads were first mapped to the Vitis vinifera genome (GCF_000003745.3) using CLC workbench mapping tool with default parameters (match score-1, mismatch cost-2, length fraction-0.5, similarity fraction-0.8) (Sidharthan 2020). Unmapped reads were then mapped to reference sequences of all known viruses and viroid species using the CLC workbench reference mapping tool using the following parameters, match score-1, mismatch cost-2, length fraction-0.9/0.8/0.7, similarity fraction-0.9/0.8/0.7.

Reverse transcriptase polymerase chain reaction (RT-PCR) was used to confirm the presence of the viruses and viroids identified from the sequencing data. A one-step RT-PCR reaction was conducted using 1 µl nucleic acid in a mixture containing 10 µM of each respective forward and reverse primer, 5 X GoTaq® buffer, 100 mM molecular grade DDT, 25 mM MgCl₂, 10 mM dNTP mix, 200 U/µl Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT), 40 U/µl Recombinant RNasin® ribonuclease inhibitor and 5 U/µl GoTaq® DNA polymerase (reagents were sourced either from New England BioLabs, Massachusetts, USA or Promega, Wisconsin, USA). The remainder of the 25 µl total volume was made up of nuclease-free water. Amplification was preformed using the following program: one cycle of reverse transcription for 45 min at 37 ˚C, 2 min at 50 ˚C, 5 min at 94 ˚C, and 35 cycles of 30s at 94˚C, 30s at each primer annealing temperature (Table 1), 30 s at 72 ˚C, followed by a terminal extension of 5 min at 72 ˚C. PCR products were analysed by electrophoresis on a 2% agarose gel. PCR products were submitted for bidirectional Sanger sequencing at the Central Analytical Facility at Stellenbosch University. Sequence identity was confirmed using NCBI BLAST.

Table 1

primers used for RT-PCR of viruses and viroids.
Species	Primer Sequence	Band size	Annealing Temp	Reference
GRSPaV	CPORF_R8620 5’-ATTAGTACGGTATTCCAGCG-3’ CPORF_7709F 5’-TGAAGGCTTTAGGGRTTAG-3’	928	58˚C	(Mostert et al., 2018)
GLRaV-4	LRAmpF 5’-ATTTAGGTAATGTWGTRGCTAC-3’ LRAmpR 5’-TATCCTCAGWGAGGAARCGG-3’	485	46˚C	(Abou Ghanem-Sabanadzovic et al. 2012)
GSyV-1	GVQCP-F 5′-TCCCAGCTTCAGGGTGAATT − 3′ GVQCP-R 5′-GCATTGCTGCGCATTGGAGG − 3	720	52˚C	(Engel et al., 2010)
GFkV	GFkV_3_F 5’-AGCCTGCTGTCTCTAGCT-3’ GFkV_3_R 5’-CACCTGTGGCTTCTACCG-3’	500	49˚C	(Usher, per com)
GRVFV	GRVFV-SAF215 5’TACAAGGTGAATTGCTCCACAC-3’ GRVFV-SAR1025 5’-TCATTGGCGATGCGTTCG − 3’	320	50˚C	(Lesilane, per com)
HSVd	HSVdI - GCGTCTCATCGGAAGAGCC-3’ HSVdII 5’-GACCGGTGGCATCACCTCT-3’	296	56˚C	(Kofalvi et al. 1997)
GYSVd-1	AS 5’-GCGGGGGTTCCGGGGATTGC-3’ S 5’-TAAGAGGTCTCCGGATCTTCTTGC-3’	367	55˚C	(Polivka et al., 1996)
GYSVd-2	P1 5’ ACTAGTACTTTCTTCTATCTCCCGAAGC-3’ P2 5’-ACTAGTCCGAGGACCTTTTCTAGCGCTC-3	370	60˚C	(Jiang et al., 2009)
AGVd	AS 5’-GTCGACGACGAGTCGCCAGGTGAG-3’ S 5’-GTCGACGAAGGGTCCTCAGCAGAG-3’	370	64˚C	(Wah & Symons, 1997)
GHVd	Vir-F2 5'GTGTGGTGCTCCTGACGAGTCCA 3' Vir-R2 5' CTAGCCTAGGAGCGAATCTGCCA 3'	320	60˚C	(Candresse et al., 2017)

Phylogenetic relationships for the viral/viroid sequences were determined from the aligned sequences, reference sequences downloaded from NCBI Genbank, using the Maximum Likelihood method (1000 bootstrap replications, General Time Reversible model) implemented in MEGA 7.0 (Kumar et al., 2016). Percentage identity scores between viroid sequences were determined using the Sequence Demarcation Tool (SDTv1.2) (Reuter and Mathews, 2010).

The number of raw reads obtained from Ion Torrent RNA sequencing ranged from 30 785 717 to 61 267 502 million with an average of 43 374 337 million reads across the 97 sample libraries (Supplementary Table 1). After assembly using CLC genomics workbench using default parameters, an average of 17 706 contigs were obtained along with an average N50 of 401 (Supplementary Table 2).

Using both BLASTn analysis and reference mapping, five grapevine viruses and four of the seven currently known grapevine infecting viroids were identified. Only 21 plants were completely free of both viroids and viruses, a summary of which can be found in Supplementary Table 2. The presence of each viroid and virus was confirmed using RT-PCR and Sanger sequencing.

The viruses identified included grapevine Ruspestris stem pitting-associated virus (GRSPaV), grapevine fleck virus (GFkV), grapevine syrah virus 1 (GSyV-1), grapevine leaf roll-associated virus 4 (GLRaV-4) and grapevine Ruspestris vein feathering virus (GRVFV). The most abundant of these viruses was GRSPaV, which was identified in six of the 97 (0.05%) samples. Phylogenetic analysis of the coat protein region of the GRSPaV isolates reveal that five isolates belong to group I and one isolate belongs to group IId of GRSPaV (Fig. 1).

GSyV-1 was identified in one sample and phylogenetic analyses of the coat protein region revealed that this isolate is most like GSyV-1 strain Cultivated-TN1 (MN716774) and appears to group into the European clade (Fig. 2).

GFkV was identified in one sample and is shares similarity with GFkV isolate SK53 (JN133940). Phylogenetic analysis reveals a high level of diversity in GFkV and isolate BA8 belonging to group I (Fig. 3). Characterisation of this isolate is discussed in Chap. 3.

GLRaV-4 was identified in one sample and sequence comparison revealed that it is most similar to GLRaV-4 isolate LR106 (FJ467503) which belongs to the GLRaV-4 group (Fig. 4). Optimisation of de novo assembly parameters showed that word size = 35 increased virus contig length and virus genome coverage. The number of contigs, assembled using word size = 35, retrieved for each of the viruses identified and the length of the partially reconstructed genome of each virus are shown in Supplementary Table 4.

Results of genome reconstruction using reference mapping analysis for both viruses and viroids identified are shown in Supplementary Table 5.

Viroids were the most frequently identified virus-like agent, being present in 73 of the 97 (75.2%) samples, with four of the seven viroid species and one putative viroid species having been identified. Of the four viroids identified, HSVd is the most abundant being present in 63 of the 97 (65.4%) samples followed by GYSVd-1, present in 52 of the 97 (53.6%) samples, GYSVd-2 present in 17 of the 97 (17.6%) samples, AGVd present in three of the 97 (0.03%) samples, while GHVd was identified in two of the 97 samples (0.02%). CEVd, JGVd, and GLVd were not identified in any of the grapevine nuclear accessions.

Analysis and comparisons of HSVd sequences show the HSVd isolates fall into three groups (Fig. 5), with the majority of HSVd isolates obtained in this study being most like HSVd isolate PGH-2 (GenBank accession KR909028) with high levels of sequence identity (96.3–98.7%), the second group being most like HSVd isolate A1541t (GenBank accession ON669211), and third and smallest group being most like HSVd isolate SLD-Y23 (GenBank accession KY270463) (Supplementary Table 6).

Analysis of GYSVd-1 sequences show all four types of GYSVd-1 are present, which can be observed in the phylogenetic analyses (Fig. 6). Sequence comparisons between the four types of GYSVd-1 show that the isolates have a board range of similarities, between 81–99% (Supplementary Table 6). The four GYSVd-1 types occur in mixed infections which was confirmed through reference mapping, BLASTn analysis, and RT-PCR and Sanger sequencing.

Analysis of GYSVd-2 sequences show that the isolates of GYSVd-2 were similar to GYSVd-2 clone 2235 (FJ597945) and GYSVd-2 clone 32 (FJ490175), ranging from 99–100% similarity in nucleotide identity (Supplementary Table 6). The overall similarity in nucleotide identity between the isolates range from 95–100%. Phylogenetic analyses confirms that there are lower levels of diversity amongst the GYSVd-2 isolates in comparison to the GYSVd-1 isolates (Fig. 7).

Sequence analysis show that the AGVd isolates are most like reference sequence AGVd isolate xatam (GenBank accession KF876037) (98.4–100%) (Supplementary Table 6). The presence of AGVd was not confirmed using RT-PCR but phylogenetic analyses of nucleotide sequences from the sequencing data show that there are low levels of diversity amongst the AGVd-1 isolates (Fig. 8).

The application of high throughput sequencing in identifying residual virus and viroid infections in nuclear grapevine material was shown to be useful and informative. In total, five virus and four viroid species were identified and confirmed to be infecting nuclear grapevine material in South Africa.

GRSPaV, a virus of the genus Foveavirus of the family Betaflexiviridae, was shown to be associated with Rupestris stem pitting (RSP), though the disease aetiology has not been clearly defined (Goheen, 1988; Meng and Rowhani, 2017). Currently, seven distinctive variant groups (I, IIa, IIb, IIc, IId, III, and IV) are recognised for GRSPaV (Glasa et al., 2017; Hily et al., 2018; Mostert et al., 2018). The symptoms associated with GRSPaV differ among variants and depend on the cultivar which is infected (Habili et al., 2006; Meng et al., 2005). Variants of group IIa are associated with grapevine vein necrosis, group IIc are associated with RSP, and group I are associated with Syrah decline (Habili et al., 2006; Lima et al., 2006; Meng et al., 2005). Phylogenetic analyses of the coat protein gene of the isolates from this study reveal that four of the isolates fall into GRSPaV group I and two isolates fall into the recently identified group IId (Mostert et al., 2018). GRSPaV group IId was initially identified in South Africa and this nuclear block is potentially the original source of this variant in South African vineyards. The identification of two single sources of GRSPaV group IId may allow the opportunity to investigate the disease symptoms and disease severity of this variant. GRSPaV isolates BK18 and BK23 are present in vines that have not undergone thermotherapy and meristem tip culture and therefore, the virus’s presence is not surprising. However, GRSPaV isolates BA22, BA24, BA26, and BA29, are present in grapevines that have undergone both elimination treatments. This confirms previous reports regarding the recalcitrance of GRSPaV to elimination via thermotherapy and meristem culture (Gribaudo et al., 2006; Skiada et al., 2013, 2009).

GFkV, of the genus Maculavirus in the family Tymoviridae, is the causal agent of fleck disease, symptoms of which include vein clearing which leads to translucent spots, or ‘flecks’ (Boscia et al., 1991; Hewitt et al., 1962; Martelli et al., 2002). GFkV has been shown to fall into two groups based on sequence analysis of the coat protein (CP) and replicase regions (Glasa et al., 2011; Shi et al., 2003), however, the taxonomy of this genus has not been fully resolved and the second group may represent a new species (Glasa et al., 2011). GFkV has been shown to not be fully eliminated using thermotherapy and meristem culture (La Notte et al., 2006; Morelli et al., 2015) and therefore, its presence in a grapevine plant that has undergone both thermotherapy and meristem tip culture is not completely unexpected.

GRVFV, of the genus Marafivirus in the family Tymoviridae, is the causal agent of Rupestris vein feathering, which is a mild asteroid mosaic disease which results in the transient chlorotic discolouration of the primary and secondary veins of the leaves in V. rupestris (El Beaino et al., 2001; Faoro and Gugerli, 1997). GRVFV was identified in one nuclear sample, which is a raisin grape variety, one of very few that has not undergone virus elimination; therefore, its presence is not surprising. GSyV-1, also of the genus Marafivirus in the family Tymoviridae, was one of the first viruses in grapevine to be identified using next generation sequencing (Al Rwahnih et al., 2009). This virus was identified from Syrah grapes experiencing severe decline but its association with the disease state has not been determined. GSyV-1 has since been reported from several grape growing countries including South Africa (Al Rwahnih et al., 2009; Giampetruzzi et al., 2012; Glasa et al., 2015; Oosthuizen, 2017). Phylogenetic analysis has revealed that GSyV-1 groups into two clades based on geographic origin, Europe and North America, with diversity being higher amongst the European isolates (Glasa et al., 2015). Isolate BA22 sorts with the European clade. This diversity is only evident using whole genomes and the use of NGS and genome reconstruction may reveal further population diversity, this was not undertaken in this study due to time and funding constraints but will be considered for future studies on GSyV-1. Genome reconstruction through mapping contigs to a reference genome only yielded a coverage of 45% for GRVFV and 49% for GSyV-1, which coincides with other studies (Eichmeier et al., 2016). This may be due to the variation that is present within this virus species, which can be up to 20% between isolates, the limited number of reference genomes, and lack of sequencing depth due to low virus titre (Al Rwahnih et al., 2009; Aoki and Suzuki, 2022). To fully reconstruct these virus genomes, small RNA (sRNA) sequencing may be a viable alternative as previous studies have shown more robust genome reconstruction using this method (Navrotskaya et al., 2021; Sidharthan et al., 2020).

GLRaV-4, of the genus Ampelovirus, family Closteroviridae, is one of several viral agents associated with leaf roll disease in grapevine (Hu et al., 1990; Martelli, 2014). The genus Ampleovirus is comprised of several virus species, but it has since been shown that GLRaV-4, -5, -6, and − 9, are all variants of the same virus, GLRaV-4, and are now referred to as strains of GLRaV-4 (Martelli et al., 2012). GLRaV-4 induces milder symptoms in comparison to GLRaV-3 (Martelli, 2014; Reynard et al., 2015). GLRaV-4 was identified in one nuclear sample, which is a raisin grape variety that has not undergone virus elimination; therefore, its presence is not unexpected. Sequencing and nucleotide comparisons show that this isolate is part of the GLRaV-4 group, being most similar to GLRaV-4 isolate LR106 (FJ467503), phylogenetic analysis shows that this isolate is part of the GLRaV-4 group.

Analysis of the HSVd isolates from this study show that they can be divided into three groups. The largest group shares the most nucleotide identity with HSVd isolate PGH-2 which originates from grapevine, the second group shares the most nucleotide identity with HSVd isolate A1541t which also originates from grapevine, the third group sharing nucleotide identity with HSVd isolate SDLY-23 which originates from strawberry. These differences between nucleotide sequences of HSVd isolates suggest that it displays a quasispecies nature (Eiras et al., 2006; Kofalvi et al., 1997). A previous study into viroid diversity in South Africa has shown that the first and third group are present in South African vineyards (Morgan et al., 2023) (Chap. 4). HSVd was detected in 63 of the 97 nuclear vines, including all 17 that have not undergone virus elimination. HSVd is present in more than half the nuclear vines that have undergone virus elimination. It stands to reason that this viroid is very well spread throughout the various sectors of the grapevine industry as it is found in wine, table, and raisin grape varieties at the nuclear level.

GYSVd-1 occurs in a heterogenous population and are separated into four types (Little and Rezaian, 2003; Salman et al., 2014; Szychowski et al., 1998). Results of this study indicate that GYSVd-1 type 1, GYSVd-1 type 2, GYSVd-1 type 3, and GYSVd-1 type 4 are present in nuclear grapevines. Types 1, 3, and 4 have been implicated in yellow speckle disease (Hajizadeh et al., 2012; Polivka et al., 1996; Salman et al., 2014), however the nucleotide identity difference between these three is fairly low, ranging from 89.8–91.8%. These differences may be associated with the variability and transient expression of the yellow speckle-vein banding symptoms (Fajardo et al., 2016; Polivka et al., 1996). GYSVd-2 also forms a quasispecies (Flores et al., 2005; Salman et al., 2014; Zhong et al., 2008), even though it has been shown to be less genetically diverse than GYSVd-1 (Jiang. et al., 2009a). This lower level of diversity can be observed in the limited genetic variation with sequence identities between isolates of GYSVd-2, ranging from 95–100%. Yellow Speckle disease expression appears to be highly variable depending on both viroid sequence and environment (Salman et al., 2014) and disease symptoms were not observed on any vines during this study probably due to the nuclear plants being grown in vector-free greenhouse conditions.

Phylogenetic analyses and nucleotide sequence identity show that AGVd does not have a high degree of genetic variability (Jiang et al., 2009b), through previous reports show that AGVd variants cluster based on geographic origin, the Italian, Tunisian and Australian cluster and the Chinese and Iranian cluster (Gambino et al., 2014; Jiang et al., 2009b). Sequences obtained in this study and previous studies of AGVd in South Africa show that south African isolates sort into both major clusters. GHVd is a under characterized circular, single stranded RNA molecule discovered through the bioinformatic analysis of small interfering RNAs of grapevine in Italy (Wu et al., 2012). It is 375 nucleotides in length and has similar structural characteristics of viroids or of some small circular satellite RNA molecules, however its infectivity has not been confirmed and therefore its identity as a viroid or satellite RNA is regarded as tentative (Martelli, 2014; Wu et al., 2012). GHVd has been detected in a number of grapevine growing countries (Candresse et al., 2017; Pappi et al., 2020) and further investigation will most likely reveal further distribution in the grape growing regions of South Africa, especially considering its discovery in nuclear grapevine material.

The presence of viroids in nuclear grapevine material was not unexpected given the nature of viroid replication. Studies have shown that traditional thermotherapy combined with meristem tip culture is only 39% and 42% effective at eliminating HSVd and GYSVd-1, respectively (Miljanić et al., 2022). This is most likely due to the complete dependence the viroid has on the hosts molecular machinery for replication (Savitri et al., 2013), it has therefore been suggested that low temperature thermotherapy to utilized for viroid elimination as the metabolism of the host is decreased (Varveri et al., 2015). These low temperatures have been utilized for the elimination of potato spindle tuber viroid (Lizirraga et al., 1980), chrysanthemum stunt viroid, chrysanthemum chlorotic mottle viroid (Paduch-Cichal and Kryczyński, 1987), apple scar skin viroid (Postman and Hadidi, 1995), and hop latent viroid (Adams et al., 1996) with varying levels of success. This technique has not been fully explored in grapevine yet. The only method which has shown to be nearly 100% effective at eliminating viroids from grapevine is somatic embryogenesis, where HSVd and GYSVd-1 were successfully eliminated from four Italian grapevines (Gambino et al., 2011). Therefore, should the Scheme wish to generate viroid free plant material, studies using this method may be recommended.

Nuclear grapevine material in South Africa is routinely tested for only a few of the known grapevine viruses. This study has shown that nuclear grapevine material is still free of most of the known viruses, despite this limited testing. This occurrence is likely due to the mandatory implementation of virus elimination, through heat therapy and meristem tip culture, which has occurred over the last four decades in wine grapes, but more recently in table- and raisin grapes. Next generation sequencing has proven useful in elucidating the virus/viroidal status of nuclear grapevine material in South Africa. Of the eight nuclear vines shown to be positive for viral infection, five had undergone thermotherapy and meristem tip culture, while three had not. These five were infected with GRSPaV, GFkV, and GSyV-1, with the first two known to be difficult to eliminate. The presence of GSyV-1 is interesting, and the effectiveness of its elimination may need to be further explored. The three vines that had not undergone treatment were infected with GRSPaV, GLRaV-4, and GRVFV. GLRaV-4 and GRVFV are amongst the less common grapevine viruses and their presence is interesting and highlights the effectiveness of the Scheme in eliminating most grapevine viruses.

As grapevine does not aways express disease symptoms associated each virus and viroid that it is infected with, the use of NGS is advantageous in indexing the plant material both for quarantine purposes and within certification schemes. Its use has further demonstrated that certain viral and viroidal species are recalcitrant to elimination especially for GRSPaV and GFkV, which are considered economically important viruses of grapevine.

Author contributions SWM, and GP contributed to the study design. SWM and GP contributed towards sample collection and processing. SWM, JTB, and GP, wrote the manuscript.

Funding This work was funded by the Wine industry network of expertise and technology (Winetech), South Africa and the South African Table Grape Industry (SATI). SWM obtained a faculty scholarship for three years pursuant of this study.

Compliance with ethical standards

Conflict of interest The authors declare that they have no conflict of interest.

Ethical standards The manuscripts constitutes original research and has not been previously published. All authors are in agreement for manuscript submission, which complies with the ethical standards of the journal.

Adams, A.N., Barbara, D.J., Morton, A., Darby, P., 1996. The experimental transmission of hop latent viroid and its elimination by low temperature treatment and meristem culture. Annals of Applied Biology 128, 37–44. https://doi.org/10.1111/j.1744-7348.1996.tb07087.x
Al Rwahnih, M., Daubert, S., Golino, D., Rowhani, A., 2009. Deep sequencing analysis of RNAs from a grapevine showing Syrah decline symptoms reveals a multiple virus infection that includes a novel virus. Virology 387, 395–401. https://doi.org/10.1016/j.virol.2009.02.028
fAl Rwahnih, M., Sudarshana, M.R., Uyemoto, J.K., Rowhani, A., 2012. Complete Genome Sequence of a Novel Vitivirus Isolated from Grapevine. Journal of Virology 86, 9545–9545. https://doi.org/10.1128/jvi.01444-12
Angelini, E., Aboughanem-Sabanadzovic, N., Dolja, V.V., Meng, B., 2017. Grapevine Leafroll-Associated Virus 2, in: Meng, B., Martelli, G.P., Golino, D.A., Fuchs, M. (Ed.), Grapevine Viruses: Molecular Biology, Diagnostics and Management. Springer International Publishing, Cham, pp. 141–165. https://doi.org/https://doi.org/10.1007/978-3-319-57706-7_2
Aoki, Y., Suzuki, S., 2022. First Report of Grapevine Rupestris Vein Feathering Virus in Vitis vinifera from Japan. Plant Disease 106, 338.
Blouin, A.G., Keenan, S., Napier, K.R., Barrero, R.A., MacDiarmid, R.M., 2017. Identification of a novel vitivirus from grapevines in New Zealand. Archives of Virology 163, 281–284. https://doi.org/10.1007/s00705-017-3581-0
Boscia, D., Martelli, G., Savino, V., Castellano, M., 1991. Identification of the agent of grapevine fleck disease. Vitis 30, 97–105.
Burger, J.T., Maree, H.J., Gouveia, P., Naidu, R.A., 2017. Grapevine Leafroll-Associated Virus 3, in: Meng, B., Martelli, G.P., Golino, D.A., Fuchs, M. (Ed.), Grapevine Viruses: Molecular Biology, Diagnostics and Management. Springer International Publishing, Cham, pp. 167–195. https://doi.org/https://doi.org/10.1007/978-3-319-57706-7_2
Candresse, T., Faure, C., Theil, S., Spilmont, A.S., Marais, A., 2017. First report of grapevine hammerhead viroid-like RNA infecting grapevine (Vitis vinifera) in France. Plant Disease. https://doi.org/10.1094/PDIS-05-17-0716-PDN
Candresse, T., Theil, S., Faure, C., Marais, A., 2018. Determination of the complete genomic sequence of grapevine virus H, a novel vitivirus infecting grapevine. Archives of Virology 163, 277–280. https://doi.org/10.1007/s00705-017-3587-7
Chiaki, Y., Ito, T., 2020. Characterization of a distinct variant of hop stunt viroid and a new apscaviroid detected in grapevines. Virus Genes 56, 260–265. https://doi.org/10.1007/s11262-019-01728-1
Digiaro, M., Elbeaino, T., Martelli, G.P., 2017. Grapevine Fanleaf Virus and Other OldWorld Nepoviruses, in: Meng, B., Martelli, G.P., Golino, D.A., Fuchs, M. (Ed.), Grapevine Viruses: Molecular Biology, Diagnostics and Management. Springer International Publishing, Cham, pp. 47–82. https://doi.org/https://doi.org/10.1007/978-3-319-57706-7_2
Eichmeier, A., Komínková, M., Komínek, P., Baránek, M., 2016. Comprehensive virus detection using next generation sequencing in grapevine vascular tissues of plants obtained from the wine regions of Bohemia and Moravia (Czech Republic). PLoS ONE 11, 1–15. https://doi.org/10.1371/journal.pone.0167966
Eiras, M., Targon, M.L.P.N., Fajardo, T.V.M., Flores, R., Kitajima, E.W., 2006. Citrus exocortis viroid and Hop Stunt viroid doubly infecting grapevines in Brazil. Fitopatologia Brasileira 31, 440–446. https://doi.org/10.1590/S0100-41582006000500002
El Beaino, T., Sabanadzovic, S., Digiaro, M., Abou Ghanem-Sabanadzovic, N., Rowhani, A., Kyriakopoulou, P.E., Martelli, G.P., 2001. Molecular detection of Grapevine fleck virus-like viruses. Vitis 40, 65–68.
Fajardo, T.V.M., Eiras, M., Nickel, O., 2016. Detection and molecular characterization of Grapevine yellow speckle viroid 1 isolates infecting grapevines in Brazil. Tropical Plant Pathology 41, 246–253. https://doi.org/10.1007/s40858-016-0097-1
Faoro, F., Gugerli, P., 1997. Cytological alterations associated with an unidentified isomertric grapevine virus (UIGV), in: 12th Meeting of IGVG. Lisbon, pp. 31–32.
Flores, R., Hernández, C., Martínez De Alba, A.E., Daròs, J.A., Di Serio, F., 2005. Viroids and viroid-host interactions. Annual Review of Phytopathology 43, 117–139. https://doi.org/10.1146/annurev.phyto.43.040204.140243
Fuchs, M., 2020. Grapevine viruses: a multitude of diverse species with simple but overall poorly adopted management solutions in the vineyard. Journal of Plant Pathology. https://doi.org/10.1007/s42161-020-00579-2
Gambino, G., Navarro, B., Torchetti, E.M., La Notte, P., Schneider, A., Mannini, F., Di Serio, F., 2014. Survey on viroids infecting grapevine in Italy: Identification and characterization of Australian grapevine viroid and Grapevine yellow speckle viroid 2. European Journal of Plant Pathology 140, 199–205. https://doi.org/10.1007/s10658-014-0458-x
Gambino, G., Navarro, B., Vallania, R., Gribaudo, I., Di Serio, F., 2011. Somatic embryogenesis efficiently eliminates viroid infections from grapevines. European Journal of Plant Pathology 130, 511–519. https://doi.org/10.1007/s10658-011-9770-x
Garcia-Arenal, F., Pallas, V., Flores, R., 1987. The sequence of a viroid from grapevine closely related to severe isolates of citrus exocortis viroid. Nucleic Acids Research 15, 4203–4210.
Giampetruzzi, A., Roumi, V., Roberto, R., Malossini, U., Yoshikawa, N., La Notte, P., Terlizzi, F., Credi, R., Saldarelli, P., 2012. A new grapevine virus discovered by deep sequencing of virus- and viroid-derived small RNAs in Cv Pinot gris. Virus Research 163, 262–268. https://doi.org/10.1016/j.virusres.2011.10.010
Glasa, M., Predajňa, L., Komínek, P., 2011. Grapevine fleck virus isolates split into two distinct molecular groups. Journal of Phytopathology 159, 805–807. https://doi.org/10.1111/j.1439-0434.2011.01845.x
Glasa, M., Predajňa, L., Šoltys, K., Sabanadzovic, S., Olmos, A., 2015. Detection and molecular characterisation of Grapevine Syrah virus-1 isolates from Central Europe. Virus Genes 51, 112–121. https://doi.org/10.1007/s11262-015-1201-1
Glasa, M., Predajňa, L., Šoltys, K., Sihelská, N., Nagyová, A., Wetzel, T., Sabanadzovic, S., 2017. Analysis of grapevine rupestris stem pitting-associated virus in Slovakia reveals differences in intra-host population diversity and naturally occurring recombination events. Plant Pathology Journal 33, 34–42. https://doi.org/10.5423/PPJ.OA.07.2016.0158
Goheen, A.C., 1988. Rupestris stem pitting, in: Goheen, A.C., Pearsen, R.C. (Eds.), Compendium of Grape Diseases. APS Press, St. Paul, Minnesota, p. 53.
Gribaudo, I., Gambino, G., Cuozzo, D., Mannini, F., 2006. Attempts to eliminate Grapevine rupestris stem pitting-associated virus from grapevine clones. Journal of Plant Pathology 88, 293–298. https://doi.org/10.4454/jpp.v88i3.875
Habili, N., Farrokhi, N., Lima, M.F., Nicholas, P., Randles, J.W., 2006. Distribution of Rupestris stem-pitting-associated virus variants in two Australian vineyards showing different symptoms. Annals of Applied Biology 148, 91–96. https://doi.org/10.1111/j.1744-7348.2006.00041.x
Hajizadeh, M., Sokhandan-Bashir, N., Navarro, B., Di Serio, F., 2012. Grapevine Yellow Speckle-1 Type 4: A New Proposed Type of Grapevine Yellow Speckle-1, in: Proceedings of the 17th Congress of ICVG, Davis, California, USA. pp. 108–110.
Hewitt, W.B., Goheen, A.C., Raski, D.J., Gooding, G.V., 1962. Studies on virus diseases of the grapevine in California. Vitis 3, 57–83.
Hily, J.M., Beuve, M., Vigne, E., Demangeat, G., Candresse, T., Lemaire, O., 2018. A genome-wide diversity study of grapevine rupestris stem pitting-associated virus. Archives of Virology 163, 3105–3111. https://doi.org/10.1007/s00705-018-3945-0
Hu, J.S., Gonsalves, D., Teliz, D., 1990. Characterization of Closterovirus‐like Particles Associated with Grapevine Leafroll Disease. Journal of Phytopathology 128, 1–14. https://doi.org/10.1111/j.1439-0434.1990.tb04247.x
James, T., 2013. A Brief History of South African Wine to 1994, in: Wines of the New South Africa: Tradition and Revolution. University of California Press, pp. 23–47.
Jiang., D., Zhang., Z., Wu., Z., Guo., R., Wang., H., Fan., P., Li., S., 2009a. Molecular characterization of grapevine yellow speckle viroid -2. Virus Genes 2, 515–520. https://doi.org/10.1007/s11262-009-0338-1
Jiang, D., Peng, S., Wu, Z., Cheng, Z., Li, S., 2009b. Genetic diversity and phylogenetic analysis of Australian Grapevine Viroid (AGVd) isolated from different grapevines in China. Virus Genes 38, 178–183. https://doi.org/10.1007/s11262-008-0306-1
Jiang, D., Sano, T., Tsuji, M., Araki, H., Sagawa, K., Purushothama, C.R.A., Zhang, Z., Guo, R., Xie, L., Wu, Z., Wang, H., Li, S., 2012. Comprehensive diversity analysis of viroids infecting grapevine in China and Japan. Virus Research 169, 237–245. https://doi.org/10.1016/j.virusres.2012.08.008
Jo, Y., Song, M.K., Choi, H., Park, J.S., Lee, J.W., Lian, S., Lee, B.C., Cho, W.K., 2017. Genome sequence of grapevine Virus K, A Novel Vitivirus infecting grapevine. Genome Announcements 5, 9–10. https://doi.org/10.1128/genomeA.00994-17
Kofalvi, S.A., Marcos, J.! F., Canizares, M.C., Pallas, V., Candresse, T., 1997. Hop stunt viroid (HSVd) sequence variants from Prunus species : evidence for recombination between HSVd isolates, Journal of General Virology.
Koltunow, A.M., Krake, L.R., Johnson, S.D., Rezaian, M.A., 1989. Two related viroids cause grapevine yellow speckle disease independently. Journal of General Virology 70, 3411–3419. https://doi.org/10.1099/0022-1317-70-12-3411
Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7:Molecular Evolutionary Genetics Analysis Version 7.0 for bigger datasets. Molecular Biology and Evolution 33, 1870–1874.
La Notte, P., Pirolo, C., Bottalico, G., Campanale, A., Savino, V., 2006. Sanitary status and sanitation of local germplasm in southern Italy, in: 15th Meeting of ICVG. pp. 114–115.
Lima, M.F., Alkowni, R., Uyemoto, J.K., Golino, D., Osman, F., Rowhani, A., 2006. Molecular analysis of a California strain of Rupestris stem pitting-associated virus isolated from declining Syrah grapevines. Archives of Virology 151, 1889–1894. https://doi.org/10.1007/s00705-006-0742-y
Little, A., Rezaian, M.A., 2003. Grapevine viroids, in: Hadidi, A., Flores, R., Randles, J.W., Semancik, J.S. (Eds.), Viroids. CSIRO Publishing, pp. 195–201.
Lizirraga, R.E., Salazar, L.F., Roca, W.M., 1980. Elimination of Potato Spindle Tuber Viroid by Low Temperature and Meristem Culture. Disease Control and Pest Management 70, 754–755.
Martelli, G., Walter, B., 1998. Virus certification in grapevines, in: Hadidi, A., Khetarpal, R.K., Koganezawa, H. (Eds.), Plant Virus Disease Control. APS Press, St. Paul, Minnesota, pp. 261–276.
Martelli, G.P., 2017. An Overview on Grapevine Viruses, Viroids, and the Diseases They Cause, in: Meng, B., Martelli, G.P., Golino, G., Fuchs, M. (Eds.), Grapevine Viruses: Molecular Biology, Diagnostics and Management. Springer International Publishing, Cham, pp. 31–46. https://doi.org/https://doi.org/10.1007/978-3-319-57706-7_2
Martelli, G.P., 2014. Directory of virus and virus-like diseases of the grapevine and their agents. Journal of Plant Pathology 96, 1–136. https://doi.org/10.4454/jpp.v96i1sup.3143
Martelli, G.P., Abou Ghanem-Sabanadzovic, N., Agranovsky, A.A., Al Rwahnih, M., Dolja, V. V., Dovas, C.I., Fuchs, M., Gugerli, P., Hu, J.S., Jelkmann, W., Katis, N.I., Maliogka, V.I., Melzer, M.J., Menzel, W., Minafra, A., Rott, M.E., Rowhani, A., Sabanadzovic, S., Saldarelli, P., 2012. Taxonomic revision of the family closteroviridae with special reference to the grapevine leafroll-associated members of the genus ampelovirus and the putative species unassigned to the family. Journal of Plant Pathology 94, 7–19.
Martelli, G.P., Sabanadzovic, S., Ghanem-Sabanadzovic, N.A., Saldarelli, P., 2002. Maculavirus, a new genus of plant viruses. Archives of Virology 147, 1847–1853. https://doi.org/10.1007/s007050200046
Meng, B., Li, C., Wang, W., Goszczynski, D., Gonsalves, D., 2005. Complete genome sequences of two new variants of Grapevine rupestris stem pitting-associated virus and comparative analyses. Journal of General Virology 86, 1555–1560. https://doi.org/10.1099/vir.0.80815-0
Meng, B., Rowhani, A., 2017. Grapevine rupestris stem pitting-associated virus, in: Meng B, Martelli G, Golino D, F.M. (Ed.), Grapevine Viruses: Molecular Biology, Diagnostics and Management. Springer International Publishing, Cham, pp. 257–287.
Miljanić, V., Rusjan, D., Škvarč, A., Chatelet, P., Štajner, N., 2022. Elimination of Eight Viruses and Two Viroids from Preclonal Candidates of Six Grapevine Varieties (Vitis vinifera L.) through In Vivo Thermotherapy and In Vitro Meristem Tip Micrografting. Plants 11. https://doi.org/10.3390/plants11081064
Minafra, A., Mawassi, M., Goszczynski, D., Saldarelli, P., 2017. Grapevine Vitiviruses, in: Meng, B., Martelli, G.P., Golino, D.A., Fuchs, M. (Ed.), Grapevine Viruses: Molecular Biology, Diagnostics and Management. Springer International Publishing, Cham, pp. 229–256. https://doi.org/https://doi.org/10.1007/978-3-319-57706-7_2
Morelli, M., Zicca, S., Bottalico, G., Campanale, A., Calderaro, M., Donatelli, G., Saldarelli, P., Pirolo, C.S., Savino, V.N., La Notte, P., 2015. Virus infections and sanitation of ancient native grapevine cultivars from Apulia, in: Proceedings of the 18th Congress of ICVG. Ankara, Turkey, pp. 242–243. https://doi.org/10.13140/RG.2.1.4591.0486
Morgan, S.W., Read, D.A., Burger, J.T., Pietersen, G., 2023. Diversity of viroids infecting grapevines in the South African Vitis germplasm collection. Virus Genes 59, 244–253. https://doi.org/10.1007/s11262-023-01971-7
Mostert, I., Burger, J.T., Maree, H.J., 2018. Genetic diversity and identification of putative recombination events in grapevine rupestris stem pitting-associated virus. Archives of Virology 163, 2491–2496. https://doi.org/10.1007/s00705-018-3883-x
Naidu, R.A., 2017. Grapevine Leafroll-Associated Virus 1, in: Meng, B., Martelli, G.P., Golino, D.A., Fuchs, M. (Ed.), Grapevine Viruses: Molecular Biology, Diagnostics and Management. Springer International Publishing, Cham, pp. 127–139. https://doi.org/https://doi.org/10.1007/978-3-319-57706-7_2
Navrotskaya, E., Porotikova, E., Yurchenko, E., Galbacs, Z.N., Varallyay, E., Vinogradova, S., 2021. High-Throughput Sequencing of Small RNAs for Diagnostics of Grapevine Viruses and Viroids in Russia. Viruses 13, 1–19.
Oosthuizen, K., 2017. Characterising the viral and microbial diversity in old and young grapevines. MSc Thesis. Stellenbsoch University. Stellenbosch
Osman, F., Olineka, T., Hodzic, E., Golino, D., Rowhani, A., 2012. Comparative procedures for sample processing and quantitative PCR detection of grapevine viruses. Journal of Virological Methods 179, 303–310. https://doi.org/10.1016/j.jviromet.2011.11.008
Paduch‐Cichal, E., Kryczyński, S., 1987. A low temperature therapy and meristem-tip culture for eliminating four viroids from infected plants. Journal of Phytopathology 118, 341–346. https://doi.org/10.1111/j.1439-0434.1987.tb00465.x
Pappi, P.G., Efthimiou, K., Lotos, L., Katis, N.I., Maliogka, V.I., 2020. First report of grapevine hammerhead viroid - like RNA (GHVd) in grapevine in Greece. Journal of Plant Pathology 102, 257. https://doi.org/10.1007/s42161-019-00393-5
Polivka, H., Staub, U., Gross, H.J., 1996. Variation of viroid profiles in individual grapevine plants: novel grapevine yellow speckle viroid 1 mutants show alterations of hairpin I, Journal of General Virology.
Postman, J.D., Hadidi, A., 1995. Elimination of Apple Scar Skin Viroid by in vitro thermotherapy and apical meristem culture. Acta Horticulturae 386, 217–228. https://doi.org/10.1016/B978-0-12-801498-1.00021-8
Reuter, J.S., Mathews, D.H., 2010. RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics .
Reynard, J.S., Schneeberger, P.H.H., Frey, J.E., Schaerer, S., 2015. Biological, serological, and molecular characterization of a highly divergent strain of Grapevine leafroll-associated virus 4 causing Grapevine leafroll disease. Phytopathology 105, 1262–1269. https://doi.org/10.1094/PHYTO-12-14-0386-R
Rezaian, M. A., Koltunow, A.M., Krake, L.R., 1988. Isolation of three viroids and a circular RNA from grapevines. The Journal of general virology 69 (2), 413–422. https://doi.org/10.1099/0022-1317-69-2-413
Salman, T.M., Habili, N., Shi, B., 2014. Effect of temperature on symptom expression and sequence polymorphism of grapevine yellow speckle viroid 1 in grapevine. Virus Research 189, 243–247. https://doi.org/10.1016/j.virusres.2014.03.028
Sano, T., Ohshima, K., Hataya, T., 1986. A viroid resembling hop stunt viroid in grapevines from Europe, the United States and Japan. Journal of General Virology 67, 1673–1678. https://doi.org/10.1099/0022-1317-67-8-1673
Savitri, W.D., Park, K. Il, Jeon, S.M., Chung, M.Y., Han, J.S., Kim, C.K., 2013. Elimination of Chrysanthemum stunt viroid (CSVd) from meristem tip culture combined with prolonged cold treatment. Horticulture Environment and Biotechnology 54, 177–182. https://doi.org/10.1007/s13580-013-0141-8
SAWIS, 2021. South African Wine Industry Information and Systems 2021 Statistics NR 46.
Shi, B.J., Habili, N., Symons, R.H., 2003. Nucleotide sequence variation in a small region of the Grapevine fleck virus replicase provides evidence for two sequence variants of the virus. Annals of applied Biology, 142(3), pp.349-355.
Sidharthan, V.K., Sevanthi, A.M., Jaiswal, S., Baranwal, V.K., 2020. Robust Virome Profiling and Whole Genome Reconstruction of Viruses and Viroids Enabled by Use of Available mRNA and sRNA-Seq Datasets in Grapevine (Vitis vinifera L.). Frontiers in Microbiology 11. https://doi.org/10.3389/fmicb.2020.01232
Skiada, F.G., Grigoriadou, K., Maliogka, V.I., Katis, N.I., Eleftheriou, E.P., 2009. Elimination of grapevine leafroll-associated viurs-1 and grapevine Rupestris steam pitting-associated virus frm grapevine cv. agiorgitiko, and a micropropagation protocol for mass production of virus-free plantlets. Journal of Plant Pathology 91, 177–184.
Skiada, F.G., Maliogka, V.I., Katis, N.I., Eleftheriou, E.P., 2013. Elimination of Grapevine Rupestris stem pitting-associated virus (GRSPaV) from two Vitis vinifera cultivars by in vitro chemotherapy. European Journal of Plant Pathology 135, 407–414. https://doi.org/10.1007/s10658-012-0097-z
Szychowski, J.A., Credi, R., Reanwarakorn, K., Semancik, J.S., 1998. Population diversity in grapevine yellow speckle viroid-1 and the relationship to disease expression. Virology 248, 432–444. https://doi.org/10.1006/viro.1998.9292
Tangkanchanapas, P., Reanwarakorn, K., Juenak, H., De Jonghe, K., 2017. First report of Grapevine yellow speckle viroid-2 infecting grapevine ( Vitis vinifera ) in Thailand . New Disease Reports 36, 6. https://doi.org/10.5197/j.2044-0588.2017.036.006
Van Den Berg, N., Crampton, B.G., Hein, I., Birch, P.R.J., Berger, D.K., 2004. High-throughput screening of suppression subtractive hybridization cDNA libraries using DNA microarray analysis. BioTechniques 37, 818–824. https://doi.org/10.2144/04375rr02
Varveri, C., Maliogka, V.I., Kapari-Isaia, T., 2015. Principles for supplying virus-tested material, in: Advances in Virus Research. Academic Press Inc., pp. 1–32. https://doi.org/10.1016/bs.aivir.2014.10.004
White, E.J., Venter, M., Hiten, N.F., Burger, J.T., 2008. Modified cetyltrimethylammonium bromide method improves robustness and versatility: The benchmark for plant RNA extraction. Biotechnology Journal 3, 1424–1428. https://doi.org/10.1002/biot.200800207
Wu, Q., Wang, Y., Cao, M., Pantaleo, V., Burgyan, J., Li, W.X., Ding, S.W., 2012. Homology-independent discovery of replicating pathogenic circular RNAs by deep sequencing and a new computational algorithm. Proceedings of the National Academy of Sciences of the United States of America 109, 3938–3943. https://doi.org/10.1073/pnas.1117815109
Zhang, Y., Singh, K., Kaur, R., Qiu, W., 2011. Association of a novel DNA virus with the grapevine vein-clearing and vine decline syndrome. Phytopathology 101, 1081–1090. https://doi.org/10.1094/PHYTO-02-11-0034
Zhang, Z., Qi, S., Tang, N., Zhang, X., Chen, S., Zhu, P., Ma, L., Cheng, J., Xu, Y., Lu, M., Wang, H., Ding, S.W., Li, S., Wu, Q., 2014. Discovery of Replicating Circular RNAs by RNA-Seq and Computational Algorithms. PLoS Pathogens 10. https://doi.org/10.1371/journal.ppat.1004553
Zhong, X., Archual, A.J., Amin, A.A., Ding, B., 2008. A genomic map of viroid RNA motifs critical for replication and systemic trafficking. Plant Cell 20, 35–47. https://doi.org/10.1105/tpc.107.056606

Supplementary Tables 1 to 6 are not available with this version.

Download PDF

Version 1

posted

You are reading this latest preprint version

Next generation RNA sequencing analysis of nuclear grapevines to identify viruses and viroids

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Results

Discussion

Declarations

References

Supplementary Tables

Status:

Version 1