CRISPRi-Induced Transcriptional Regulation of IAH1 Gene and its Influence on Volatile Compounds Profile in Kluyveromyces marxianus DU3

doi:10.21203/rs.3.rs-3221845/v1

Download PDF

Research Article

CRISPRi-Induced Transcriptional Regulation of IAH1 Gene and its Influence on Volatile Compounds Profile in Kluyveromyces marxianus DU3

https://doi.org/10.21203/rs.3.rs-3221845/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 05 Mar, 2024

Read the published version in World Journal of Microbiology and Biotechnology →

You are reading this latest preprint version

Mezcal is a traditional Mexican distilled beverage, known for its marked organoleptic profile, which is influenced by several factors, such as the fermentation process, where a wide variety of microorganisms are present. Kluyveromyces marxianus is one of the main yeasts isolated from mezcal fermentations and has been associated with ester synthesis, contributing to the flavors and aromas of the beverage. In this study, we employed CRISPR interference (CRISPRi) technology, using dCas9 fused to the Mxi1 repressor factor domain, to down-regulate the expression of the IAH1 gene, encoding for an isoamyl acetate-hydrolyzing esterase, in K. marxianus strain DU3. The constructed CRISPRi plasmid successfully targeted the IAH1 gene, allowing for specific gene expression modulation. Through gene expression analysis, we assessed the impact of IAH1 down-regulation on the metabolic profile of volatile compounds. We also measured the expression of other genes involved in volatile compound biosynthesis, including ATF1, EAT1, ADH1, and ZWF1 by RT-qPCR. Results demonstrated successful down-regulation of IAH1 expression in K. marxianus strain DU3 using the CRISPRi system. The modulation of IAH1 gene expression resulted in alterations in the production of volatile compounds, specifically ethyl acetate, which are important contributors to the beverage's aroma. Changes in the expression levels of other genes involved in ester biosynthesis, suggesting possible regulatory interactions between these genes. The application of CRISPRi technology in K. marxianus opens the possibility of targeted modulation of gene expression, metabolic engineering strategies, and synthetic biology in this yeast strain.

CRISPRi

IAH1

Kluyveromyces marxianus

volatile compounds

Mezcal is a traditional distilled beverage obtained from different species of Agave and produced in some states of Mexico, mainly in Oaxaca (Nolasco-Cancino et al. 2018). The mezcal production process consists of: (1) harvesting the agave, (2) cooking the agave, (3) milling, (4) spontaneous or induced fermentation, and (5) the distillation process (De León-Rodríguez et al. 2008; Lappe-Oliveras et al. 2008; Kirchmayr et al. 2017). The organoleptic profile of mezcal is influenced by several factors, such as the species and origin of the agave plant, the initial agave juice sugar concentration, environmental conditions, and other factors released during the mezcal process (De León-Rodríguez et al. 2006; Vera-Guzmán et al. 2009,2012). During the fermentation process, native-microorganisms present may provide desirable flavors and aromas due to the generation of secondary metabolites, such as volatile organic compounds (VOCs; Lopez-Alvarez et al. 2012). The type of microorganisms present determines the type and concentration of VOCs, as well as their synthesis pathway (Escalante-Minakata et al. 2008).

Ethyl esters, acetate esters, fusel alcohols, carbonyls, and fatty acids are the main microbe-derived VOCs associated with the beverage's flavors and aromas (Swiegers et al. 2005; Cordente et al. 2012). In fermented beverages, the participation of yeasts has been associated with the production of esters, which contribute important organoleptic characteristics to the beverage (Lopez et al. 2014). Pichia spp, Saccharomyces cerevisiae and Kluyveromyces marxianus are the main yeasts isolated by mezcal fermentations and they have been associated with ester synthesis during the fermentation process (Segura-García et al. 2015; Arellano-Plaza et al. 2017; Nolasco-Cancino et al. 2018).

K. marxianus is an aerobic yeast with respiro-fermentative metabolism, rapid cell division, high thermotolerance, can ferment several types of sugars, has efficient compound secretion, and is relatively easy to genetically manipulate (Fonseca et al. 2007; Lane et al. 2011; Gombert et al. 2016; de la Torre-González et al. 2017; Cernak et al. 2018). This yeast produces ethanol under anaerobic conditions (Crabtree negative) and can produce other metabolites such as flavors and aromas under aerobic conditions. (Lane et al. 2011; Nambu-Nishida et al. 2017). The ability to produce several esters has been described in different strains of K. marxianus, including ethyl acetate, phenylethyl acetate and isoamyl acetate, whose precursors are ethanol, 2-phenylethanol and isoamyl alcohol, respectively (Gethins et al. 2014). Therefore, the biosynthesis of these compounds is going to be determined mainly by the presence of the respective alcohol, the availability of acetyl-CoA, as well as the expression and activity of alcohol acetyltransferase (AATase; Morrissey et al. 2015). Studies in K. marxianus have shown that the enzymes encoded by the ATF and EAT1 genes are the AATases in this yeast (Morrissey et al. 2015; Löbs et al. 2018).

The activity of ester-synthesizing enzymes and ester-hydrolyzing enzymes are related to the ester accumulation (Fukuda et al. 1998a). Several studies have reported on esterase function and ester accumulation in various yeasts. Lilly and collaborators (2006) found that overexpression of IAH1, which encodes an isoamyl acetate-hydrolyzing esterase, under the constitutive PGK1 promoter in a commercial wine strain of S. cerevisiae decreased the production of 2-phenylethyl acetate, ethyl acetate, hexyl acetate and isoamyl acetate, suggesting that the esterase activity from this gene influences the concentration of acetate esters. Dank et al. 2018 deleted the IAH1 gene of S. cerevisiae BY4742, which showed a higher relative abundance of acetate esters and even some medium-chain fatty acid ethyl esters compared to the wild-type. So far, there are only a few papers on the activity of this gene in K. marxianus. In a first study, the IAH1 gene of the K. marxianus strain CBS 6556 was deleted, and a slight increase in the concentration of 2-phenylethyl acetate and a slight decrease in the production of ethyl acetate and isoamyl acetate were detected; however, neither change was statistically significant (Löbs et al. 2018). Since information on the function of this esterase is minimal, it is necessary to know what role it plays in metabolic behavior and whether it is possible to regulate it to increase ester concentration. Further research is needed on all enzymes involved in the biosynthesis of esters in K. marxianus.

Gene inactivation is the principal approach to better understand and elucidate gene functions. In K. marxianus, it has been difficult to inactivate genes in isolated wild-type strains by using homologous recombination methods. Molecular genetic tools, such as CRISPR/Cas, have been implemented in K. marxianus to assess gene function (Löbs et al. 2017; Nambu-Nishida et al. 2017). The CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 (CRISPR-associated) system consists of a Cas9 endonuclease protein and an engineered small guide RNA (sgRNA) containing a complementary DNA-binding site, a Cas9-binding harpoon structure, and a transcription terminator. The Cas9 of Streptococcus pyogenes is guided by the sgRNA to complementary target DNA sequences adjacent to the respective Protospacer Adjacent Motif (PAM) sequence, causing double strand breaks in the DNA target (Doudna & Charpentier, 2014). This technology has been applicable in several industrial yeast strains, generating the modification of one or several genes simultaneously, without the introduction of a selection marker (Stovicek et al. 2015; Nambu-Nishida et al. 2018).

One metabolic engineering strategy employed in yeast has been the alteration of expression levels rather than complete gene inactivation or promoter swapping for overexpression of a target transcript. The use of a nuclease deficient Cas9 (dCas9), often fused to an activation or repression domain, has been used effectively to alter expression in both prokaryotes and eukaryotes (Smith et al. 2016; Wensing et al. 2019; Depardieu et al. 2020). This system is called CRISPR activation/interference (CRISPRa/i). dCas9 simply binds to a specific locus in the sgRNA-guided genome without cleaving DNA, modulating gene expression. CRISPR-based repression (CRISPRi) has been demonstrated using dCas9 or dCas9 fused to repressor domains such as KRAB (Krüppel associated box) or Mxi1 (Smith et al. 2016; Jensen, 2018). In yeasts, CRISPRi technology has been used to investigate specific differences in metabolite levels in response to gene modification (Löbs et al. 2018). The application of high throughput sequencing technologies, high throughput editing technologies, the use and management of data science and bioinformatics in yeast allows us to look to the future in the application of synthetic biology, and to design or redesign metabolic pathway modules of interest in this eukaryotic system (Pretorius & Boeke, 2018).

In this study, a CRISPRi plasmid was generated for altering gene expression in K. marxianus strain DU3. This strain isolated from traditional mezcal fermentation was chosen based on several physiological experiments that demonstrated high alcoholic fermentative capacity (Flores et al. 2013; Lopez et al. 2014) and ester production in different media (Segura-García et al. 2015). The expression of the IAH1 gene of K. marxianus was down-regulated via knockdown by means of CRISPRi system, and its impact on the metabolic profile of volatile compounds was determined by gas chromatography. In addition, the expression of genes involved in the volatile compound's biosynthesis, such as ATF1, EAT1, ADH1, and ZWF1, were measured.

Strains and culture media

Kluyveromyces marxiuanus strain DU3 (KmDU3) was isolated from mezcal fermentation of Oaxaca state, Mexico. This strain belongs to the strain collection of Research Center and Assistant in Technology and Design of Jalisco State (CIATEJ). KmDU3 was growth in liquid and solid YPD media (10 g L^-1 yeast extract, 20 g L^-1 peptone, and 20 g L^-1 glucose). YPD medium supplemented with 300 µg mL^-1 G418 (Sigma-Aldrich) was used for KmDU3 transformation selection. Defined mineral medium reported for Flores-Cosio et al. 2018 was used for the cultivation of the CRISPRi strains with 50 g L^-1 glucose and 300 µg m L^-1 of geneticin (G418, Sigma Aldrich, A1720). The medium was adjusted to pH 4.5.

Escherichia coli strain DH10β was used as a host for cloning and plasmid propagation. E. coli was grown at 37 °C in Luria Bertani (LB) medium (10 g L^-1 tryptone, 5 g L^-1 yeast extract, and 5 g L^-1 sodium chloride) containing 100 mg L^-1 ampicillin.

Genome sequencing, assembly and annotation

Genomic DNA was extracted from an overnight culture of KmDU3 using the Wizard Genomic DNA Purification Kit (Promega, USA). The genome of KmDU3 was sequenced by illumina and Oxford Nanopore sequencing technologies. For Illumina, a library of 100-pb paired-end reads was generated and sequenced on an HiSeq 2000 platform (Macrogen, Inc.). Data integrity and read quality distribution was evaluated with FastQC v0.11.9 software (Andrews et al. 2010). Then, low-quality bases and regions were removed by using Trimmomatic v0.38 (Bolger et al. 2014). For Oxford Nanopore Technologies (Oxford, UK), the library was constructed using the Rapid Barcoding Sequencing kit (SQK-RBK004) and using a FLOMIN 106 flow cell. The raw FAST5 data were basecalled using guppy basecalling program v6.3.8+d9e0f64, GPU-enabled (Oxford Nanopore Technologies) and the adaptor sequences were removed by guppy barcoding script. Low quality reads and contaminant reads were filtered out by Nanofilt v2.8.0 (De Coster et al. 2018) and Filtlong v0.2.1 (Wick, 2017) softwares.

Long clean reads generated by the nanopore sequencing platform were assembled by Flye v2.9.1 software (Kolmogorov et al. 2019) using default parameters. The resulting assembly was polished by mapping the clean reads back against the Flye draft assembly using minimap2 v2.24 (Li, 2018) to self-correct, and using the mapping files as input to Racon v1.5.0 (4X corrections, Vaser et al. 2017) and Medaka v1.6.0 (https://github.com/nanoporetech/medaka). We performed a second sequence correction of the assembly with the Illumina data using Pilon v1.23 software (Walker et al. 2014), resulting in 359x of coverage evidence. The sequence alignment between genome assembly and Illumina reads was performed with Bowtie 2 (Langmead & Salzberg, 2012). The final assembly was used to construct scaffolds with RagTag (Alonge et al. 2022) using K. marxianus DMKU3-1042 genome as a reference.

The assembled genome was annotated with Funannotate v.1.8.14 (Palmer & Stajich, 2022), using the RNAseq data as evidence of transcription, and adding functional information with InterproScan5 v.5.22.61.0 (Jones et al. 2014), and EggNog (Huerta-Cepas et al. 2014).

Plasmid construction

The CRISPRi vector and the primers for the subcloning processes were designed with the NEBuilder Assembly Tool v1.12.19 from New England BioLabs (NEB). Cloning process was performed using restriction enzymes (NEB, Sigma, abm) and Gibson-type assembly (Gibson et al. 2009) with Gibson HiFi DNA Assembly Master Mix (NEB). The assembled plasmids were transformed into E. coli DH10β by electroporation using the MicroPulser kit (Bio-Rad) 0.2 cm cells. Plasmid purification from E. coli was performed using the PureYield^TMPlasmid Miniprep System kit (Promega). All plasmids and primers used are listed in Supplementary Table 1 and 2. The oligonucleotides were synthesized by Integrated DNA Technologies, Inc. (IDT; www.idtdna.com) and ADN ARTIFICIAL S. de R.L. de C.V. (https://t4oligo.com). All the amplifications of regions of interest were performed by endpoint PCR with the SimpliAmp^TMthermal cycler (Applied Biosystems), using the Q5 High fidelity DNA polymerase (NEB).

The CRISPR-dCas9 plasmid was constructed using pRS410 (Addgene #11258) containing the KanMX selection marker used for cloning selection in prototrophic yeast (Vickers et al. 2013; Walker et al. 2003). This plasmid was digested with the restriction enzymes Psp5II and PfoI. The CEN6/ARS1 cassette was amplified from pIW601-KmCRISPR (Addgene, #98907) using primers ARS1_F and ARS1_R, generating the plasmid named pMZ18-ARS. To express the catalytically inactive dCas9 fused with the repressor factor domain Mxi1, the Tef1p-dCas9-Mxi1-Cyct cassette was amplified from pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA plasmid (Addgene #73796) using primers FW_4 and RV_4. The structural guide RNA containing a KmRPR1-tRNA^Gly promoter, structural guide RNA and Supt was amplified from pIW601-KmCRISPR using primer FW_1-3, FW_1-4, FW_2-3, FW_2-4 and RV_2, which contain the two different IAH1 target sequences (Supplementary Fig. 1). The reverse primer of the promoter fragment and the forward primer of the sgRNA fragment were exchanged with the two different IAH1 target sequences (Supplementary Fig. 2). The pMZ18-ARS was cut with XhoI and XbaI, and the dCas9-Mxi1 and sgRNA fragments were inserted by Gibson assembly, generating two plasmids with different sgRNAs (pMZ18-KmdCas9-g1 y pMZ18-KmdCas9-g2). Verification of plasmid construction was performed by PCR using the primers listed in Supplementary Table 2. A detailed plasmid map is presented in Fig. 1a.

Fig. 1

Design of sgRNAs of the IAH1 target gene

The nucleotide sequence of IAH1 from the reference strain K. marxianus DMKU3-1042 was retrieved from NCBI ''Nucleotide'' database, to search for its orthologs into the assembled KmDU3 genome by local alignment. Once located, sequences of ~300 nucleotides upstream of the open reading frame (ORF) of the gene were recovered to analyze the promoter sequences using YeastTSS program (McMillan et al. 2019) and using Kluyveromyces lactis as a reference. The Clustal Omega tool (Sievers and Higgins, 2014) was used to detect regulatory elements in the IAH1 promoter of KmDU3.

The specific 20-bp targeting sequences with 3’-adjacent PAM sequences were selected from the K. marxianus genome using CRISPRdirect software (Naito et al. 2015). The two sgRNA were designed near the start codon of IAH1 gene to achieve maximum silencing efficiency, following Smith et al. 2016 recommendations. The target sequences were checked for uniqueness within the KmDU3 genome by local blast. The secondary structure of the sgRNAs were analyzed with RNAfold WebServer (Lorenz et al. 2011).

Transformation of K. marxianus

Plasmid transformations were performed using a previously reported protocol (Löbs et al. 2017) with the following modifications (McMillan, 2019). KmDU3 was grown in YPD broth overnight. 1 mL KmDU3 cell was harvested by centrifugation at 5000 rpm for 1 min. After washing twice with 1 mL of Tris-EDTA 1X and 0.1 M of lithium acetate (TE/LiAc), cells were resuspended in 100 µg carrier DNA (salmon sperm DNA) and 500 ng of plasmid. 500 µL of transformation mix (40 % polyethylene glycol 3350, 0.1 M lithium acetate, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 70 mM DTT) was added, and the solution was incubated at room temperature for 15 min. Subsequently, the transformation mix was heating shock at 47 °C for 15 min. The mix was centrifuged at 5000 rpm for 1 min, and the cells were resuspended in 1 mL of YPD broth and incubated for 2 h. Then, the 1 mL of resuspended cells were diluted with 9 mL of YPD medium (1:10 dilution) and incubated at 30 °C for 16 h with shaking. Finally, the cells were then centrifuged and resuspended in 1 mL of YPD broth. 100 µL of this resuspended cell was inoculated in solid YPD medium supplemented with 300 μg mL^-1 geneticin G418.

Fermentation system and volatile compounds quantification

Both yeast cells, each transformed with a different plasmid, were inoculated into defined mineral (DM) medium supplemented with 300 µg mL^-1 G418. Wild-type yeast was inoculated in the same medium without G418. These cultures were carried out at 30 °C for 24h in constant stirring (200 rpm). Samples of these cultures were taken during fermentation at 6 and 24 h in triplicate to measure cell growth, sugar consumption, volatile compounds and RNA extraction.

The cell density was analyzed by dry weight (g). Sugar consumption was determined by DNS (dinitrosalicylic acid) method (Miller, 1959). Gas chromatography was used for volatile compounds quantification using a Head-Space Sampler (HSS Model 7694 E, Hewlett Packard, Agilent Technologies, Palo Alto, CA, USA) coupled to a gas chromatograph (GC Hewlett Packard 6890, Agilent Technologies, Palo Alto, CA, USA), using a flame ionization detector (FID) and HP-INNOWAX column (60m x 0.32mm x 0.25 mm). Program conditions were used as reported by Méndez-Zamora 2020.

RNA extractions and cDNA synthesis

RNA extraction for both the control and the two transformed cultures was performed with TRIzol reagent (Invitrogen, cat. 15596026 and 15596018), according to the protocol described by Chomczynski, 1993. The concentration and purity of the RNA was confirmed by spectrophotometry in a NanoDrop One (Thermo Scientific). The integrity and quality of the total RNA was verified by electrophoresis on 1 % agarose gel stained with Viva SybrGreen Nucleic Acid Stain (Vivantis). Genomic DNA was digested with DNase I Amplification Grade (Sigma-Aldrich, Cat. AMPD1) using 1000 ng of RNA from each sample. Subsequently, it was retrotranscribed to cDNA with the GoScript™ Reverse Transcriptase (Promega, Cat. A5000) using 250 ng of RNA from each sample. Upon completion of retrotranscription, all samples were quantified and diluted to the same concentration.

RT-qPCR and expression level quantification

Gene regulation of the IAH1 gene was evaluated by Real-time quantitative PCR (RT-qPCR), as well as the expression of other genes related to ester production (ATF1, EAT1) and targeting of metabolic pathways (ZWF1 and ADH1). These genes were searched for homology in our annotated genome.

RT-qPCR analysis was conducted with the Applied Biosystems Step One Real-Time PCR System using Maxima SYBR Green/ ROX qPCR Master Mix (Thermo Scientific, K0221) according to the manufacturer’s instructions. Each sample was analyzed twice, and a non-template control for each primer set was included. For the qPCR reaction, all genes were amplified in 25 µL reactions that contained 6.5 µL Maxima SYBR Green/ ROX qPCR Master Mix, 1 µL of template (1:4 diluted cDNA), 0.25 µL of each primer (10 µM) and 4.5 µL of sterile distilled water. The thermal cycling conditions were as follows: cDNA was heated to 95 °C for 10 min for enzyme activation followed by 40 cycles of 30 s at 95 °C, and 60 s at 60 °C. The actine 1 (ACT1) gene was used as the reference gene. The relative expression levels of each gene were calculated using the 2^{− ΔΔCt}method (Livak & Schmittgen 2001). All primers used for RT-qPCR are listed in Supplementary Table 2.

Statistical analysis

A two-tailed unpaired T-test was performed for comparison between two samples, with a difference at P < 0.05 considered significant. One-way ANOVA with a Tukey's post hoc test was performed for analysis of groups of samples and was considered significant at P < 0.05. Samples of the wild type and the two mutant strains of KmDU3 were further analyzed using Principal Component Analysis (PCA) using the statistically significant data at P < 0.05. Statistical analysis of the data was performed with GraphPad Prism software. Graphical representations were depicted in R v3.4.4 (R Core Team 2017) using the ggplot2 package (Wickham, 2016), and edited in Inkscape v0.91 software (www.inskcape.org).

Whole genome de novo assembly of K. marxianus DU3

For the K. marxianus DU3 genome assembly, a total of 146.33 Mb of long reads and 3.25 Gb of short reads were generated. The assembled genome had a coverage of 13x with ONT reads and 359x with Illumina reads. The clean genome assembly resulted in a 10.84 Mb with 45 contigs (contig N50 length of 662 Kb; the longest contig length was 1.02 Mb). From the scaffolding process, the contigs were anchored to the 8 chromosomes and the mitochondrial chromosome of K. marxianus DMKU-1042, with a total 10.82 Mb, resulting in 14 scaffolds (scaffold N50 length of 1.40 Mb; the longest scaffold length of 1.69 Mb; Table 1). 5168 protein-coding genes were predicted, with an average number of exons per gene of 1.96, although 4969 of the transcripts were single exons. The gene models were supported by 92.73% RNA-Seq data derived from samples of K. marxianus on the same culture medium.

Table 1

Genome assembly and gene prediction of *K. marxianus* DU3
Genome assembly
No. Of scaffolds	14
Total length (Mb)	10.82
Scaffold N50 length (Mb)	1.40
Longest scaffold length (Mb)	1.69
GC content (%)	40.08
Gene Prediction
No. of genes	5308
mRNA genes	5168
tRNA genes	160
Average gene length (bp)	1635
Multiple exon transcript	199
Single exon transcript	4969
Average exon length (bp)	668
Average protein length (aa)	477
Homology-based functional annotation
GO terms	3508
InterproScan	4526
EggNog	4987
Pfam	4177
CAZYme	103
Merops	163
BUSCO	1240
Secretion	221

Table 1

sgRNA design of K. marxianus genome

Predictions of sgRNAs were performed 300 bp upstream of the transcription start site (TSS) of IAH1 gene on the CRISPR direct platform using the genome of K. marxianus strain DMKU3-1042 as a reference. Two sgRNAs were selected that had not computationally predicted off-targets and targeted single-copy regions with identical sequences in the KmDU3 genome (Table 2). sgRNA1 localizes near the TATA box and sgRNA2 near the TSS (Fig. 1b, c). The secondary structure of both sgRNAs showed the 20 bp of the 5' end free for DNA binding and the tracrRNA sequence form the stem-and-loop structures necessary for dCas9 binding.

Table 2

sgRNAs sequences of *IAH1* gene
sgRNAs	Strand	Sequence 5’ − 3’	sgRNA position
sgRNA1	+	CTGACAGTACACGGCAACTAAGG	-15 to -34
sgRNA2	+	TATTGAGGGTAACAGTCTTGAGG	-191 to -210
^{*Nucleotides in bold type are PAM sequences}

Table 2

Plasmid system for CRISPR interference in Kluyveromyces marxianus

We designed and constructed a plasmid for regulatable CRISPRi in KmDU3 isolated from mezcal fermentation without genetics modifications (Fig. 1a). The plasmid is a derivate of pRS410, which contains a KanMX selectable marker, which was used in this yeast (Nambu-Nishida et al. 2018). To this backbone, we changed a S. cerevisiae centromeric origin of replication for an endogenous autonomous replication sequence (ARS) from K. marxianus obtained from pIW601-KmCas, since it has been proven that the plasmid sequence belonging to S. cerevisiae has been found not to function in replicating plasmids in K. marxianus strains (Nonklang et al. 2008). This sequence has 94.5% identity with the sequence of KmDU3 (data not shown). Then, we assembled the complete open reading frame for catalytically inactive S. pyogenes Cas9 (dCas9) coupled to the transcriptional repressor Mxi1 at C-terminus. These regions are constitutively expressed from the TEF1 promoter belonging to S. cerevisiae, which has been observed to be a functional promoter in K. marxianus (Lee et al. 2013). These sequences were amplified by pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA plasmid which was used in CRISPRi in S. cerevisiae (Smith et al. 2016). As for the sgRNA region, a native and hybrid RNA polymerase III (RPR1-tRNA^Gly) promoter was obtained from plasmid pIW601-KmCas, which was used in the expression of sgRNAs in K. marxianus strain CBS6556 (Löbs et al. 2017). Plasmid construction was verified by PCR fragments (Fig. 2).

Figure 2

Effect of CRISPRi system on VOC profile

To investigate the function of IAH1, the IAH1 gene regulations were done by CRISPRi system. We obtained two IAH1 mutants, M1KmDU3 and M2KmDU3. The mutant's strains caused a significant reduction in the expression of IAH1 (Fig. 3). Knockdown efficiency ranged from 62.45–63.6% with M1KmDU3 and 82–60% with M2KmDU3 at 6 and 24 h, respectively. The generated IAH1 mutant's strains and the wildtype were inoculated into the DM medium for 24 h. The mutant's strains showed increased growth, ethanol, and glucose consumption relative to the control WT strain (Fig. 4). To investigate the effects of IAH1 on the synthesis of volatile compounds in KmDU3, the supernatant of the DM medium was recovered for gas chromatographic analysis of 1-butanol, isoamyl alcohol, ethanol, phenylethyl acetate, butyl acetate, ethyl acetate and acetaldehyde. Screening revealed that IAH1 knockdown significantly changes the VOC profile in the mutant strains (Table 3, Fig. 5). The principal Component Analysis (PCA) of the GC-MS data and the glucose consumption sought to define the relationship between VOCs compounds and the two mutants and the WtKmDU3 (Fig. 5). Three distinct groups were identified within the samples. The first group (pink circle) comprised solely the WtKmDU3 samples, which featured high ethyl acetate and acetaldehyde. The second group (blue circle) and the third (yellow circle) comprised the M1KmDU3 and M2KmDU3, respectively. These groups are interconnected and are notable for their ethanol, sugar consumption, butanol, isoamyl alcohol, ethyl butyrate, and phenylethyl acetate content.

Table 3

Volatile compounds concentrations in WtKmDU3 and the two mutans M1KmDU3 and M2KmDU3
Volatile compounds	Time (h)	Wt KmDU3	M1 KmDU3	M2 KmDU3	P
Ethanol (g/L)	6	52.88 ± 15.16	190.24 ± 18.58	127.30 ± 5.06	< 0.0001*
Ethanol (g/L)	24	161.27 ± 5.40	184.66 ± 5.16	179.57 ± 20.61	0.136
1-Butanol (mg/mL)	6	20.574 ± 4.616	47.218 ± 5.379	36.272 ± 2.124	0.001^§
1-Butanol (mg/mL)	24	47.984 ± 2.395	59.430 ± 4.576	63.083 ± 8.056	0.036^Ω
Isoamyl alcohol (mg/mL)	6	30.760 ± 7.215	60.044 ± 7.320	46.719 ± 3.302	0.004^Ψ
Isoamyl alcohol (mg/mL)	24	71.932 ± 4.315	71.311 ± 2.916	73.889 ± 9.486	0.873
Acetaldehyde (mg/mL)	6	9.188 ± 4.374	14.437 ± 1.381	11.183 ± 0.872	0.132
Acetaldehyde (mg/mL)	24	319.266 ± 4.520	230.169 ± 74.858	233.662 ± 46.519	0.129
Ethyl acetate (mg/mL)	6	109.796 ± 33.427	70.593 ± 6.102	82.403 ± 0.331	0.116
Ethyl acetate (mg/mL)	24	382.967 ± 16.726	56.933 ± 10.436	88.387 ± 19.080	< 0.0001^χ
Ethyl butyrate (mg/mL)	6	1.576 ± 0.542	5.376 ± 0.471	3.162 ± 0.120	< 0.0001^†
Ethyl butyrate (mg/mL)	24	5.784 ± 0.388	5.566 ± 0.656	6.926 ± 0.555	0.046‡
2-Phenylethyl acetate (mg/mL)	6	2.063 ± 0.131	1.838 ± 0.246	1.570 ± 0.194	0.058
2-Phenylethyl acetate (mg/mL)	24	0.000 ± 0.000	0.000 ± 0.000	0.000 ± 0.000	1.000
^{*Wt vs M1 p = 0.0001, Wt vs M2 p = 0.002, M1 vs M2 p = 0.004;§Wt vs M1 p = 0.001, Wt vs M2 p = 0.009, M1 vs M2 p = 0.043;ΩWt vs M2 p = 0.036;ΨWt vs M1 p = 0.003, Wt vs M2 p = 0.046;χWt vs M1 p = 0.0001, Wt vs M2 p = 0.0001;†Wt vs M1 p = 0.0001, Wt vs M2 p = 0.009, M1 vs M2 p = 0.002;‡M1 vs M2 p = 0.05. Between−group comparisons were performed using Tukey's HSD as a post hoc test}

Figure 3 and Table 3

A decrease in ethyl acetate quantification of 35.7 and 89.1% with M1KmDU3 and 24.9 and 76.9% with M2KmDU3 was observed at 6 and 24h, respectively, compared to the WtKmDU3. In ethyl butyrate production, 3.4- and 2.0-fold increases were observed in the M1KmDU3 and M2KmDU3, respectively with respect to WtKmDU3 at 6h, but a significant difference remained only in M2KmDU3 at 24h. As for phenylethyl acetate ester, production was only observed at 6h with no differences between strains. In the production of alcohols, we observed a higher quantification of ethanol and isoamyl alcohol at 6h with both mutants, with respect to WtKmDU3, but there was no difference at 24h. As for 1-butanol, we observed a significant accumulation in the mutants at 6 and 24 h. 2.3- and 1.2-fold increase was observed in M1KmDU3 and 1.8- and 1.31-fold increase in M2KmDU3 with respect to WtKmDU3 at 6 and 24h, respectively. In addition, a significant accumulation of acetaldehyde was observed in both mutants at 6 h, but no differences were observed at 24 h (Table 3, Fig. 6).

Figure 4

To identify the enzymatic pathways responsible for ester production in KmDU3 (Fig. 6), we analyzed the expression of several genes by RT-qPCR: the AATases EAT1 and ATF1, whose enzymes have been associated with ester production; alcohol dehydrogenase gene 1 (ADH1) and glucose-6-phosphate dehydrogenase gene (ZWF1) for redirection of the metabolic pathway. No significant differences were observed in the expressed genes. In EAT1 and ATF1 genes we observed a slight decrease in expression in the mutant strains with respect to Wt at 6 h, but it looks almost the same at 24 h. Regarding ADH1 gene expression, we could not observe any quantification in the mutant strains at 24 h. As for the ZWF1 gene, no change in expression was observed at the two sampling points (Fig. 7).

Figure 5

In this study, we successfully developed a CRISPRi system to modulate transcription in an industrial K. marxianus strain isolated from mezcal. We evaluated the CRISPRi system by altering the expression of IAH1 gene using dCas9 fused to repressor domain Mxi1. IAH1 encodes an isoamyl acetate-hydrolyzing esterase (Fukuda et al. 1998a). The ester yield in yeasts depends on the AATase activity, substrate availability (acetyl-CoA and fusel alcohol) and ester hydrolysis (Saerens et al. 2008; van Rijswijck et al. 2019). Ester synthesis has been studied mainly in the conventional yeast S. cerevisiae (Saerens et al. 2010). The function of IAH1 is related with the hydrolysis of isoamyl acetate (Fukuda et al. 1998a). The knockout of this gene increases the acetate esters and even some medium-chain fatty acid ethyl esters compared to the wild-type (Dank et al. 2018), and its overexpression decreases of acetate esters (Lilly et al. 2006). Here, knockdown in the IAH1 by the CRISPR-dCas9-Mxi1 system (Fig. 3) led to changes in VOC profile in KmDU3 (Table 3, Fig. 6). Given the decrease in ethyl acetate production in IAH1 mutants (Table 3, Fig. 6), would be explained by the IAH1 could have an ester synthase activity, as hypothesized by other authors (Kallel-Mhiri & Miclo, 1993; Fukuda et al. 1998a; Vidal et al. 2013; Löser et al. 2014; Löbs et al. 2017) or that other possible esterases are activated under these conditions (Saerens et al. 2010). It has been observed that the balance between AATases and esterases affects the accumulation of acetate esters (Fukuda et al. 1998b; van Rijswijck et al. 2019). According to the findings of Dank et al. (2018), it is suggested that the removal of the IAH1 and TIP1 genes in S. cerevisiae results in an intracellular metabolite imbalance, triggering a regulatory response in the cells. This response may lead to the rewiring of metabolic pathways, a decrease in ester substrates, a reduction in ester synthase activity to compensate for the decreased hydrolyzing activity, or an upregulation of promiscuous esterases.

Figure 6

As for K. marxianus, little information is available on enzymes involved in ester synthesis. Deletion of ester related gene IAH1 in K. marxianus strain 6556 decreases the ethyl and isoamyl acetate and increases the 2-phenylethyl ester (Löbs et al. 2018). Furthermore, in this same article, the deletion of the ATF1 and EAT1 gene decreases the production of ethyl acetate, isoamyl acetate and 2-phenylethyl acetate, although the deletion of the EAT1 gene decreases the production of these esters by more than 87%, leading to an accumulation of ethanol and acetaldehyde. This is evidence that these enzymes may be involved in ester production, although the role of atfp is questionable in terms of ester production in K. marxianus and other non-Saccharomyces yeasts (Gethins et al. 2014; Kruis et al. 2017). EAT1 and ATF1 expression of the mutants was slightly lower than that of the wild type (Fig. 7), suggesting that the negative regulation in IAH1 expression could generate an imbalance with respect to ester accumulation, which is related to the increase in ethanol and acetaldehyde from time 6 h onwards (Table 3, Fig. 6). This is linked to the expression of the ADH1 gene (Fig. 7), which codes for the enzyme alcohol dehydrogenase 1, involved in alcohol production (Lertwattanasakul et al. 2015; Löbs et al. 2017).

Figure 7

The knockdown expression of IAH1 in both mutants at 6 h showed an increase in the production of ethyl butyrate, which is an ethyl ester of medium chain fatty acid (Table 3, Fig. 6). Dank et al. (2018) also showed an increase in MCFA ethyl esters, which the said authors hypothesize that IAH1 may have promiscuous activity on these esters, resulting in a redirection of intracellular fluxes of amino acid catabolism intermediates to MCFA ethyl esters. These assertions were supported by other authors (Rossouw et al. 2008; Notebaart et al. 2014). This is because it has been studied in S. cerevisiae that the synthesis and hydrolysis of MCFA ethyl esters are due to other enzymes encoded by the EEB1 and EHT1 genes (Saerens et al. 2006). The increase of 1-butanol in the mutant strains is linked to the production of ethyl butyrate as they possess the same synthesis intermediate butyryl-CoA (Azambuja et al. 2020; Ma et al. 2020), although the synthesis of these molecules has not been studied in K. marxianus. In addition, no changes in ZWF1 expression were observed in the mutants with respect to WtKmDU3, so it would be thought that all three strains follow the same glucose catabolic pathway to ethanol production with no apparent shift of the mutants toward the pentose phosphate pathway (Varela et al. 2012; Heinisch et al. 2020).

These results demonstrated successful down-regulation of IAH1 expression in KmDU3 using the CRISPRi system. The modulation of IAH1 gene expression resulted in alterations in the production of volatile compounds, specifically acetate esters, which are important contributors to the beverage's aroma. Further analysis revealed changes in the expression levels of other genes involved in ester biosynthesis, suggesting potential regulatory interactions between these genes. This study provides insights into the function of the IAH1 gene and its role in ester metabolism in K. marxianus. The application of CRISPRi technology in K. marxianus opens up possibilities for targeted gene expression modulation and metabolic engineering strategies in this yeast strain. Understanding the molecular mechanisms underlying volatile compound biosynthesis in K. marxianus will contribute to the optimization of mezcal production and the development of tailored flavor profiles in fermented beverages.

Data availability The complete KmDU3 genome sequence has been deposited in the National Center of Biotechnology Information (NCBI) database with the accession number JAQIJY000000000. The raw reads obtained from the Oxford Nanopore Sequence and Illumina Sequences used to assemble the KmDU3 genome were deposited in the NCBI - Sequence Read Archive (SRA) under the BioProject ID PRJNA909832. RNA-Seq data supporting the genomic annotation of KmDU3 are not openly available for reasons of sensitivity of another publication and can be requested from the corresponding author.

Acknowledgments The authors thank Dr. Cesar Arturo Nava Valdivia and M. en C. Martin Zermeño Ruíz (Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara) for the space and technical assistance during the RT-qPCR experiments.

Funding The present work was financed by the CONAHCYT Basic Science fund with project number 252465, with the title "Study of ester production by non-Saccharomyces yeasts with a multidisciplinary approach".

Non-financial interests: none.

Conflict of interest The authors declare that they have no conflict of interest.

Author information

Authors and Affiliations

Unidad de Biotecnología Industrial, Centro de Investigación y Asistencia en Tecnología y Diseño del Estado de Jalisco A.C. (CIATEJ), Zapopan, Jalisco, México.

Luis A. Muñoz-Miranda, Andrea C. Zepeda-Peña, Leticia Casas-Godoy, Andrés Méndez-Zamora, Iliana del Carmen Barrera-Martínez, Anne Christine Gschaedler-Mathis & Luis J. Figueroa-Yáñez

Departamento de Microbiología y Patología, Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara, Guadalajara, Jalisco, México.

Luis A. Muñoz-Miranda

Investigadores por México, Consejo Nacional de Ciencia y Tecnología, Ciudad de México, México.

Leticia Casas-Godoy, Alejandro Pereira-Santana, & Iliana del Carmen Barrera-Martínez

Centro de Investigación y Asistencia en Tecnología y Diseño del Estado de Jalisco. Subsede Sureste, Parque Científico Tecnológico de Yucatán, Mérida, Yucatán, México.

Alejandro Pereira-Santana

Unidad de Biotecnología, Centro de Investigación Científica de Yucatán, Mérida, Yucatán, México.

Luis Carlos Rodríguez-Zapata

Corresponding author

Correspondence to Luis J. Figueroa-Yáñez

Author identification

LAMM (0000-0003-3964-7170), ACZP (0000-0003-1714-0213), APS (0000-0001-7714-9485), LCG (0000-0002-0566-5824), AMZ (0000-0003-2725-0125), ICBM (0000-0001-5391-6299), LCRZ (0000-0002-4872-8231), ACGM (0000-0003-4372-7317), LJFY (0000-0002-7283-8035).

Author contributions Conceptualization: [LJFY]; Methodology: [LAMM, ACZP, ACGM, AMZ, APS, LCG, ICBM]; Formal analysis [APS, LAMM, AMZ, LJFY]; Data curation [APS, LAMM]; Investigation: [LAMM, ACZP, ACGM, AMZ]; Funding acquisition: [ACGM]; Resources: [ACGM, LJFY, LCG, ICBM, LAMM, APS]; Supervision: [ACGM, LJFY]; Software [APS, LAMM]; Validation [LAMM, LJFY]; Visualization [LAMM]; Project administration [LJFY, ACGM]; Writing - original draft preparation: [LAMM]; Writing - review and editing: [LAMM, ACZP, ACGM, AMZ, APS, LCG, ICBM, LCRZ].

Alonge M, Lebeigle L, Kirsche M. et al. (2022). Automated assembly scaffolding using RagTag elevates a new tomato system for high-throughput genome editing. Genome Biol 23:258. https://doi.org/10.1186/s13059-022-02823-7.
Andrews S. (2010). FastQC: a quality control tool for high throughput sequence data [Online]. http://www.bioinformatics.babraham.ac.uk/projects/fastqc/.
Arellano-Plaza M, Noriega-Cisneros R, Clemente-Guerrero M, González-Hernández JC, Robles-Herrera PD, Manzo-Ávalos S, Saavedra-Molina A, Gschaedler-Mathis A. (2017). Fermentative capacity of Kluyveromyces marxianus and Saccharomyces cerevisiae after oxidative stress. J. Inst. Brew 123:519–526. https://doi.org/10.1007/s11274-013-1291-7.
Azambuja SPH, Goldbeck R. (2020). Butanol production by Saccharomyces cerevisiae: perspectives, strategies and challenges. World journal of microbiology & biotechnology, 36(3):48. https://doi.org/10.1007/s11274-020-02828-z.
Bolger AM, Lohse M, Usadel B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30:2114–20. https://doi.org/10.1093/bioinformatics/btu170.
Cernak P, Estrela R, Poddar S, Skerker JM. (2018). Engineering Kluyveromyces marxianus as a robust synthetic biology platform host. MBio 9(5):e01410-18. https://doi.org/10.1128/mBio.01410-18.
Chomczynski P. (1993). A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. BioTechniques 15: 532-537.
Cordente AG, Curtin CD, Varela C, Pretorius IS. (2012). Flavour active wine yeasts. Appl. Microbiol. Biotechnol 96(3): 601−618. https://doi.org/10.1007/s00253-012-4370-z.
Dank A, Smid EJ, Notebaart RA. (2018). CRISPR-Cas genome engineering of esterase activity in Saccharomyces cerevisiae steers aroma formation. BMC Res Notes 11(1):4–9. https://doi.org/10.1186/s13104-018-3788-5.
De Coster W, D'Hert S, Schultz DT, Cruts M, & Van Broeckhoven C. (2018). NanoPack: visualizing and processing long-read sequencing data. Bioinformatics (Oxford, England), 34(15): 2666–2669. https://doi.org/10.1093/bioinformatics/bty149.
De la Torre-González FJ, Narváez-Zapata JA, Larralde-Corona CP. (2017). Microbial Diversity and Flavor Quality of Fermented Beverages. In: Holban AM, Grumezescu AM (ed). Handbook of Food Bioengineering, Microbial Production of Food Ingredients and Additives. Academic Press, pp 125–54. https://doi.org/10.1016/B978-0-12-811520-6.00005-2.
De León-Rodríguez A, Escalante-Minakata P, Barba-De la Rosa AP, Blaschek HP. (2008). Optimization of fermentation conditions for the production of the mezcal from Agave salmiana using response surface methodology. Chem Eng Process 47:76–82. https://doi.org/10.1016/j.cep.2007.08.010.
De León-Rodríguez A, González-Hernández L, Barba de la Rosa AP, Escalante-Minakata P, López GM. (2006). Characterization of Volatile Compounds of Mezcal, and Ethnic Alcoholic Beverage Obtained from Agave salmiana. J. Agric. Food Chem 54, 1337–1341. https://doi.org/10.1021/jf052154+.
Depardieu F, Bikard D. (2020). Gene silencing with CRISPRi in bacteria and optimization of dCas9 expression levels. Methods 172:61–75. https://doi.org/10.1016/j.ymeth.2019.07.024.
Doudna JA, Charpentier E. (2014). Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science (New York, N.Y.), 346(6213):1258096. https://doi.org/10.1126/science.1258096.
Escalante-Minakata P, Blaschek HP, Barba de la Rosa AP, Santos L, De León-Rodríguez A (2008). Identification of yeast and bacteria involved in the mezcal fermentation of Agave salmiana. Lett. Appl. Microbiol 46(6):626-630. https://doi.org/10.1111/j.1472-765X.2008.02359.x.
Flores JA, Gschaedler A, Amaya-Delgado L, Herrera-López EJ, Arellano M, Arrizon J. (2013). Simultaneous saccharification and fermentation of Agave tequilana fructans by Kluyveromyces marxianus yeasts for bioethanol and tequila production. Bioresour Technol 146:267-273. https://doi.org/10.1016/j.biortech.2013.07.078.
Flores-Cosio G, Arellano-Plaza M, Gschaedler A, Amaya-Delgado L. (2018). Physiological response to furan derivates stress by Kluyveromyces marxianus SLP1 in ethanol production. Rev Mex Ing Quim 17:189–202. https://doi.org/10.24275/uam/izt/dcbi/revmexingquim/2018v17n1/Flores.
Fonseca GG, Gombert AK, Heinzle E, & Wittmann C. (2007). Physiology of the yeast Kluyveromyces marxianus during batch and chemostat cultures with glucose as the sole carbon source. FEMS yeast research 7(3): 422–435. https://doi.org/10.1111/j.1567-1364.2006.00192.x
Fukuda K, Yamamoto N, Kiyokawa Y, Yanagiuchi T, Wakai Y, Kitamoto K, et al. (1998a). Brewing properties of sake yeast whose EST2 gene encoding isoamyl acetate-hydrolyzing esterase was disrupted. J Ferment Bioeng 85(1):101–6. https://doi.org/10.1016/S0922-338X(97)80362-5.
Fukuda K, Yamamoto N, Kiyokawa Y, Yanagiuchi T, Wakai Y, Kitamoto K, Inoue Y, Kimura A. (1998b) Balance of activities of alcohol acetyltransferase and esterase in Saccharomyces cerevisiae is important for production of isoamyl acetate. Appl. Environ. Microbiol 64:4076–4078. https://doi.org/10.1128/AEM.64.10.4076-4078.1998.
Gethins L, Guneser O, Demirkol A, Rea MC, Stanton C, Ross RP, et al. (2014). Influence of carbon and nitrogen source on production of volatile fragrance and flavour metabolites by the yeast Kluyveromyces marxianus. Yeast 32(1):67–76. https://doi.org/10.1002/yea.3047.
Gibson DG, Young L, Chuang R-Y, Venter JG, Hutchinson III CA, Smith H. (2009). Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature methods 6 (5): 343-347. https://doi.org/10.1038/nmeth.1318.
Gombert AK, Madeira JV Jr, Cerdán ME, González-Siso MI. (2016). Kluyveromyces marxianus as a host for heterologous protein synthesis. Applied microbiology and biotechnology 100(14), 6193–6208. https://doi.org/10.1007/s00253-016-7645-y.
Heinisch JJ, Knuesting J, Scheibe R. (2020). Investigation of Heterologously Expressed Glucose-6-Phosphate Dehydrogenase Genes in a Yeast zwf1 Deletion. Microorganisms 8(4):546. https://doi.org/10.3390/microorganisms8040546.
Huerta-Cepas J, Forslund K, Coelho LP, Szklarczyk D, Jensen LJ, von Mering C, Bork, P. (2017). Fast Genome-Wide Functional Annotation through Orthology Assignment by eggNOG-Mapper. Molecular biology and evolution 34(8):2115–2122. https://doi.org/10.1093/molbev/msx148.
Jensen MK. (2018). Design principles for nuclease-deficient CRISPR-based transcriptional regulators. FEMS yeast research 18(4):foy039. https://doi.org/10.1093/femsyr/foy039.
Jones P, Binns D, Chang HY, Fraser M, Li W, McAnulla C, McWilliam H, Maslen J, Mitchell A, Nuka G, Pesseat S, Quinn AF, Sangrador-Vegas A, Scheremetjew M, Yong SY, Lopez R, Hunter S. (2014). InterProScan 5: genome-scale protein function classification. Bioinformatics (Oxford, England) 30(9):1236–1240. https://doi.org/10.1093/bioinformatics/btu031.
Kallel-Mhiri H, Miclo A. (1993). Mechanism of ethyl acetate synthesis by Kluyveromyces fragilis. FEMS Microbiology Letters 111(2–3):207-212. https://doi.org/10.1111/j.1574-6968.1993.tb06387.x.
Kirchmayr MR, Segura-García LE, Lappe-Oliveras P et al. (2017). Impact of environmental conditions and process modifications on microbial diversity, fermentation efficiency and chemical profile during the fermentation of mezcal in Oaxaca. Food Sci Technol 79:160–9. https://doi.org/10.1016/j.lwt.2016.12.052.
Kolmogorov M, Yuan J, Lin Y, & Pevzner PA. (2019). Assembly of long, error-prone reads using repeat graphs. Nat Biotechnol 37:540–546. https://doi.org/10.1038/s41587-019-0072-8.
Kruis AJ, Levisson M, Mars AE, van der Ploeg M, Garcés Daza F, Ellena V, Kengen SWM, van der Oost J, Weusthuis RA. (2017). Ethyl acetate production by the elusive alcohol acetyltransferase from yeast. Metabolic engineering 41:92–101. https://doi.org/10.1016/j.ymben.2017.03.004.
Lane MM, Burke N, Karreman R, Wolfe KH, O'Byrne CP, Morrissey JP. (2011). Physiological and metabolic diversity in the yeast Kluyveromyces marxianus. Antonie Van Leeuwenhoek 100(4):507-19. https://doi.org/10.1007/s10482-011-9606-x.
Langmead B, Salzberg SL. (2012). Fast gapped-read alignment with Bowtie 2. Nature methods 9(4):357–359. https://doi.org/10.1038/nmeth.1923.
Lappe-Oliveras P, Moreno-Terrazas R, Arrizón-Gaviño J, Herrera-Suárez T, García-Mendoza A, & Gschaedler-Mathis A. (2008). Yeasts associated with the production of Mexican alcoholic nondistilled and distilled Agave beverages. FEMS Yeast Res 8:1037–52. https://doi.org/10.1111/j.1567-1364.2008.00430.x.
Lee K-S, Kim J-S, Heo P, Yang T-J, Sung Y-J, Cheon Y, Koo HM, Yu BJ, Seo J-H, Jin Y-S, Park JC, Kweon D-H. (2013). Characterization of Saccharomyces cerevisiae promoters for heterologous gene expression in Kluyveromyces marxianus. Applied Microbiology and Biotechnology 97: 2029-2041. https://doi.org/10.1007/s00253-012-4306-7.
Lertwattanasakul N, Kosaka T, Hosoyama A, Suzuki Y, Rodrussamee N, Matsutani M, Murata M, Fujimoto N, Suprayogi, Tsuchikane K, Limtong S, Fujita N, Yamada M. (2015). Genetic basis of the highly efficient yeast Kluyveromyces marxianus: complete genome sequence and transcriptome analyses. Biotechnology for biofuels 8:47. https://doi.org/10.1186/s13068-015-0227-x.
Li H. (2018). Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics (Oxford, England) 34(18):3094–3100. https://doi.org/10.1093/bioinformatics/bty191.
Li M, Lang X, Moran Cabrera M, De Keyser S, Sun X, Da Silva N, & Wheeldon I. (2021). CRISPR-mediated multigene integration enables Shikimate pathway refactoring for enhanced 2-phenylethanol biosynthesis in Kluyveromyces marxianus. Biotechnology for biofuels, 14(1):3. https://doi.org/10.1186/s13068-020-01852-3.
Lilly M, Bauer FF, Lambrechts MG, Swiegers JH, Coz-zolino D, Pretorius IS. (2006). The effect of increased yeast alcohol acetyltransferase and esterase activity on the flavour profiles of wine and distillates. Yeast 23(9):641–659. https://doi.org/10.1002/yea.1382.
Liu N, Qin L, Hu L, Miao S. (2023). Formation mechanisms of ethyl acetate and organic acids in Kluyveromyces marxianus L1-1 in Chinese acid rice soup. Food Science and Human Wellness, 12(1):45-56. https://doi.org/10.1016/j.fshw.2022.07.017.
Livak KJ, Schmittgen TD. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta DeltaC) method. Methods 25:402–408. https://doi.org/10.1006/meth.2001.1262.
Lopez CL, Beaufort S, Brandam C, Taillandier P. (2014). Interactions between Kluyveromyces marxianus and Saccharomyces cerevisiae in tequila must type medium fermentation. World journal of microbiology & biotechnology 30(8): 2223–2229. https://doi.org/10.1007/s11274-014-1643-y.
Lopez-Alvarez A, Diaz-Perez AL, Sosa-Aguirre C, Macias-Rodriguez L, Campos-Garcia J. (2012). Ethanol yield and volatile compound content in fermentation of agave must by Kluyveromyces marxianus UMPe-1 comparing with Saccharomyces cerevisiae baker’s yeast used in tequila production. J. Biosci. Bioeng 113 (5): 614−618. https://doi.org/10.1016/j.jbiosc.2011.12.015.
Lorenz R, Bernhart SH, Siederdissen CH, Tafer H, Flamm C, Stadler PP, Hofacker IL. (2011). ViennaRNA Package 2.0. Algorithms for Molecular Biology 6:26. https://doi.org/10.1186/1748-7188-6-26.
Löbs A-K, Engel R, Schwartz C, Flores A, Wheeldon I. (2017). CRISPR-Cas9-enabled genetic disruptions for understanding ethanol and ethyl acetate biosynthesis in Kluyveromyces marxianus. Biotechnology Biofuels 10:1-14. https://doi.org/10.1186/s13068-017-0854-5.
Löbs AK, Schwartz C, Thorwall S. Wheeldon I. (2018). Highly multiplexed CRISPRi repression of respiratory functions enhances mitochondrial localized ethyl acetate biosynthesis in Kluyveromyces marxianus. ACS Synth Biol 7(11):2647–55. https://doi.org/10.1021/acssynbio.8b00331.
Löser C, Urit T, Bley T. (2014). Perspectives for the biotechnological production of ethyl acetate by yeasts. Appl Microbiol Biotechnol 98:5397–5415. https://doi.org/10.1007/s00253-014-5765-9.
Löser C, Urit T, Keil P, & Bley T. (2015). Studies on the mechanism of synthesis of ethyl acetate in Kluyveromyces marxianus DSM 5422. Applied microbiology and biotechnology, 99(3), 1131–1144. https://doi.org/10.1007/s00253-014-6098-4.
Ma Y, Deng Q, Du Y, Ren J, Chen Y, Liu X, Guo X, Xiao D. (2020). Biosynthetic Pathway for Ethyl Butyrate Production in Saccharomyces cerevisiae. Journal of agricultural and food chemistry 68(14): 4252–4260. https://doi.org/10.1021/acs.jafc.0c00750.
McMillan D. (2019). Optimizing a transformation protocol for Kluyveromyces marxianus. The California Digital Library. https://escholarship.org/uc/item/3p5717k9.
McMillan J, Lu Z, Rodriguez JS, Ahn TH, Lin Z. (2019). YeasTSS: an integrative web database of yeast transcription start sites. Database (Oxford): baz048. https://doi.org/10.1093/database/baz048.
Medaka: Sequence correction provided by ONT Research. https://github.com/nanoporetech/medaka. Accessed 22 November 2023.
Miller GL. (1959). Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 31: 426–8. https://doi.org/10.1021/ac60147a030.
Mitri S, Koubaa M, Maroun RG, Rossignol T, Nicaud JM, & Louka N. (2022). Bioproduction of 2-Phenylethanol through Yeast Fermentation on Synthetic Media and on Agro-Industrial Waste and By-Products: A Review. Foods (Basel, Switzerland), 11(1):109. https://doi.org/10.3390/foods11010109.
Morrissey JP, Etschmann MMW, Schrader J, de Billerbeck GM. (2015). Cell factory applications of the yeast Kluyveromyces marxianus for the biotechnological production of natural flavour and fragrance molecules. Yeast 32(1):3–16. https://doi.org/10.1002/yea.3054.
Méndez-Zamora A, Gutiérrez-Avendaño DO, Arellano-Plaza M, De la Torre González FJ, Barrera-Martínez I, Gschaedler Mathis A, Casas-Godoy L. (2021). The non-Saccharomyces yeast Pichia kluyveri for the production of aromatic volatile compounds in alcoholic fermentation. FEMS Yeast Res 20(8):foaa067. https://doi.org/10.1093/femsyr/foaa067.
Naito Y, Hino K, Bono H, Ui-Tei K. (2015). CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics 31:1120–3. https://doi.org/10.1093/bioinformatics/btu743.
Nambu-Nishida Y, Nishida K, Hasunuma T, et al. (2017). Development of a comprehensive set of tools for genome engineering in a cold- and thermo-tolerant Kluyveromyces marxianus yeast strain. Sci Rep 7:8993. https://doi.org/10.1038/s41598-017-08356-5.
Nambu-Nishida Y, Nishida K, Hasunuma T, Kondo A. (2018). Genetic and physiological basis for antibody production by Kluyveromyces marxianus. AMB Express 8(1):56. https://doi.org/10.1186/s13568-018-0588-1.
Nolasco-Cancino H, Santiago-Urbina JA, Wacher C, & Ruíz-Terán F. (2018). Predominant yeasts during artisanal mezcal fermentation and their capacity to ferment maguey juice. Front Microbiol 9:2900. https://doi.org/10.3389/fmicb.2018.02900.
Nonklang S, Babiker MA, Abdel-Banat BM, Cha-aim K, Nareerat M, Hoshida H, Limtong S, Yamada M, Akada R. (2008). High-Temperature ethanol and transformation with linear DNA in thermotolerant yeast Kluyveromyces marxianus DMKU3-1042. Applied and Environmental Microbiology 74(24):7514-7521. https://doi.org/10.1128/AEM.01854-08.
Notebaart RA, Szappanos B, Kintses B, Pál F, Györkei Á, Bogos B, Lázár V, Spohn R, Csörgő B, Wagner A, Ruppin E, Pál C, Papp B. (2014). Network-level architecture and the evolutionary potential of underground metabolism. Proceedings of the National Academy of Sciences of the United States of America 111(32):11762–11767. https://doi.org/10.1073/pnas.1406102111.
Palmer JM, Stajich JE. (2022). Funannotate (Version 1.8.13) [Computer software]. https://github.com/nextgenusfs/funannotate.
Prado-Jaramillo N, Estarrón-Espinosa M, Escalona-Buendía H, Cosío-Ramírez R, Martín-del-Campo ST. (2015). Volatile compounds generation during different stages of the Tequila production process. A preliminary study. LWT Food Sci. Technol 61:471–483. https://doi.org/10.1016/j.lwt.2014.11.042.
Pretorius IS, & Boeke JD. (2018). Yeast 2.0-connecting the dots in the construction of the world's first functional synthetic eukaryotic genome. FEMS yeast research 18(4): foy032. https://doi.org/10.1093/femsyr/foy032.
R Core Team. (2017). R: a language and environment for statistical computing. https://www.R-project.org/.
Rossouw D, Naes T, Bauer FF. (2008). Linking gene regulation and the exo-metabolome: a comparative transcriptomics approach to identify genes that impact on the production of volatile aroma compounds in yeast. BMC genomics 9:530. https://doi.org/10.1186/1471-2164-9-530.
Saerens SM, Verstrepen KJ, Van Laere SD, Voet AR, Van Dijck P, Delvaux FR. (2006). The Saccharomyces cerevisiae EHT1 and EEB1 genes encode novel enzymes with medium-chain fatty acid ethyl ester synthesis and hydrolysis capacity. J Biol Chem 281(7):4446–56. https://doi.org/10.1074/jbc.M512028200.
Saerens SMG, Delvaux F, Verstrepen KJ, Van Dijck P, Thevelein JM, Delvaux FR. (2008). Parameters Affecting Ethyl Ester Production by Saccharomyces cerevisiae during Fermentation. Applied and environmental microbiology 74(2):454-461. https://doi.org/10.1128/AEM.01616-07.
Saerens SMG, Delvaux FR, Verstrepen KJ, Thevelein JM. (2010). Production and biological function of volatile esters in Saccharomyces cerevisiae. Microbial Biotechnology 3(2):165-177. https://doi.org/10.1111/j.1751-7915.2009.00106.x.
Segura-García LE, Taillandier P, Brandam C, Gschaedler A. (2015). Fermentative capacity of Saccharomyces and non-Saccharomyces in agave juice and semi-synthetic medium. LWT Food Sci. Technol 60:284–291. https://doi.org/10.1016/j.lwt.2014.08.005.
Shi S, Si T, Liu Z, Zhang H, Ang EL, & Zhao H. (2016). Metabolic engineering of a synergistic pathway for n-butanol production in Saccharomyces cerevisiae. Scientific reports 6:25675. https://doi.org/10.1038/srep25675.
Sievers F, Higgins DG. (2014). Clustal Omega, accurate alignment of very large numbers of sequences. Methods in molecular biology 1079:105–116. https://doi.org/10.1007/978-1-62703-646-7_6.
Smith JD, Suresh S, Schlecht U, Wu M, Wagih O, Peltz G, Davis RW, Steinmetz LM, Parts L, St Onge RP. (2016). Quantitative CRISPR interference screens in yeast identify chemical-genetic interactions and new rules for guide RNA design. Genome Biol 17:45. https://doi.org/10.1186/s13059-016-0900-9.
Stewart GG. (2017). The Production of Secondary Metabolites with Flavour Potential during Brewing and Distilling Wort Fermentations. Fermentation 3(4):63. https://doi.org/10.3390/fermentation3040063.
Stovicek V, Borodina I, Forster J. (2015). CRISPR-Cas system enables fast and simple genome editing of industrial Saccharomyces cerevisiae strains. Metabolic engineering communications 2:13–22. https://doi.org/10.1016/j.meteno.2015.03.001.
Swiegers JH, Pretorius IS. (2005). Yeast modulation of wine flavor. Adv. Appl. Microbiol 57: 131−175. https://doi.org/10.1016/S0065-2164(05)57005-9.
van Rijswijck IMH, Kruis AJ, Wolkers–Rooijackers JCM, Abee T, Smid EJ. (2019). Acetate-ester hydrolase activity for screening of the variation in acetate ester yield of Cyberlindnera fabianii, Pichia kudriavzevii and Saccharomyces cerevisiae. LWT 104:8-15. https://doi.org/10.1016/j.lwt.2019.01.019.
Varela C, Kutyna DR, Solomon MR, Black CA, Borneman A, Henschke PA, Pretorius IS, Chambers PJ. (2012). Evaluation of gene modification strategies for the development of low-alcohol-wine yeasts. Applied and environmental microbiology 78(17):6068–6077. https://doi.org/10.1128/AEM.01279-12.
Vaser R, Sović I, Nagarajan N, Šikić M. (2017). Fast and accurate de novo genome assembly from long uncorrected reads. Genome research 27(5):737–746. https://doi.org/10.1101/gr.214270.116.
Vera-Guzmán AM, Guzmán-Gerónimo RI, López MG, Chávez-Servia JL. (2018). Volatile Compound Profiles in Mezcal Spirits as Influenced by Agave Species and Production Processes. Beverages 4(1):9. https://doi.org/10.3390/beverages4010009.
Vera-Guzmán AM, López MG, Chávez-Servia JL. (2012). Chemical Composition and Volatile Compounds in the Artisanal Fermentation of Mezcal in Oaxaca, Mexico. Afr. J. Biotechnol 11:14344–14353. https://doi.org/10.5897/AJB11.1963.
Vera-Guzmán AM, Santiago-García PA, López MG. (2009). Compuestos Volátiles Aromáticos Generados durante la Elaboración de Mezcal de Agave angustifolia y Agave potatorum. Rev. Fitotec. Mex 32: 273–279. doi: 10.35196/rfm.2009.4.273-279
Vickers CE, Bydder SF, Zhou Y, Nielsen LK. (2013). Dual gene expression cassete vectors with antibiotic selection markers for engineering in Saccharomyces cerevisiae. Microbial Cell Factories, 12 (96): 1-10. https://doi.org/10.1186/1475-2859-12-96.
Vidal EE, de Billerbeck GM, Simões DA, Schuler A, François JM, de Morais MA Jr. (2013). Influence of nitrogen supply on the production of higher alcohols/esters and expression of flavour-related genes in cachaça fermentation. Food chemistry 138(1):701–708. https://doi.org/10.1016/j.foodchem.2012.10.147
Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, Cuomo CA, Zeng Q, Wortman J, Young SK, & Earl AM. (2014) Pilon: An Integrated Tool for Comprehensive Microbial Variant Detection and Genome Assembly Improvement. PLOS ONE 9(11): e112963. https://doi.org/10.1371/journal.pone.0112963.
Walker ME, Gardner JM, Vystavelova A, McBryde C, de Barros Lopes M, Jiranek V. (2003). Application of the reuseable, KanMX selectable marker to industrial yeast: construction and evaluation of heterothallic wine strains of Saccharomyces cerevisiae, possessing minimal foreign DNA sequences. FEMS Yeast Res 4(3):339-47. https://doi.org/10.1016/S1567-1356(03)00161-2.
Wensing L, Sharma J, Uthayakumar D, Proteau Y, Chavez A, Shapiro RS. (2019). A CRISPR Interference Platform for Efficient Genetic Repression in Candida albicans. mSphere 4(1):e00002-19. https://doi.org/10.1128/mSphere.00002-19.
Wick RR. Filtlong. 2017. https://github.com/rrwick/Filtlong.
Wickham H. (2016). ggplot2: Elegant Graphics for Data Analysis. New York, NY: Springer-Verlag.
Yu A, Zhao Y, Pang Y, Hu Z, Zhang C, Xiao D, Chang M.W, Leong S.S.J. (2018). An oleaginous yeast platform for renewable 1-butanol synthesis based on a heterologous CoA-dependent pathway and an endogenous pathway. Microbial cell factories 17(1):166. https://doi.org/10.1186/s12934-018-1014-8.

No competing interests reported.

SupplementaryFile.pdf

Download PDF

Journal Publication

published 05 Mar, 2024

Read the published version in World Journal of Microbiology and Biotechnology →

Editorial decision: Major revision
19 Aug, 2023
Reviews received at journal
16 Aug, 2023
Reviewers agreed at journal
08 Aug, 2023
Reviewers invited by journal
02 Aug, 2023
Editor assigned by journal
02 Aug, 2023
Submission checks completed at journal
02 Aug, 2023
First submitted to journal
31 Jul, 2023

You are reading this latest preprint version

CRISPRi-Induced Transcriptional Regulation of IAH1 Gene and its Influence on Volatile Compounds Profile in Kluyveromyces marxianus DU3

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and methods

Results

Effect of CRISPRi system on VOC profile

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1