Interacting proteins of AMPK studied using TurboID proximity labeling technology

doi:10.21203/rs.3.rs-3223917/v1

Download PDF

Research Article

Interacting proteins of AMPK studied using TurboID proximity labeling technology

https://doi.org/10.21203/rs.3.rs-3223917/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objective

Adenosine monophosphate activated protein kinase (AMPK), whose activity is regulated by the AMP/ATP ratio in the body, is an important center for controlling cell energy metabolism, and is also an evolutionarily conservative serine/threonine protein kinase. AMPK plays an important role in diabetes, myocardial infarction and many diseases. We try to use TurboID technology to study a novel protein that can interact with AMPK, and explore the biological function of this protein, in order to provide a theoretical basis for the development of new targeted drugs.

Methods

We will construct AMPK overexpression stable cell lines by transfecting AMPK-TurboID fusion gene into astrocytes U251 using lentiviral infection technique. After 6 h of biotin labeling, a large number of proteins interacting with AMPK can be observed by silver staining. The interacting proteins were analyzed by label-free quantitative protein profiling, and the interacting protein DNAJA1 was selected for IP and immunofluorescence validation.

Results

We successfully constructed AMPK-TurboID overexpression stable cell lines, and obtained a large number of interacting proteins after biotin labeling experiments, and then obtained all interacting protein information by mass spectrometry, and selected the interacting protein DNAJA1 for IP and immunofluorescence validation. In addition, we found that AMPK and DNAJA1 could be jointly involved in anti-apoptotic cell death.

Conclusion

Because AMPK is involved in a variety of metabolic pathways, coupled with the advantages of high catalytic activity and fast labeling of TurboID neighboring labeling technology, a large number of proteins interacting with AMPK gene were found through biotin labeling experiments, and subsequent experiments verified that AMPK and DNAJA1 have interaction, and the two can synergistically protect cells from apoptosis; this has laid a certain theoretical foundation for how to use AMPK to treat clinical diseases such as diabetes and myocardial infarction in the future.

TurboID

AMPK

DNAJA1

biotin labeling

U251 cells

Biomolecules are important components of living organisms and perform a variety of functions in the organism. Common biomolecules include proteins, nucleic acids and sugars. Proteins are the embodiment of life activities, and the study of protein assembly, interactions and subcellular distribution is essential to understand their functions. Protein-protein interactions (PPIs) are the basis of cellular and other life activities, such as replication, transcription, and expression of genetic information, and intercellular signaling and regulation. Systematic elucidation of the spatial patterns of protein localization and interactions is the cornerstone of understanding cellular processes^[1]. The spatial distances between proteins are very short and their interactions mostly rely on hydrogen, salt and hydrophobic interaction forces; therefore, the present study assumes that interacting proteins must be in close proximity to each other. Traditionally, protein interactions have been studied by affinity purification, preserving organelles or interactions in cell lysis and purification complexes, but this method is more difficult to obtain ideal protein structures^[2]. To overcome this drawback proximity labeling technology combined with mass spectrometry detection is gradually becoming an ideal method for the identification of organelle protein components and interactions^[3]. The principle of this technique is the fusion of a labeling enzyme to a targeted protein or subcellular compartment by gene fusion, followed by the addition of a small molecule substrate (e.g. biotin), which initiates the covalent labeling of the endogenous protein within a few nanometers of the labeling enzyme. The biotinylated protein is then obtained using streptavidin-coated magnetic beads and identified by mass spectrometry (MS) ^[2].

At present, the modified enzymes of proximity labeling technology are mainly divided into two categories, biotin ligases and ascorbate peroxidases, of which biotin ligases are more widely used^[4]. Biotin ligases are natural biotinylated proteins including BioID, BioID2, BASU, TurboID, miniTurbo, Split-BioID, and Split-TurboID^[5]. The first biotin ligase is BioID, which is an E. coli BirA (Bifunctional ligase/ repressor) mutant with a size of 35 kDa. This enzyme has a reduced affinity for biotin-5'-AMP and can react with the proximal protein's primary amine, leading to its covalent biotinylation^[6]. To address the defective target protein localization due to the large molecular weight of BioID, a new mutant BioID2 was identified from the thermophilic bacterium Aquifex aeolicus with a size of 27 kDa^[7]. It is more targeted and requires lower biotin concentration compared to BioID. However, both BioID and BioID2 have the following limitations: first, the long labeling time (18–24 h) is not favorable for the study of short transient interacting proteins. Secondly, biotin is actively imported into the cytoplasm of mammalian cells and free to diffuse to the nucleus but may not be as accessible in the secretory pathway, thus reducing labeling efficacy in that compartment^[8]. In addition, due to prolonged BioID labeling, biotinylation of proteins can affect their function, resulting in false positive or false negative results. TurboID and miniTurbo were generated by targeted modification of the biotin ligase in BioID^[9]. Compared to BioID and BioID2 mentioned above, their labeling kinetics are faster and require less labeling time (10 min or less), in addition to their ability to maintain catalytic activity at lower temperatures^[9]. The labeling principle of TurboID uses ATP and biotin to generate an intermediate substance, biotinase-5'-AMP, which can covalently label neighboring end proteins^[10], which can be used to extract or capture proteins more efficiently. And the proximity labeling technique is now increasingly used in animal cell experiments, including protein complexes (e.g., nuclear pore complexes)^[11], tissue proteosomes (e.g., mitochondrial matrix and intermembrane space)^[12], and native proteomes^{[13, 14]}. It was shown that this technique not only allows the detection of proteins that transiently interact with specific proteins in living cells, but also reduces the potential losses caused by traditional methods during purification and enables the precise identification of real-time, dynamic interacting proteins within living cells. In addition, the proximity labeling technology has been extended to the study of transcriptional complexes and histone modifications, providing an important safeguard for exploring biomolecular interactions.

AMP-activated protein kinase (AMPK) is an evolutionarily conserved serine/threonine protein kinase with AMP-dependent properties^[15]. As a key molecule for cells to sense external environmental changes and adjust energy metabolism, it not only regulates energy metabolism at the cellular level, but also plays a crucial role in maintaining the energy homeostasis of the body. In normal physiological state, the intracellular AMP level is not high, and when the ATP level decreases after energy consumption, the AMP level increases and the AMP/ATP ratio increases, followed by the activation of AMPK by upstream kinase (AMPKK) through phosphorylation^[16]. So the state of the cell can be monitored by the concentration of ATP, ADP and AMP. Current studies have shown that AMPK, a switch for energy regulation, improves the metabolic imbalance caused by type 2 diabetes, not only by inhibiting its activity in a short time but also by promoting insulin secretion^[17]. In addition, AMPK has an anti-apoptotic effect, and its activation not only reduces myocardial energy consumption but also increases energy production, stabilizes mitochondrial membrane potential to reduce intracellular reactive oxygen species, and plays a protective role for the myocardium^[18]. Therefore, AMPK may be a new target for the treatment of diabetes mellitus and myocardial infarction.

Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) is a potent mitochondrial oxidative phosphorylation uncoupling agent that acts on the inner mitochondrial membrane to make it permeable to H⁺, causing depolarization of the mitochondrial membrane potential, which induces autophagy to clear the depolarized mitochondria and further induces the mitochondrial pathway of apoptosis^[19]. A literature search revealed that p53 activates AMPK-dependent inhibitory pathways that attenuate the activity of mammalian target of rapamycin (mTORC1)^[20]. Inhibition of mitochondrial depolarization by the proton carrier CCCP facilitates experiments to trigger mitosis and induce apoptosis and autophagy^[21].

Therefore, in this experiment, CCCP was selected as an induction factor to transfect AMPK-TurboID fusion gene into astrocytes U251 by lentiviral infection technique, and a cell line stably transfected with AMPK was successfully constructed. After that, TurboID proximity labeling technique was used to find novel interacting proteins associated with AMPK, and label-free quantitative protein profiling was used to obtain a large number of interacting proteins, and DNAJA1 was selected for IP and immunofluorescence validation. In addition, we found that AMPK and DNAJA1 can be jointly involved in anti-apoptotic cell death. We provide a theoretical basis to explore the biological function of this protein and its development of new targeted drugs.

Materials

Monoclonal antibodies [FLAG (ab205606), DNAJA1 (ab192904)] were purchased from abcam. AMPKα2 (A7339), BAX (A12009), Bcl-2 (A0208), and α-Tubulin (AC012) were purchased from ABclonal. Carbonyl cyanide 3-chlorophenylhydrazone (CCCP, C6700) was purchased from Beijing Solarbio Technology Co., Ltd. PVDF membrane was purchased from Millipore. Dynabead™ MyOne™ streptavidin C1 (65001), biotin (B20656) and liposomal transfection reagent (Lipofectamine 2000, 11668500) comes from Thermo Fisher. RIPA (G2002-100ML), DAIP (G1012-100ML), and anti-fluorescence quenching sealing agent (G1401-25ML) were purchased from Wuhan Servicebio Technology Co., Ltd. Anti-DYKDDDDK (Flag) Affinity Gel (20585ES03), Lentivirus Concentration Solution (41101ES50) and protein silver staining kit (36244ES30) were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd. DNA product purification kit (DP204) and high purity plasmid small amount extraction kit (DP104) was purchased from Tiangen Biotech (Beijing) Co., Ltd. All kinds of inorganic salts come from Sinopharm.

Cell lines and cell culture

HEK 293T (human embryonic kidney epithelial cell line), U251 (astrocyte cell line) were obtained from ATCC (Manassas, USA). U251, HEK 293T were cultured in Dulbecco's Modify Eagle Media (Gibco, USA) containing 10% fetal bovine serum (Gibco, USA) and 0.5% penicillin streptomycin, and all cells were grown in a CO₂ incubator at 37°C with 5% CO₂.

Construction of AMPK-TurboID overexpression vector and EGFP-TurboID fusion expression vector

The whole gene synthesized TurboID fragment, replacing EGFP fragment and integrated into plenti-CMV-EGFP plasmid, called plenti-CMV-TurboID, this step was done by Beijing Qingke Biotechnology Co., Ltd. The AMPK gene was amplified using human cDNA as a template. (Primers, AMPKF: atagaagacaccgactctaga ATGGCTGAGAAGCAGAAGCAC, AMPKR: catacgcgtgatatccccggg ACGGGCTAAAGTAGTAATCAG), plenti-CMV-TurboID was double digested using Xba I and sma I, and the AMPK fragment was recombined into the linearized plenti-CMV-TurboID plasmid. Positive clones were screened by transformation. The extracted plasmids were identified by enzymatic digestion and sent to the Beijing Qingke Biotechnology for sequencing. The successfully sequenced plasmid was named AMPK-TurboID, and this plasmid was tagged with a flag tag.

Lentiviral packaging of AMPK-TurboID and plenti-CMV-EGFP plasmids

Resuscitate 293T cells in a 10 cm culture dish and wait until their cell density reaches 80–90% for transfection. At the beginning of transfection, the plasmids need to be diluted with serum-free medium. First prepare two 1.5 mL EP tubes, one EP tube with psPAX2, pMD2.G and AMPK-TurboID and the other EP tube with psPAX2, pMD2.G and plenti-CMV-EGFP. Later, an appropriate amount of liposomal transfection reagent (approximately 60 µl in a 10 cm dish) was diluted with serum-free medium and incubated at room temperature for 5 min. Then, the diluted DNA plasmid and the diluted liposomal nucleic acid transfection reagent were gently mixed and incubated at room temperature for 30 min. Then, the incubated DNA liposome complexes were evenly dropped into 293T cell culture dishes that had been replaced with non-resistant DMEM medium and incubated overnight at 37 ℃ in a cell culture incubator with 5% CO₂. The next day, the medium needs to be replaced with fresh medium and continued to be incubated for 48–72 h. The supernatant of the medium was collected. The collected medium supernatant was filtered by aspiration with a 5 ml syringe onto a 0.45 mm membrane, after which the filtrate was mixed with lentivirus concentration reagent in a 4:1 ratio and incubated overnight at 4 ℃. After incubation, the supernatant was removed by centrifugation, and fresh medium was added to the sediment and dispensed into several 1.5 mL EP tubes.

Construction and validation of AMPK overexpression cell lines

The wild-type U251 cell line was grown in 10 cm cell culture dishes, and when its cell coverage reached 80%-90%, an appropriate amount of cells were grown into 24-well cell culture plates. When the cell density reached 70–80%, one well was selected for dropwise addition of lentivirus concentrate carrying AMPK-TurboID plasmid, and the other well was added with lentivirus concentrate carrying plenti-CMV-EGFP plasmid, and both were infected for 6–8 h and replaced with fresh medium. The fluorescence intensity of plenti-CMV-EGFP plasmid infected cell culture plates was observed after 48 h. Successful infection was demonstrated when stronger fluorescence appeared. Resistance screening was performed with medium containing puromycin (1.5 µg·mL^− 1), and cell status was observed after 24–48 h. The cells in good condition were continued to be cultured, and after the cells were in normal condition, they were passaged to 12-well plates and sequentially passed to the amount of cells that met the requirements of subsequent experiments. During this period, the cell status was observed daily and the fresh medium was changed once every two days. Some cells were taken to make cell lysate for SDS-PAGE gel electrophoresis and developed to determine whether the stable transfer was successful. Cells successfully stably transfected with plenti-CMV-EGFP plasmid were named EGFP-U251 cells, and cells stably transfected with AMPK-TurboID plasmid were named AMPK-U251 cells.

Screening of AMPK biotin labeling time

AMPK-U251 cells were grown into 6-well cell culture plates, and experiments were performed when their density reached about 80%. The original medium was replaced with complete medium containing Biotin (500 µmol·L^− 1), MgCl₂ (1 µmol·L^− 1) and ATP (200 µmol·L^− 1), and seven labeling time gradients were set, with labeling times of 0 min, 10 min, 1 h, 3 h, 6 h, 12 h and 24h in that order. Cells were collected, made into cell lysates and subjected to protein blotting, and the antibody used was streptavidin-perosidase.

Effect of adding ATP on biotin labeling

AMPK-U251 cells were grown into 6-well cell culture plates and left to reach a density of about 70%-80% for experiments. The original culture medium was discarded and replaced with biotin-labeled buffer containing 5 different concentrations after 2 washes with PBS. The biotin labeling buffer was a complete medium containing Biotin (500 µmol·L^− 1), MgCl₂ (1 µmol·L^− 1) and ATP (200 µmol·L^− 1), and the biotin labeling buffer without ATP had only the ATP component removed. Cells were collected, made into cell lysates and then subjected to protein blotting. The antibody used was streptavidin-perosidase, and the results were visualized.

TurboID-based neighboring biotin labeling technology

The method was performed with reference to that reported by Branon et al. The wild-type U251 cell line and AMPK-U251 cell line were grown in T75 cell culture flasks, and the experiment was set up in three groups: respectively, ① blank group, two T75 culture flasks for wild-type U251 cell line; ② experimental group I, two T75 culture flasks for AMPK-U251 cell line; and ③ experimental group II, two T75 culture flasks for AMPK- U251 cell line and treated with 15 µmol-L-1 CCCP. All three groups of cells were cultured using DMEM medium containing Biotin (500 µmol·L^− 1) and MgCl2 (1 µmol·L^− 1), and the cells were collected after 6 h for sample preparation.

Affinity purification of biotin-labeled proteins

The cells in the T75 cell culture flasks were collected by centrifugation into 1.5 ml centrifuge tubes, resuspended by adding 1 ml of RIPA (containing PMSF), and placed on ice for about 20 min for lysis. After lysis, the beads were centrifuged at 12000 rpm for 15 min at 4°C. The supernatant was pipetted into a 1.5 ml centrifuge tube with a pipette. Subsequently, the biotin magnetic beads (beads) were washed with 1 ml RIPA for about 2 min, and the RIPA was discarded after the supernatant became clarified by adsorption on a magnetic stand, and the washing was repeated 5 times. After the last wash, divide the beads into 3 equal parts evenly, and after the beads are precipitated, discard the RIPA, add the above protein lysate into the beads separately, place at 4 ℃, and shake slowly under a 360 degree shaker overnight. The supernatant was discarded the next day and washed once with 1 ml of potassium chloride (KCl), three times with Buffer 1 configured in advance, once with sodium carbonate (Na₂CO₃) buffer, and then 2 min (maximum 3 min) with 10% sodium dodecyl sulfate (SDS), after which RIPA solution was added and soaked continuously for 1 min at 50°C in a metal bath. After completion of the operation, 1/3 of the samples were removed and identified by silver staining, while the rest of the samples were washed twice with RIPA and PBS, then stored at -20°C in the refrigerator. After electrophoresis, the gel was removed and placed in 100 mL of fixative on a 60–70 rpm shaker for 20 min. The fixative was discarded and placed in 100 mL of 30% ethanol on a slow shaker for 10 min. Discard the fixative, place in 100 mL of 30% ethanol, shake slowly for 10 min, discard the ethanol, place in 200 mL of deionized water, and shake slowly for 10 min. Discard deionized water, replace with 100 mL of 1× sensitizing solution, shake the shaker for 4 ~ 5 min. Discard sensitizing solution, place 200 mL of deionized water, shake the shaker for 1 min, repeat once and then discard deionized water. Add 100 mL of 1× silver staining solution and shake the shaker for 30 ~ 40 min. Replace the silver staining solution with 100 mL of deionized water, shake the shaker for 0.5 min, repeat once and then discard the deionized water. Add 100 mL of color development solution and shake the shaker until a band appears (about 3 ~ 10 min). Replace the color development solution with 100 mL of termination solution and place on a shaker for 10 min. Discard the termination solution and add 100 mL of deionized water, shake the shaker for 0.5 min, repeat once and then discard the deionized water and take pictures to save the strips.

Liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis

After silver staining and identification, the amount of protein was observed after magnetic bead elution, and there was a significant increase in protein compared to the control group. The remaining 2/3 protein samples were sent to Wuhan SpectroZone Life Sciences Co., Ltd. for label-free quantitative protein profiling^[22].

Validation of the protein DNAJA1 interacting with AMPK

The first step was initially verified with an immunoprecipitation (co-IP) assay. The Anti-Flag affinity purification gel was resuspended to form a homogeneous solution. Take 50 µL of the mixture (25 µL gel) in a centrifuge tube, centrifuge at 8000 rpm for 30 s and leave for 1–2 min to allow the gel to settle at the bottom of the tube. Discard the supernatant, add 500 µL TBS and gently resuspend and centrifuge at 10,000 rpm for 30 s. Discard the supernatant and repeat the above steps once. Add a volume of cell lysate to 1 mL and incubate slowly at 4°C overnight. The next day, centrifuge at 8000 rpm for 30 s and remove the supernatant. Add 0.5 mL of TBS and mix the precipitate gently, then centrifuge at 8000 rpm for 30 s. Discard the supernatant and repeat the above operation three times.

In the second step, spread AMPK-TurboID cells in a 3.5 cm cell confocal dish, discard the medium when the density reaches 80%, add PBS and wash for 3 min, then discard and repeat the washing two times. Add 4% paraformaldehyde in a small dish for 15 min to fix the cells in the dish, and discard after completion. Add PBS for 3 min and discard, repeat twice. Add 0.5% Triton X-100 for 20 min at room temperature; discard, then add PBS for 3 min and discard, repeat twice. Absorb the PBS in the dish with absorbent paper and add normal goat serum dropwise, and leave it at room temperature for 30 min to close; absorb the closed solution with absorbent paper, add the prepared primary antibody (primary antibody DNAJA1 2.5 µL + primary antibody flag 1 µL + primary antibody dilution 500 µL) and incubate at 4 ℃ overnight. Discard the primary antibody, add PBS and wash for 3 min, then discard, repeat the washing twice, absorb the PBS with absorbent paper. Discard the secondary antibody, incubate the nuclei with DAPI for 5 min, discard DAPI, add PBS and wash for 5 min, then discard, repeat the washing 3 times. After absorbing the PBS on blotting paper, the slice was sealed with anti-fluorescent bursting agent, and the image in the small dish was observed under confocal microscope.

Construction of overexpression plasmids and TurboID tagging flow chart

The composition of AMPK-TurboID overexpression plasmid is shown in Fig. 1A, including target gene AMPK, biotin marker enzyme TurboID and tag protein Flag, as well as two different resistance screening markers AmpR and puro, where AmpR was used for the screening of positive clones in E. coli, puro was used for the screening of stably transfected cells. Figure 1B was a simple illustration of our biotin experiment. First, the AMPK-U251 cells that have been successfully and stably transfected were placed in a biotin environment with a suitable concentration, so that the free biotin could fully enter the cells, adjacent proteins are covalently labeled with biotin by TurboID. After protein affinity purification experiment, other proteins that were not labeled with biotin were excluded, and the proteins that had been labeled with biotin were screened out, and the labeled proteins were analyzed by label-free quantitative protein spectrum.

Construction of AMPK-TurboID overexpression stable cell line

293T cells were inoculated in three 10 cm dishes. The first dish was co-transfected with psPAX2, pMD2.G and AMPK-TurboID overexpression plasmid; the second dish was co-transfected with psPAX2, pMD2.G and plenti-CMV-EGFP. The 293T virus supernatant was collected from the above two 10 cm culture dishes and infected with U251 cells. After infection, resistance screening was performed using puromycin as a way to obtain stable, highly expressed cell lines, which were named AMPK-U251 cell line and EGFP-U251 cell line, respectively. In Fig. 2A, psPAX2, PMD2.G and plenti-CMV-EGFP overexpression plasmid were cotransfected with 293T cells; 48 hours after infection, a large amount of fluorescence could be seen under the microscope, which proved that 293T cells had been successfully transfected with plenti-CMV-EGFP gene, and the supernatant viral fluid could be collected from the same batch of cells after transfection; Fig. 2B, on the other hand, shows the results of U251 cells observed under fluorescence microscopy 48 h after lentivirus infection, which also confirms that the plenti-CMV-EGFP gene has been successfully transfected into U251 cells, implying that the concurrent AMPK-TurboID gene was also transfected into U251 cells with high probability.

Validation of AMPK-TurboID overexpression in stably transduced cell lines

Comparative analysis of stably expressed AMPK-TurboID cell lines with U251 cell lines using Western blotting. WB bands of AMPK-TurboID cell lines treated with AMPK antibody and FLAG antibody, respectively, in Fig. 2C, NC represents wild-type U251 cell lines, OE represents overexpressed in U251 cell lines AMPK-TurboID fusion protein. The results showed that the AMPK-TurboID fusion protein showed a uniform and clear band at a molecular weight of about 97 kDa (molecular weight of AMPK protein was 62.3 kDa, molecular weight of TurboID protein was 35 kDa, FLAG size was neglected), and the corresponding protein region in the TurboID-U251 cell line was blank, indicating that the stable cell line was successfully constructed.

Biotin labeling and silver staining

AMPK-U251 cells were inoculated in six-well plates and cultured, and different time gradients were set to explore the optimal biotin labeling time. Cells were collected, and protein blotting assay was performed after cells were made into lysate. The antibodies used in Fig. 3A were streptavidin peroxidase. 1, 2, 3, 4, 5, 6 and 7 corresponded to seven time gradients of 0, 10 min, 1 h, 3 h, 6 h, 12 h and 24h. The results showed that the interacting proteins appeared after 10 min and more significantly after 1 h. To prevent oversaturation of biotin labeling, 6 h was used as the biotin labeling time in this experiment.

AMPK-U251 cells were grown into six-well plates, set up with or without two sets of biotin-labeled buffers such as ATP, and the cells were collected after 6 h. The cells were made into cell lysates and then subjected to protein blotting assays. The antibodies used in Fig. 3B are streptavidin peroxidase, 1, 2 and 3 indicate the replicate groups without ATP addition, and 4, 5 and 6 indicate the replicate groups with ATP addition. The results showed that there was some improvement in biotin labeling efficiency with the addition of ATP, but the effect was limited. Considering the possible effect of the addition of ATP on the activity of AMPK, the subsequent biotin-labeled buffers in this study will not be added with ATP.

After the above experimental exploration the U251 cell line and AMPK-U251 cell line were affinity purified and identified by silver staining. In Fig. 3C, M indicates protein molecular weight marker, 1 represents U251 primary cell line, 2 represents AMPK overexpressing cell line, and 3 represents AMPK overexpressing cell line added to CCCP for drug treatment. The results showed that U251 as a negative control pulled only a very few proteins, and this part of the protein data needs to be excluded. The remaining two sets of data indicated that AMPK overexpressing cell lines pulled a large number of biotin-interacting proteins.

Mass Spectrometry Data Analysis

By analyzing the mass spectrometry data, a total of 1808 interacting proteins were collected by the proximity labeling technique, and 329 proteins were identified in the U251 blank group; 1045 proteins were identified in the AMPK overexpression group, after excluding 129 proteins that were also identified in the blank group, there were still 916 interacting proteins; 1705 proteins were identified in the CCCP-treated group, and after excluding 296 proteins that were also identified in the blank group, there were still 1408 interacting proteins.

We used the online analysis tool Sangerbox 3.0 for GO analysis and KEGG analysis (Sangerbox 3.0, http://vip.sangerbox.com/home.html). We selected 1045 interacting proteins in the AMPK overexpression group for analysis. In the analysis of cellular components, the following protein enrichments were found, including cytosol, nuclear part, protein-containing complex, nuclear lumen, non-membrane-bounded organelle, etc. (Fig. 4A). In the analysis of molecular function, the search for RNA binding, enzyme binding, ribonucleotide binding, ribonucleotide binding, ATP binding, etc. (Fig. 4B). In addition, several significant enriched regions were identified in the analysis of biological process, including organelle organization, positive regulation of metabolic process, cellular localization, positive regulation of marcromolecule metabolic process, cellular marcromolecule localization, etc. (Fig. 4C). In the KEGG analysis, it was found to be enriched in the following pathways, including endocytosis, spliceosome, RNA transport, regulation of actin cytoskeleton, Hippo signaling pashway, insulin signaling pathway, insulin resistance, ferroptosis, etc. (Fig. 4D).

Validation of the protein DNAJA1 interacting with AMPK

DNAJA1, a key substance in the protection against apoptosis, acts as a co-chaperone protein for HSPA1B and negatively regulates the transport of Bax from the cytoplasm to the mitochondria when the cell is stressed. The DNAJA1 protein obtained above was verified to interact with AMPK by co-IP. In Fig. 5A, 1 shows the flow-through solution of U251 cell line after flag magnetic beads, 2 shows the flow-through solution of AMPK overexpressing cell line after flag magnetic beads, 3 shows the eluate of U251 cell line after flag magnetic beads affinity adsorption, and 4 shows the eluate of AMPK overexpressing cell line after flag magnetic beads affinity adsorption, the results show that AMPK can specifically precipitate DNAJA1.

Immunofluorescence detection of the localization of AMPK and DNAJA1 in U251 cells further provided a basis for the interaction between AMPK and DNAJA1. The results are shown in Fig. 5B, where both AMPK and DNAJA1 are localized in the nucleoplasm, which provides a spatial and temporal basis to further confirm the interactions between AMPK and DNAJA1.

AMPK interacts with DNAJA1 to participate in anti-apoptosis

It has been shown that DNAJA1 is involved in the negative regulation of BAX and thus helps in the anti-apoptotic process. The present study confirmed the existence of an interaction between AMPK and DNAJA1 and therefore proposed the hypothesis that AMPK interacts with DNAJA1 to participate in the anti-apoptotic pathway of cells. As shown in Fig. 6, where 1 represents the U251 cell line, 2 represents the AMPK-TurboID overexpressing cell line, and 3 represents the AMPK-TurboID overexpressing cell line treated with CCCP. Bax and Bcl2 are apoptosis marker proteins, and the results showed that the AMPK overexpressing cell line increased the expression of DNAJA1 and Bcl2, and decreased the expression of BAX, which reduced the apoptotic process, compared with the U251 cell line. In contrast, the addition of CCCP-treated AMPK-TurboID overexpressing cell lines showed just the opposite result, with significantly weakened DNAJA1 and Bcl2 trends and enhanced Bax trends.

Proteins are not only the material basis of life activities but also important components of cells and are the main performers in the regulation of physiological functions and substance metabolism in the human body. Proteins act in two main forms, acting alone or in specific complexes with other proteins or chaperone molecules^[23]. The study of protein interactions is an important aspect of protein functional inquiry^[24]. Based on the idea that interacting proteins must be in proximity to each other, proximity labeling techniques have gradually become a hot research topic. Among them, TurboID stands out among the proximity labeling techniques with the advantages of high catalytic activity, fast labeling, no in vivo application toxicity, and easy operation, and its principle of action is to catalyze the bioacylation of the fused biotinase and target protein regions in a proximity-dependent manner^[25]. In order to consistently and stably express the target gene and study protein interactions, a stable transient cell line was constructed in this paper. Stable overexpression of genes can overcome the disadvantage of relatively limited and uncontrollable transient overexpression^[26] and increase the stability of experimental results.

AMPK signaling pathway is the current research hotspot. AMPK trimeric serine/threonine protein kinase is composed of a catalytic subunit (α) and two regulatory subunits (β and γ) ^[27], which is an enzyme regulating the general switch of cellular metabolism and maintaining the balance of nutrient supply and energy demand in vivo^[28]. Studying the interaction between AMPK and other proteins is an important step in understanding its function. It has been recently discovered that AMPK is closely associated with mitochondrial fission factor (MFF), which can promote AMPK phosphorylation and activate mitochondrial fission. In 2022, Peng et al. demonstrated that high osmotic pressure (HOP)-induced energy stress can activate the AMPK/MFF pathway, which subsequently regulates mitochondrial fission and mitophagy, contributing to the development of dry eye^[29]. Receptor-interacting protein kinase 1 (RIPK1) is a key factor in mediating cell inflammation and death. In 2023, Zhang et al. found that AMPK can inhibit RIPK1 activation through phosphorylation at Ser415, suppressing energy stress-induced cell death. These findings provide important insights for the development of therapeutic drugs aimed at preventing ischemia-induced cell death and tissue damage^[30]. Penfluridol can activate AMPK/FOXO3a/BIM signaling pathway and inhibit glycolysis induced apoptosis, thereby inhibiting tumor formation. In 2022, Zheng et al. Found that Penfluridol significantly inhibited the growth of patient derived xenograft (PDX) tumor, and the therapeutic effect of PDX tumor on Penfluridol was closely related to the expression of phosphofructokinase, liver type (PFKL). PDX was subcutaneously inoculated with esophageal squamous cell carcinoma in mice. Through further study, the authors found that Penfluridol targeted PFKL inhibited glycolysis and inhibited the occurrence of esophageal cancer in an AMPK/FOXO3a/BIM dependent manner^[31]. In addition, AMPK also participates in many physiological processes such as cell growth metabolism^[32], autophagy^[33], apoptosis^[34], etc.

Therefore, this paper takes AMPK as the main body to find the proteins that interact with it, so as to provide a basis for improving the function of AMPK gene and its regulatory network. Because the success rate of human astrocytoma cell U251 lentivirus infection is relatively high, this paper selects it as the original cell line of the stably transformed cell line. At present, we have successfully inserted TurboID fragment into AMPK plasmid and constructed U251 cell line stably expressing AMPK gene. Subsequently, TurboID was used to conduct biotin labeling experiments to find a large number of proteins interacting with AMPK gene. Finally, a large class of AMPK-interacting proteins was screened by label-free mass spectrometry, and GO analysis and KEGG analysis were performed based on the AMPK overexpression group.

Apoptosis is a fundamental phenomenon of life activity, and a literature search revealed that DNAJA1 can negatively regulate the pro-apoptotic protein Bax from the cytoplasm to the mitochondria during cellular stress, thus participating in the anti-apoptotic process^[33]. AMPK activates NF-κB to increase the expression of the anti-apoptotic protein Bcl2, thereby promoting cell survival and inhibiting apoptosis. The present study confirmed the existence of interaction between AMPK and DNAJA1, and therefore proposed the hypothesis that AMPK interacts with DNAJA1 to participate in the anti-apoptotic pathway of cells^[34]. Therefore, this paper compares U251 cells, AMPK-TurboID cells, and CCCP drug-treated AMPK-TurboID cells to detect Bax and Bcl2, two apoptosis marker proteins. The results showed that compared with the U251 cell line, the AMPK overexpressing cell line decreased DNAJA1 and BAX expression and promoted Bcl2 expression, thereby reducing the apoptotic process. In contrast, the results of CCCP-treated AMPK-TurboID cells were the opposite, with a significantly weaker trend of DNAJA1 and Bcl2 and an enhanced trend of Bax, as expected, i.e. AMPK can interact with DNAJA1 to inhibit apoptosis.

Although this paper successfully constructed AMPK overexpression cell line, discovered the protein that interacts with it, and verified that AMPK can inhibit apoptosis, how to use AMPK to treat clinical diseases such as diabetes and myocardial infarction needs to be further explored.

PPIs, Protein-protein interactions;

MS, mass spectrometry;

AMPK, AMP-activated protein kinase

AMPKK, AMPK by upstream kinase

CCCP, Carbonyl cyanide 3-chlorophenylhydrazone

mTORC1, mammalian target of rapamycin

DAPI, 4', 6-diaminyl-2-phenylindoles;

RIPA, Radio Immunoprecipitation Assay;

ATP, Adenosine 5'-triphosphate;

LC-MS, Liquid Chromatography-Mass Spectrometry;

Acknowledgement

This work was strongly supported by the Doctoral Foundation of HuBei University of Science and Technology (Grant Number: BK202011) and the Diabetes Open Fund of Hubei University of Science and Technology (Grant Number: 2020TNB17).

Authors’ contributions

Wu Liu and Qingjie Chen wrote the main manuscript text. Jun Gong, Long Wang, Liqiong Ding prepared Figure 1-2, Jieyu Guo, Siao Lu and Baoqing Zhao prepared Figure 3-6. All authors reviewed the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (Grant number: 82270892), the Guidance Project of Scientific Research Program of Hubei Provincial Department of Education (B2019153), the Hubei Provincial Department of Education (Grant Number: Q20202803), the Doctoral Foundation of HuBei University of Science and Technology (Grant Number: BK202011), the Diabetes Open Fund of Hubei University of Science and Technology (Grant Number: 2020TNB17).

Ethics approval and consent to participate

Not applicable.

Consent for publication

All authors agree to publish this research.

Competing interests

The authors have declared that no competing interest exists.

Availability of data and materials

The label-free protein profiling data in this paper is stored in iProX with accession numbers: PXD044248. The data access connection in ProteomeXchange is: https://proteomecentral.proteomexchange.org/cgi/GetDataset?ID=PXD044248. The access link of data in iProX is: https://www.iprox.cn/page/project.html?id=IPX0006806000. Other data and materials used to support the findings of this study are available from the corresponding author upon request.

Supplementary materials

Additional file 1:

The table lists information on the interacting proteins of AMPK. The AMPK overexpression group contained 1045 reciprocal proteins and the CCCP-treated group contained 1705 reciprocal proteins.

Additional file 2:

The PPT document contains original images of full-length blots, includes Figure 2C, 3A, 3B, 5A and 6.

Huber, L.A., K. Pfaller, and I. Vietor, Organelle proteomics: implications for subcellular fractionation in proteomics. Circ Res, 2003. 92(9): p. 962-8.
Wang, X. and L. Huang, Identifying dynamic interactors of protein complexes by quantitative mass spectrometry. Mol Cell Proteomics, 2008. 7(1): p. 46-57.
Roux, K.J., et al., A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells. J Cell Biol, 2012. 196(6): p. 801-10.
Bosch, J.A., C.L. Chen, and N. Perrimon, Proximity-dependent labeling methods for proteomic profiling in living cells: An update. Wiley Interdiscip Rev Dev Biol, 2021. 10(1): p. e392.
Qin, W., et al., Deciphering molecular interactions by proximity labeling. Nat Methods, 2021. 18(2): p. 133-143.
Samavarchi-Tehrani, P., R. Samson, and A.C. Gingras, Proximity Dependent Biotinylation: Key Enzymes and Adaptation to Proteomics Approaches. Mol Cell Proteomics, 2020. 19(5): p. 757-773.
Kim, D.I., et al., An improved smaller biotin ligase for BioID proximity labeling. Mol Biol Cell, 2016. 27(8): p. 1188-96.
Zempleni, J., Uptake, localization, and noncarboxylase roles of biotin. Annu Rev Nutr, 2005. 25: p. 175-96.
Branon, T.C., et al., Efficient proximity labeling in living cells and organisms with TurboID. Nat Biotechnol, 2018. 36(9): p. 880-887.
Cho, K.F., et al., Proximity labeling in mammalian cells with TurboID and split-TurboID. Nat Protoc, 2020. 15(12): p. 3971-3999.
Tourasse, N.J. and W.H. Li, Selective constraints, amino acid composition, and the rate of protein evolution. Mol Biol Evol, 2000. 17(4): p. 656-64.
Martell, J.D., et al., Engineered ascorbate peroxidase as a genetically encoded reporter for electron microscopy. Nat Biotechnol, 2012. 30(11): p. 1143-8.
Mick, D.U., et al., Proteomics of Primary Cilia by Proximity Labeling. Dev Cell, 2015. 35(4): p. 497-512.
Cho, I.T., et al., Ascorbate peroxidase proximity labeling coupled with biochemical fractionation identifies promoters of endoplasmic reticulum-mitochondrial contacts. J Biol Chem, 2017. 292(39): p. 16382-16392.
Yan, Y., et al., Structure and Physiological Regulation of AMPK. Int J Mol Sci, 2018. 19(11).
Hardie, D.G., F.A. Ross, and S.A. Hawley, AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat Rev Mol Cell Biol, 2012. 13(4): p. 251-62.
Fu, A., C.E. Eberhard, and R.A. Screaton, Role of AMPK in pancreatic beta cell function. Mol Cell Endocrinol, 2013. 366(2): p. 127-34.
Wang, S., P. Song, and M.H. Zou, AMP-activated protein kinase, stress responses and cardiovascular diseases. Clin Sci (Lond), 2012. 122(12): p. 555-73.
de Graaf, A.O., et al., Bcl-2 prevents loss of mitochondria in CCCP-induced apoptosis. Exp Cell Res, 2004. 299(2): p. 533-40.
Han, Y.H., et al., Carbonyl cyanide p-(trifluoromethoxy) phenylhydrazone (FCCP) as an O2(*-) generator induces apoptosis via the depletion of intracellular GSH contents in Calu-6 cells. Lung Cancer, 2009. 63(2): p. 201-9.
Kane, M.S., et al., Current mechanistic insights into the CCCP-induced cell survival response. Biochem Pharmacol, 2018. 148: p. 100-110.
Su, Y., et al., Study of FOXO1-interacting proteins using TurboID-based proximity labeling technology. BMC Genomics, 2023. 24(1): p. 146.
Liu, G., L. Wong, and H.N. Chua, Complex discovery from weighted PPI networks. Bioinformatics, 2009. 25(15): p. 1891-7.
Li, X.L., C.S. Foo, and S.K. Ng, Discovering protein complexes in dense reliable neighborhoods of protein interaction networks. Comput Syst Bioinformatics Conf, 2007. 6: p. 157-68.
Zhang, Y., et al., TurboID-based proximity labeling reveals that UBR7 is a regulator of N NLR immune receptor-mediated immunity. Nat Commun, 2019. 10(1): p. 3252.
Hua, F., et al., TRB3 interacts with SMAD3 promoting tumor cell migration and invasion. J Cell Sci, 2011. 124(Pt 19): p. 3235-46.
Herzig, S. and R.J. Shaw, AMPK: guardian of metabolism and mitochondrial homeostasis. Nat Rev Mol Cell Biol, 2018. 19(2): p. 121-135.
Viollet, B. and F. Andreelli, AMP-activated protein kinase and metabolic control. Handb Exp Pharmacol, 2011(203): p. 303-30.
Erratum in: AMPK/MFF Activation: Role in Mitochondrial Fission and Mitophagy in Dry Eye. Invest Ophthalmol Vis Sci, 2022. 63(13): p. 24.
Zhang, T., et al., Metabolic orchestration of cell death by AMPK-mediated phosphorylation of RIPK1. Science, 2023. 380(6652): p. 1372-1380.
Zheng, C., et al., Targeting PFKL with penfluridol inhibits glycolysis and suppresses esophageal cancer tumorigenesis in an AMPK/FOXO3a/BIM-dependent manner. Acta Pharm Sin B, 2022. 12(3): p. 1271-1287.
Xu, J., J. Ji, and X.H. Yan, Cross-talk between AMPK and mTOR in regulating energy balance. Crit Rev Food Sci Nutr, 2012. 52(5): p. 373-81.
Gwinn, D.M., et al., AMPK phosphorylation of raptor mediates a metabolic checkpoint. Mol Cell, 2008. 30(2): p. 214-26.
Zhang, M.H., et al., Effects of AMPK on Apoptosis and Energy Metabolism of Gastric Smooth Muscle Cells in Rats with Diabetic Gastroparesis. Cell Biochem Biophys, 2019. 77(2): p. 165-177.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Interacting proteins of AMPK studied using TurboID proximity labeling technology

Status:

Version 1

Abstract

Objective

Methods

Results

Conclusion

Figures

Introduction

Materials and Methods

Materials

Cell lines and cell culture

Construction of AMPK-TurboID overexpression vector and EGFP-TurboID fusion expression vector

Lentiviral packaging of AMPK-TurboID and plenti-CMV-EGFP plasmids

Construction and validation of AMPK overexpression cell lines

Screening of AMPK biotin labeling time

Effect of adding ATP on biotin labeling

TurboID-based neighboring biotin labeling technology

Affinity purification of biotin-labeled proteins

Liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis

Validation of the protein DNAJA1 interacting with AMPK

Results

Construction of overexpression plasmids and TurboID tagging flow chart

Construction of AMPK-TurboID overexpression stable cell line

Validation of AMPK-TurboID overexpression in stably transduced cell lines

Biotin labeling and silver staining

Mass Spectrometry Data Analysis

Validation of the protein DNAJA1 interacting with AMPK

AMPK interacts with DNAJA1 to participate in anti-apoptosis

Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1