Islr regulates satellite cells asymmetric division through the SPARC/p-ERK1/2 signaling pathway

doi:10.21203/rs.3.rs-3226416/v1

Download PDF

Article

Islr regulates satellite cells asymmetric division through the SPARC/p-ERK1/2 signaling pathway

https://doi.org/10.21203/rs.3.rs-3226416/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 10 Apr, 2024

Read the published version in The FASEB Journal →

Version 1

posted

You are reading this latest preprint version

Satellite cells (SCs) are adult muscle stem cells responsible for muscle regeneration after acute and chronic muscle injuries. The balance between stem cell self-renewal and differentiation determines the kinetics and efficiency of skeletal muscle regeneration. This study assessed the function of Islr in SC asymmetric division. The deletion of Islr reduced muscle regeneration in adult mice by decreasing the SC pool. Islr is pivotal for SC proliferation, and its deletion promoted the asymmetric division of SCs. A mechanistic search revealed that Islr bound to and stabilized secreted protein acidic and rich in cysteine (SPARC), which activated p-ERK1/2 signaling required for asymmetric division. These findings demonstrate that Islr is a key regulator of SC division through the SPARC/p-ERK1/2 signaling pathway. These data provide a basis for treating myopathy.

Biological sciences/Cell biology

Biological sciences/Stem cells

Satellite cells (SCs), located between the basement membrane and the sarcolemma when in a quiescent state, are responsible for the postnatal growth, maintenance, and repair of skeletal muscle^1–4. In response to stimuli, such as weight bearing and trauma, these cells become activated and undergo several rounds of division and eventually differentiate and fuse with each other or with damaged myofibers to make new fibers^5–7. In addition, a small population of activated SCs undergoes self-renewal to replenish the satellite stem cell pool^8,9. During skeletal muscle regeneration, activated SCs express regulatory factors and fuse with each other to form multinucleated myofibers¹⁰. The balance between stem cell self-renewal and differentiation determines the kinetics and efficiency of muscle regeneration. However, the molecular mechanisms regulating SC self-renewal and differentiation are unclear.

Extracellular signal-regulated kinase (ERK)-1 and 2 are ubiquitously expressed hydrophilic non-receptor proteins. These proteins are members of the mitogen-activated protein kinase family and participate in the mitogenic Ras-Raf-MEK-ERK signal transduction cascade ¹¹, which regulates several cellular processes, including migration, adhesion, proliferation, differentiation, survival, metabolism, transcription, and cell cycle progression^12–17. The ERK signaling pathway promotes skeletal muscle regeneration¹⁸. The MAPK-ERK1/2 signaling pathway is implicated in SC proliferation¹⁹ by promoting G1 to S phase transition²⁰ and decreasing p21 expression in SCs from aged mice²¹. However, the role of this pathway in SC asymmetric division is unclear.

Islr, a member of the leucine-rich repeat and immunoglobulin family of proteins²², is a marker of mesenchymal stem cells and is expressed in SCs^23,24. The Islr protein, expressed and secreted by stromal cells, regulates epithelial cell growth during intestinal regeneration and tumorigenesis by inhibiting Hippo signaling and activating YAP in epithelial cells²⁵. Moreover, we have previously shown that Islr regulates myoblast differentiation and skeletal muscle regeneration via the Wnt signaling pathway²⁴. However, the molecular mechanisms by which Islr controls SC fate need to be further studied.

Islr KO impairs injury-induced muscle regeneration

The role of Islr in SCs in vivo was assessed using Islr-KO mice (Supplementary Fig. 1a). The results showed that the regenerative capacity of Bacl₂-injuried tibialis anterior (TA) muscles was lower in Islr-KO mice than in wild-type (WT) counterparts (Supplementary Fig. 1b), evidenced by a significant reduction in the size of myofibers with centralized nuclei in Islr-KO mice on day 5 after injury (Supplementary Fig. 1c,d). The percentage of regenerating myofibers with two or more centralized nuclei was significantly lower in Islr-KO mice than in control mice (Supplementary Fig. 1e), consistent with a previous study²⁴. Moreover, the number of SCs was marginally lower in Islr-KO mice than in control mice (Supplementary Fig. 1f), suggesting that Islr KO decreases the proliferation of SCs.

To elucidate the role of Islr in SC function, Islr was selectively ablated in Pax7-derived cells by crossing Pax7-CreER mice expressing a Cre-ER recombinase from the Pax7 locus, Pax7^{CreERT 26} with Islr^f/f mice to generate Pax7^CreERT/+: Islr^f/f mice (Supplementary Fig. 2a). Following the administration of four consecutive doses of tamoxifen (Supplementary Fig. 2a), SCs were isolated by fluorescence-activated cell sorting (FACS) and cultured²⁷, and the Islr protein was efficiently depleted (Supplementary Fig. 2b). Islr KO did not significantly affect animal survival, and cKO animals displayed no noticeable change in phenotype or TA muscle weight (Supplementary Fig. 2c,d). In addition, there was no significant change in the number of SCs on myofibers at 1 week after tamoxifen injection (Supplementary Fig. 2e). Consistent with this finding, the protein concentration of Pax7 was similar between Islr-cKO and control animals (Supplementary Fig. 2f), indicating that Islr loss did not strongly impact the maintenance of the SC pool in the TA muscle.

Islr-cKO limited the proliferation of SCs and shrank the SC pool

To study the role of Islr in SCs during skeletal muscle regeneration, TA muscle injury was induced using 1.2% BaCl₂²⁸ (Supplementary Fig. 3a). Islr-cKO decreased the regenerative capacity of the TA muscle (Supplementary Fig. 3a). SCs are strongly implicated in skeletal muscle repair²⁹. Therefore, we measured the number of Pax7-positive SCs on days 5 and 7 after injury. The number of SCs was substantially lower in Islr-cKO mice than in control mice on day 5 after injury (Fig. 1a). Similarly, the number of SCs was markedly lower on day 7 after injury (Supplementary Fig. 3b), indicating that Islr helps maintain the stem cell pool after muscle injury.

Next, FACS-isolated SCs were cultured for 5 days and labeled with 5-ethynyl-20-deoxyuridine (EdU) for 2 h. Islr-cKO decreased the number of EdU-positive SCs (Fig. 1b). To elucidate the role of Islr in cell proliferation, myoblasts were immunostained with the cell proliferation marker Ki67. The percentage of Ki67-positive cells was significantly lower in Islr-cKO myoblasts than in control myoblasts (Supplementary Fig. 3c). Moreover, the percentage of MyoD⁺ Ki67⁺ cells was significantly lower in the Islr-cKO group (Supplementary Fig. 3d).

The proliferation potential of SCs during muscle regeneration was assessed by Ki67 immunostaining. Proliferating and differentiating cells are usually present in regenerating skeletal muscle³⁰. The number of Ki67-positive cells was significantly lower than in the TA muscles of Islr-cKO mice than in control mice on day 5 after injury (Fig. 1c). Proliferating cells were labeled with EdU for 2 h, and mice were sacrificed on day 3 after injury (Supplementary Fig. 3e). The number of EdU-positive cells was significantly lower in Islr-cKO mice than in control mice on day 3 after injury (Supplementary Fig. 3f). Freshly isolated extensor digitorum longus (EDL) myofiber explants were cultured for 42 h to allow SC activation and proliferation. The results showed that the number of Pax7⁺ Ki67⁺ cells was significantly lower in myofibers from Islr-cKO mice than in control mice (Fig. 1d). Moreover, the number of MyoD⁺Ki67⁺ cells per myofiber was significantly lower in the Islr-cKO group (Fig. 1e).

Islr KO leads to SC asymmetric division in vivo

To assess the effect of Islr-cKO on satellite cell renewal and differentiation, FACS-isolated SCs were cultured and stained for Pax7 and Ki67. Islr-cKO increase the percentage of self-renewing (Pax7⁺ Ki67⁻) cells and decreased the percentage of differentiated (Pax7⁻ Ki67⁺) cells and the number of Ki67-positive cells (Fig. 2a,b)⁹. Freshly isolated EDL myofiber explants were cultured for 48 h to allow SCs activation and proliferation. Islr-cKO increased the percentage of Pax7⁺ Ki67⁻ cells (Fig. 2c,d), suggesting that Islr reduces the ability of SCs to self-renew and return to a quiescent state. Additionally, Islr-cKO and Islr KO increased the number of dividing SCs asymmetrically expressing Pax7 or MyoD in one of paired cells (Fig. 2e,f; Supplementary Fig. 4a,b), indicating that SCs had distinct fates: self-renewal or differentiation³¹. These results suggest that Islr regulates satellite stem cell division.

Islr prevents the activation of the p-ERK1/2 pathway in SCs

To investigate the molecular mechanisms underlying the effect of Islr on SC division, we performed RNA sequencing (RNA-seq) to interrogate the transcriptomic changes caused by Islr-cKO (Supplementary Fig. 5a). Kyoto Encyclopedia of Genes and Genomes and Gene Ontology enrichment analyses demonstrated that Islr was strongly implicated in the MAPK signaling pathway and that Islr upregulated several genes from ERK1/2 signaling pathway (Fig. 3a,b).

The concentration of phosphorylation ERK1/2 proteins increased in proliferating SCs lacking Islr (Fig. 3c). To confirm these findings, SCs in EDL myofibers were treated with the p-ERK1/2 inhibitor PD98059 or PD184352³² (Supplementary Fig. 5b). PD98059 decreased the rate of asymmetric division (Fig. 3d), the number of Pax7⁺ MyoD⁻ cells per myofiber at 48 h after treatment (Fig. 3e), and the number of Pax7⁺ Ki67⁻ cells in WT mice (Fig. 3f). PD184352 treatment yielded similar results (Supplementary Fig. 5c,d).

We found that p-ERK1/2 was expressed asymmetrically in dividing SCs (Supplementary Fig. 6b), as was the case with phosphorylated p38³³.

Islr binds to and stabilizes SPARC

To elucidate the role of Islr in the p-ERK1/2 pathway, p-ERK1/2 pathway proteins that interact with Islr were predicted using the STRING website³⁴. Co-immunoprecipitation assays showed that exogenous Islr interacted with SPARC in 293T cells (Fig. 4a). In addition, Islr and SPARC were co-localized in the cytoplasm of 293T cells (Fig. 4b). Immunoblot analysis showed that Islr-cKO significantly increased SPAC protein concentrations (Fig. 4c) but not its mRNA levels (Fig. 4c), indicating that Islr decreased SPARC protein concentrations in activated SCs. Islr stabilizes protein through the proteasome pathway²⁴. Therefore, 293T cells were transfected with Islr-GFP and the SPARC-Flag plasmid to determine whether Islr regulates proteasome-dependent degradation of SPARC. Cycloheximide chase assay and treatment with the proteasome inhibitor MG132 revealed that Islr regulated SPARC via the proteasomal degradation (Fig. 4d,e), demonstrating that Islr contributes to the degradation of SPARC. However, Islr stabilizes SPARC via a mechanism other than the ubiquitin-proteasome pathway (Fig. 4f). These results suggest that Islr directly binds to SPARC and causes its proteasome-mediated degradation in SCs.

Islr KO promotes p-ERK1/2 activity through SPARC to stimulate asymmetric division

Although the concentrations of SPARC and p-ERK1/2 proteins increased in Islr-deficient SCs (Supplementary Fig. 3c,4b), whether SPARC regulates p-ERK1/2 activity via an SC-independent mechanism is unknown. To address this question, we transfected proliferating WT SCs with a SPARC siRNA and found that this siRNA decreased the concentration of p-ERK1/2 proteins and the number of Pax7⁺ Ki67– cells (Fig. 5a-c). In addition, PD98059 treatment significantly reduced the number of Pax7⁺ Ki67^–SCs and asymmetric division in EDL myofibers of Islr-cKO mice (Fig. 5d-f). These results indicate that Islr regulates SC division by activating SPARC/p-ERK1/2 signaling.

Islr KO aggravates the dystrophic phenotype in mdx mice

The impact of Islr KO on injury-induced muscle regeneration was assessed in an mdx mouse model, in which mutations in the dystrophin gene leads to long-term myofibers degeneration and regeneration accompanied by the activation and turnover of SCs, mimicking the phenotype of human Duchene muscular dystrophy (DMD)³⁵. Islr-cKO mice were crossed with mdx mice to generate Islr cKO-mdx mice. Two-months-old mdx mice were treated with four consecutive doses of tamoxifen to delete Islr (Fig. 6a). After 7 months, relative TA muscle weight was significantly lower in Islr cKO-mdx mice than in mdx counterparts (Fig. 6b).

Histological analysis revealed that TA muscle fibers and the muscle cross-sectional area were significantly smaller in Islr cKO-mdx mice than in mdx controls (Fig. 6c). These findings suggested that Islr KO in SCs aggravates the dystrophic phenotypes in mdx mice. In addition, the number of Pax7-positive cells decreased remarkably in Islr cKO-mdx mice (Fig. 6d), suggesting that Islr KO impairs SC expansion during muscle regeneration. These results indicate that Islr is essential for replenishing SC pools and stimulating muscle regeneration.

Islr regulates skeletal muscle regeneration by activating canonical Wnt signaling pathways²⁴. Our results showed that Islr KO did not affect the baseline SC pool (Supplementary Fig. 2e) but significantly decreased the number of Pax7-positive SCs during skeletal muscle regeneration in vivo (Fig. 1a). Islr KO impaired muscle regeneration by delaying SC activation and proliferation (Fig. 1d). Additionally, Islr KO strongly increased the mRNA and protein expression of the quiescent SC marker CD34³⁶ (data not shown), indicating that Islr affected the SC niche. Islr also controls SC asymmetric division (Fig. 2e,f). These data demonstrate that Islr has roles in muscle stem cell fate and quiescence.

SPARC, also known as osteonectin and basement membrane protein 40 (BM-40), belongs to the family of matricellular calcium-binding proteins^37–41, involved in several processes, including cell adhesion and motility, angiogenesis, extracellular matrix remodeling⁴², bone metastasis, and epithelial-mesenchymal transition⁴³. SPARC is upregulated in Achilles tendon tissues of rats with heterotopic ossification (HO), and SPARC silencing limits HO progression by reducing the phosphorylation of mitogen-activated protein kinases (MAPKs), including ERK1/2³⁴. We found that the siRNA knockdown of SPARC decreased the number of Pax7⁺ Ki67⁻ SCs (Fig. 5b), confirming the critical role of this protein in controlling SC fate. Nevertheless, the role of SPARC in asymmetric division was not evaluated using gain and loss-of-function approaches. Our results suggest that Islr binds to and regulates SPARC independently of its transcriptional activity (Fig. 4a-c). Moreover, Islr stabilizes SPARC through a mechanism other than the ubiquitin-proteasome pathway (Fig. 4d-f).

MAPK/ERK signaling plays roles in various cellular responses, including activation, proliferation, differentiation, and aging⁴⁴. EGFR inhibitors inhibit SC asymmetric division⁴⁵. Our results demonstrate that p-ERK1/2 stimulates asymmetric division in EDL myofibers (Fig. 3d). Consistent with this finding, p-ERK1/2 inhibition decreased the number of Pax7⁺ MyoD⁻ cells. In addition, p-ERK1/2 was expressed in quiescent SCs (Supplementary Fig. 6a), suggesting that p-ERK1/2 has functions other than SC division. EGF alleviates the DMD phenotype by increasing SC asymmetric division⁴⁵. Our finding showed that Islr KO enhanced SC asymmetric division by upregulating p-ERK1/2. In contrast, Islr KO decreased the SC pool in mdx mice. The conflicting results may be because the loss of SC pools in Islr KO mice was a prerequisite; thus, increasing asymmetric division was insufficient to compensate for the mdx phenotype caused by satellite cell loss.

In summary, our findings provide strong evidence that Islr is implicated in SC asymmetric division through the SPARC-ERK1/2 signaling pathway. Future studies should elucidate the role of p-ERK1/2 signaling in regulating stem cell polarity and assess the therapeutic potential of p-ERK1/2 signaling for muscular diseases.

Animal Studies

All experiments were performed in accordance with the China Agricultural University’s Guide for the Care and Use of Laboratory Animals. The study was approved by the Research Ethics Committee of the Laboratory Animal Center of China Agricultural University. Pax7-CreER: Islr^fl/fl mice were generated on a C57BL/6 background, as described previously²⁴. Genotypes were determined by PCR with tail DNA. The primers used in genotyping are listed in Table 1. To induce Islr KO in these mice, tamoxifen (Sigma-Aldrich) dissolved in corn oil (Sigma-Aldrich) was injected intraperitoneally in 2-month-old mice on four subsequent days (40 mg/kg). Muscle injury was generated by injecting 75 µl of 1.2% BaCl₂ solution (Sigma-Aldrich) into the TA muscle of anesthetized mice. The study is reported in accordance with ARRIVE 2.0 guidelines.

Table 1

PCR Primer
Primer name	Sequence (5’ to 3’)
Pax7-creER-F	GCCTGCATTACCGGTCGATGC
Pax7-creER-R	CAGGGTGTTATAAGCAATCCC
Islr-Flox-F	GCGAGCAATCCAGTCCTTA
Islr-Flox-R	CCTGTTCTGTTCAAACTATCCC
Islr-creERT-1F	GGTTGGCTATAAAGAGGTCATCAG
Islr-creERT-1R	AGCAACTAGCACTAGAGATGATGAG
Islr-creERT-2F	TTTGTTGGGCTGTTCTCCTG
Islr-creERT-2R	CATCTTGGCTGGGCTGGTA
Islr-creERT-3F	TCTATGACCTGCTGCTGGAG
Islr-creERT-3R	GCTGAACTTGTGGCCGTTTA

Myofiber Isolation and Culture

Extensor digitorum longus (EDL) muscles were dissected and digested with collagenase I (Sigma-Aldrich) in DMEM media (Gibco) at 37°C for 75 min, as described previously²⁴. Myofibers were cultured in DMEM containing 10% horse serum, 0.5% chick embryo extract, and 1% penicillin–streptomycin. The fibers were cultured at 37°C in a 5% CO₂ atmosphere for 48–72 h. Freshly isolated fibers were fixed with 4% paraformaldehyde for 20 min and stained for Pax7, MyoD, Ki67, and DAPI.

Satellite Cells Isolation and Culture

SCs were sorted using established methods²⁷. Hindlimb muscles were digested with 0.2% type II collagenase and 2.5 U/ml dispase (Roche) for 60 min at 37°C. The cell suspension was filtered with a 40-µm cell strainers. Cells were stained with primary antibodies (CD31-PE-Cy7, CD45-FITC, Sca1-PerCP and α7-integrin-APC) for 30 min on ice. SCs were isolated by FACS (Beckman Coulter, USA) following the manufacturer’s instructions. Isolated SCs were cultured in DMEM medium containing 20% FBS (Gibco), basic fibroblast growth factor (Invitrogen), and 1% penicillin-streptomycin at 37°C in a 5% CO₂ atmosphere.

Cell Proliferation Assay

Cell proliferation was measured in vitro and in vivo using a cell proliferation assay. SCs were seeded in 24-well plates and incubated at 37°C in a 5% CO₂ atmosphere for 5 days. Then, cells were labeled with EdU for 2 h using a Click-iT EdU Cell Proliferation Assay Kit (Invitrogen). To assess cell proliferation in vivo, EdU was injected into abdominal cavity. Regenerating TA muscles were harvested from Islr-cKO and control mice 3 days after injury.

Western Blotting and Immunoprecipitation Analysis

SCs were collected and lysed in RIPA buffer (CST). Proteins were separated by 10% SDS-PAGE. For immunoprecipitation (IP), HEK293T cells were lysed with IP lysis buffer (Beyotime), and the total protein was immunoprecipitated with an anti-Flag or anti-Islr antibody bound to protein A/G beads (Thermo Fisher) and anti-FLAG beads (MCE). Immunocomplexes were washed with the same buffer five times and analyzed by western blotting. Samples were incubated with primary antibodies against Pax7 (1:500, Developmental Sdudies Hybridoma Bank [DSHB], Iowa, USA), p-ERK1/2 (1:1000, CST), ERK1/2 (1:1000, CST), FLAG (1:1000, Sigma-Aldrich), SPARC (1:1000, Abclonal), Islr (1:1000, Sigma-Aldrich), GAPDH (1:10000, CST), β-tubulin (1:10000, Abcam), ubiquitin (1:1000, Abcam), and IgG (1:300, Beyotime).

Immunofluorescence

TA muscle sections, myofiber cells, and SCs were stained using established methods ²⁷ and incubated with the following primary antibodies: mouse anti-Pax7 (1:100, DSHB), rabbit anti-MyoD (1:100, sc-760, Santa Cruz), rabbit anti-laminin (1:1000, L9393, Sigma-Aldrich), and rabbit anti-Ki67 (1:500, Invitrogen).

Plasmids and RNA Interference

To construct a plasmid encoding SPARC-FLAG, the FLAG-tag was fused to the C-terminus of SPARC. Then, SPARC-FLAG was cloned into the BamHI and EcoRI sites of the pcDNA3.1(+) vector (Invitrogen). Islr-GFP (MG206818) was purchased from OriGene. The nucleotide sequences of SPARC siRNAs are shown in Table 2.

Table 2

The sequences of Sparc siRNAs were as follows
Primer name	Sequence (5’ to 3’)
Sparc siRNA1 sence	5′-GGAGAUAGUGGAGGAGGAATT-3′
Sparc siRNA1 antisence	5′-UUCCUCCUCCACUAUCUCCTT-3′
Sparc siRNA2 sence	5′- CCAGAACCAUCAUUGCAAATT-3′
Sparc siRNA2 antisence	5′-UUUGCAAUGAUGGUUCUGGTT-3′
Sparc siRNA3 sence	5′- GCAAUGACAACAAGACCUUTT-3′
Sparc siRNA3 antisence	5′-AAGGUCUUGUUGUCAUUGCTT − 3′

Cell Culture, Transfections, and Drug Treatment

C2C12 and HEK293T cell lines were purchased from the Chinese Academy of Medical Sciences and the School of Basic Medicine at Peking Union Medical College. First, cells were transfected with 2 µg of the SPARC-Flag vector, Islr-GFP vector, or a negative control vector using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. Then, cells were incubated with different concentrations of MG132 (Sigma-Aldrich) and cycloheximide (Sigma-Aldrich). FACS-isolated SCs or myofibers were treated with PD98059 (MCE) or PD184352 (MCE) according to the manufacturer's recommendations.

RNA sequencing and Data Analysis

For mRNA microarrays, total RNA was collected from cultured SCs from Islr-cKO and control mice and sequenced by Tangtangtianxia Biotechnology (Beijing, China). Library construction, sequencing and bioinformatics analysis were performed using standard protocols.

Quantitative Real-time Polymerase Chain Reaction (qRT-PCR)

Total RNA from SCs was extracted with TRIzol reagent (Invitrogen) according to the manufacturer’s recommendations. First-strand complementary DNA was synthesized from 1 µg of RNA using a Promega RT system according to the manufacturer’s guidelines. PCR was performed using a Light Cycler 480 Real-time PCR system (Roche). Primers are shown in Table 3.

Table 3

The q-PCR primers were as follows
Primer name	Sequence (5’ to 3’)
Sparc-forward	5′-GTGGAAATGGGAGAATTTGAGGA-3′
Sparc-reverse	5′-CTCACACACCTTGCCATGTTT-3′
GAPDH-forward	5′-CCCAGAAGACTGTGGATGG-3′
GAPDH-reverse	5′-ACACATTGGGGGTAGGAACA-3′

Statistical Analysis

At least three biological replicates were used in each assay. The cross-sectional areas of TA muscle fibers were measured using ImageJ software. Data were analyzed using Microsoft Excel. Statistical significance was assessed by the student’s t-test.

Data availability

RNA-sequencing data were deposited in the NCBI GEO under the Accession Number GSE210951 and enter token efufwysmbrirpun into the box. (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE210951)

Acknowledgements

We thank Liying Du and other members of the Flow Cytometry group of National Center for Protein Sciences at Peking University for technical assistance.

Authors' contributions

F. L., and X. W., designed the study, provided the research material, collected and analyzed data, and wrote the manuscript. K. Z., Y, S., and Y, C., Collected and analyzed data and wrote the manuscript. Q. M., designed the study, provided administrative and financial support, and revised the manuscript.

Funding

This study was supported by the National Key Research and Development Program of China (2021YFF1000603), the National Natural Science Foundation of China (31790412, 31970712), the Beijing Natural Science Foundation (5222013), the China Agriculture Research System of MOF and MARA, the Project for Extramural Scientists of the State Key Laboratory of Agrobiotechnology (2020SKLAB6-9), and the National Research Facility for Phenotypic and Genotypic Analysis of Model Animals (Beijing). The funding bodies played no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Competing interests

The authors declare that they have no conflicts of interest.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Almada, A.E. & Wagers, A.J. Molecular circuitry of stem cell fate in skeletal muscle regeneration, ageing and disease. Nat Rev Mol Cell Biol 17, 267–279 (2016).
Mauro, A. Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol 9, 493–495 (1961).
Wang, Y.X. & Rudnicki, M.A. Satellite cells, the engines of muscle repair. Nat Rev Mol Cell Biol 13, 127–133 (2011).
Collins, C.A., et al. Stem cell function, self-renewal, and behavioral heterogeneity of cells from the adult muscle satellite cell niche. Cell 122, 289–301 (2005).
Aziz, A., Sebastian, S. & Dilworth, F.J. The origin and fate of muscle satellite cells. Stem Cell Rev Rep 8, 609–622 (2012).
Bentzinger, C.F., Wang, Y.X. & Rudnicki, M.A. Building muscle: molecular regulation of myogenesis. Cold Spring Harb Perspect Biol 4(2012).
Relaix, F. & Zammit, P.S. Satellite cells are essential for skeletal muscle regeneration: the cell on the edge returns centre stage. Development 139, 2845–2856 (2012).
Abou-Khalil, R. & Brack, A.S. Muscle stem cells and reversible quiescence: the role of sprouty. Cell Cycle 9, 2575–2580 (2010).
Yin, H., Price, F. & Rudnicki, M.A. Satellite cells and the muscle stem cell niche. Physiol Rev 93, 23–67 (2013).
Zammit, P.S. Function of the myogenic regulatory factors Myf5, MyoD, Myogenin and MRF4 in skeletal muscle, satellite cells and regenerative myogenesis. Semin Cell Dev Biol 72, 19–32 (2017).
Wortzel, I. & Seger, R. The ERK Cascade: Distinct Functions within Various Subcellular Organelles. Genes Cancer 2, 195–209 (2011).
Voisin, L., Saba-El-Leil, M.K., Julien, C., Fremin, C. & Meloche, S. Genetic demonstration of a redundant role of extracellular signal-regulated kinase 1 (ERK1) and ERK2 mitogen-activated protein kinases in promoting fibroblast proliferation. Mol Cell Biol 30, 2918–2932 (2010).
Wary, K.K., Mariotti, A., Zurzolo, C. & Giancotti, F.G. A requirement for caveolin-1 and associated kinase Fyn in integrin signaling and anchorage-dependent cell growth. Cell 94, 625–634 (1998).
Lopez, J., et al. Src tyrosine kinase inhibits apoptosis through the Erk1/2- dependent degradation of the death accelerator Bik. Cell Death Differ 19, 1459–1469 (2012).
Nett, I.R., Mulas, C., Gatto, L., Lilley, K.S. & Smith, A. Negative feedback via RSK modulates Erk-dependent progression from naive pluripotency. EMBO Rep 19(2018).
Falck Miniotis, M., et al. MEK1/2 inhibition decreases lactate in BRAF-driven human cancer cells. Cancer Res 73, 4039–4049 (2013).
Mendoza, M.C., Vilela, M., Juarez, J.E., Blenis, J. & Danuser, G. ERK reinforces actin polymerization to power persistent edge protrusion during motility. Sci Signal 8, ra47 (2015).
Volonte, D., Liu, Y. & Galbiati, F. The modulation of caveolin-1 expression controls satellite cell activation during muscle repair. FASEB J 19, 237–239 (2005).
Bae, J.H., et al. Satellite cell-specific ablation of Cdon impairs integrin activation, FGF signalling, and muscle regeneration. J Cachexia Sarcopenia Muscle 11, 1089–1103 (2020).
Jones, N.C., Fedorov, Y.V., Rosenthal, R.S. & Olwin, B.B. ERK1/2 is required for myoblast proliferation but is dispensable for muscle gene expression and cell fusion. J Cell Physiol 186, 104–115 (2001).
Li, J., Han, S., Cousin, W. & Conboy, I.M. Age-specific functional epigenetic changes in p21 and p16 in injury-activated satellite cells. Stem Cells 33, 951–961 (2015).
Nagasawa, A., et al. Cloning of the cDNA for a new member of the immunoglobulin superfamily (ISLR) containing leucine-rich repeat (LRR). Genomics 44, 273–279 (1997).
Maeda, K., et al. Identification of Meflin as a Potential Marker for Mesenchymal Stromal Cells. Scientific reports 6, 22288 (2016).
Zhang, K., et al. Islr regulates canonical Wnt signaling-mediated skeletal muscle regeneration by stabilizing Dishevelled-2 and preventing autophagy. Nat Commun 9, 5129 (2018).
Xu, J., et al. Secreted stromal protein ISLR promotes intestinal regeneration by suppressing epithelial Hippo signaling. EMBO J 39, e103255 (2020).
Lepper, C., Conway, S.J. & Fan, C.M. Adult satellite cells and embryonic muscle progenitors have distinct genetic requirements. Nature 460, 627–631 (2009).
Su, Y., et al. Fate decision of satellite cell differentiation and self-renewal by miR-31-IL34 axis. Cell Death Differ 27, 949–965 (2020).
DalleDonne, I., Milzani, A. & Colombo, R. Effect of replacement of the tightly bound Ca2 + by Ba2 + on actin polymerization. Arch Biochem Biophys 351, 141–148 (1998).
Schultz, E. & Jaryszak, D.L. Effects of skeletal muscle regeneration on the proliferation potential of satellite cells. Mech Ageing Dev 30, 63–72 (1985).
Ono, Y., Gnocchi, V.F., Zammit, P.S. & Nagatomi, R. Presenilin-1 acts via Id1 to regulate the function of muscle satellite cells in a gamma-secretase-independent manner. J Cell Sci 122, 4427–4438 (2009).
Kuang, S., Kuroda, K., Le Grand, F. & Rudnicki, M.A. Asymmetric self-renewal and commitment of satellite stem cells in muscle. Cell 129, 999–1010 (2007).
Shang, J., Lu, S., Jiang, Y. & Zhang, J. Allosteric modulators of MEK1: drug design and discovery. Chem Biol Drug Des 88, 485–497 (2016).
Bernet, J.D., et al. p38 MAPK signaling underlies a cell-autonomous loss of stem cell self-renewal in skeletal muscle of aged mice. Nat Med 20, 265–271 (2014).
Wang, Q., et al. Silencing of SPARC represses heterotopic ossification via inhibition of the MAPK signaling pathway. Biosci Rep 39(2019).
Bulfield, G., Siller, W.G., Wight, P.A. & Moore, K.J. X chromosome-linked muscular dystrophy (mdx) in the mouse. Proc Natl Acad Sci U S A 81, 1189–1192 (1984).
Beauchamp, J.R., et al. Expression of CD34 and Myf5 defines the majority of quiescent adult skeletal muscle satellite cells. J Cell Biol 151, 1221–1234 (2000).
Riley, H.J. & Bradshaw, A.D. The Influence of the Extracellular Matrix in Inflammation: Findings from the SPARC-Null Mouse. Anat Rec (Hoboken) 303, 1624–1629 (2020).
Rosset, E.M. & Bradshaw, A.D. SPARC/osteonectin in mineralized tissue. Matrix Biol 52–54, 78–87 (2016).
Camacho, D., et al. SPARC-p53: The double agents of cancer. Adv Cancer Res 148, 171–199 (2020).
Chen, S., et al. Regulation of SPARC family proteins in disorders of the central nervous system. Brain Res Bull 163, 178–189 (2020).
Jorgensen, L.H., et al. SPARC Interacts with Actin in Skeletal Muscle in Vitro and in Vivo. Am J Pathol 187, 457–474 (2017).
Bradshaw, A.D. & Sage, E.H. SPARC, a matricellular protein that functions in cellular differentiation and tissue response to injury. J Clin Invest 107, 1049–1054 (2001).
Feng, J. & Tang, L. SPARC in Tumor Pathophysiology and as a Potential Therapeutic Target. Curr Pharm Des 20, 6182–6190 (2014).
Boucher, M.J., Jean, D., Vezina, A. & Rivard, N. Dual role of MEK/ERK signaling in senescence and transformation of intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol 286, G736-746 (2004).
Wang, Y.X., et al. EGFR-Aurka Signaling Rescues Polarity and Regeneration Defects in Dystrophin-Deficient Muscle Stem Cells by Increasing Asymmetric Divisions. Cell Stem Cell 24, 419–432 e416 (2019).

No competing interests reported.

SupplementaryMaterials.docx

Download PDF

Journal Publication

published 10 Apr, 2024

Read the published version in The FASEB Journal →

Version 1

posted

You are reading this latest preprint version

Islr regulates satellite cells asymmetric division through the SPARC/p-ERK1/2 signaling pathway

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Discussion

Methods

Statistical Analysis

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1