Chinese herbal compound Xinfeng capsule inhibits cartilage extracellular matrix degradation and inflammation in osteoarthritis by modulating circ_0032131 and the miR-502-5p/TRAF2 axis

doi:10.21203/rs.3.rs-3239039/v1

Download PDF

Research Article

Chinese herbal compound Xinfeng capsule inhibits cartilage extracellular matrix degradation and inflammation in osteoarthritis by modulating circ_0032131 and the miR-502-5p/TRAF2 axis

https://doi.org/10.21203/rs.3.rs-3239039/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objective

We intended to explore the anti-inflammatory and chondroprotective effects of Xinfeng capsule (XFC) in osteoarthritis (OA), perhaps through the regulation of hsa_circ_0032131 and miR-502-5p/TRAF2 axis.

Materials and methods

In total, 30 patients with OA and healthy subjects were recruited. To detect markers of cartilage metabolism and inflammation, peripheral blood mononuclear cells (PBMCs) were taken out. Subsequently, network pharmacology was employed to forecast OA-related targets and pathways for XFC therapy. To investigate the function of upregulated hsa_circ_0032131 in model cells.A series of functional experiments revealed the relationship between hsa_circ_0032131 and miR-502-5p/TRAF2 axis. To further determine whether XFC potentially treats OA through the interaction between circ_0032131 and miR-502-5p/TRAF2 axis. CKK-8 assay and flow cytometry were performed to detect cell proliferation and apoptotic processes in XFC-treated cells. Some conventional experimental methods were used to detect the expression levels of inflammatory factors, extracellular matrix and others. In addition, rescue experiments verified that XFC blocked the effects of hsa_circ_0032131 overexpression on extracellular matrix, inflammation and cell viability.

Results

Clinical observations indicated that the expression of hsa_circ_0032131 in PBMCs of OA patients was significantly elevated, and there was a correlation with clinical immuno-inflammatory factors and inflammatory indicators. Network pharmacology verified that the chief active ingredients of XFC exerted their roles mainly in the regulation of inflammation (IL1A, IL1B, IL4), extracellular matrix metabolism (MMP13, COL2A1), and tumour necrosis factor (TNF, TRAF2). In vitro experiments revealed that knockdown of circ_0032131 inhibited apoptosis, inflammatory and ECM degradation in PBMCs-stimulated chondrocytes. Circ_0032131 was verified to be a sponge of miR-502-5p by targeting, and TRAF2 was a direct target of miR-502-5p. By regulating circ_0032131 and miR-502-5p/TRAF2 axis, XFC prevented PBMCs-stimulated chondrocytes from responding to inflammation and ECM degradation.

Conclusion

The XFC suppressed inflammatory response and extracellular matrix metabolism in OA by regulating circ_0032131 and miR-502-5p/TRAF2 axis.

Inflammation

Osteoarthritis

Xinfeng capsule

Circ_0032131

Extracellular matrix metabolism

Osteoarthritis (OA) is a devastating disease and a significant contributor to disability ^[1]. Some of the major factors driving the progression of OA are chronic inflammation and disordered extracellular matrix (ECM) ^[2]. Alterations in the microenvironment caused by inflammation further impair cellular function by altering ECM production ^[3]. It is therefore crucial to probe for effective therapeutic approaches to prevent ECM degradation.

Endogenous non-coding RNAs identified as circular RNAs (circRNAs) have a strong closed-loop structure and regulate a variety of cellular processes ^[4–6]. Recently, the potential for hsa_circRNA_0032131 to be exploited as a diagnostic marker was noticed by Wang Y et al. ^[7] after microarray sequencing of differentially expressed circRNAs in healthy and OA articular cartilage. Additionally, hsa_circ_0032131, which has a certain diagnostic worth, was expressed differently in the peripheral blood mononuclear cells (PBMCs) of OA patients ^[8]. Preliminary experiments in this study showed that hsa_circ_0032131 was upregulated in OA peripheral blood mononuclear cell specimens. However, reports on the molecular mechanism of circ_0032131 in OA are scarce and would be valuable for further investigation.

It has been proven that microRNAs serve as essential for controlling cartilage metabolism ^[9]. MiRNA (miR)-502-5p has been recognized as a prospective target for circ_0032131 by miRNA target prediction and preliminary testing. By aimed at tumour necrosis factor receptor related factor 2 (TRAF2) and suppressing the NF-kappa signaling pathway, miR-502-5p may be able to protect chondrocytes against IL-1-induced cellular injury ^[10]. An articulating protein called TRAF2 is essential for attenuating chondrocyte apoptosis and inflammation ^[11–12]. Therefore, TRAF2 is likely to be an interesting therapeutic target candidate for cartilage loss in arthritis.

A type of Chinese patent medication known as Xinfeng capsule (XFC) was approved by the Anhui Province Food and Drug Administration in 1997 (Anhui medicine system drug approval No. Z20050062), which is mainly composed of Radix Astragali (Chinese name Huangqi; Astragalus membranaceus (Fisch.) Bunge.), Radix et Rhizoma Tripterygii Wilfordii (Chinese name Leigongteng; Tripterygium wilfordii Hook. f.), Semen (Chinese name Yiyiren;Coicis Coix lacryma-jobi L. var. ma-yuen(Roman.)Stapf.) and Centipede(Chinese name Wugong; Scolopendra subspinipes mutilans L. Koch). Previous research has demonstrated that fingerprint graphs generated by the High Efficiency Liquid Phosphorography (HPLC) can attest to XFC's employing reliable production procedures and stringent quality controls ^[13]. Several research has clarified that XFC may alleviate OA patients' sensations of joint pain and the aberrant inflammatory immune response ^[14]. Nevertheless, the mechanism of action remains to be further pursued.

In order to simulate local biological effects in the body, an in vitro co-culture system can be employed using PBMCs, which are distinguished by a multicellular composition like that of the immune system ^[15–16]. Hence, in our experiments, PBMCs were used to stimulate local chondrocytes as a model to imitate the overall regulation of OA by TCM therapy. Firstly, the expression of hsa_circ_0032131 in OA PBMCs was clinically observed, and its relationship with immuno-inflammatory indicators and ECM was evaluated. Subsequently, the possible components and pathways of XFC for the treatment of OA were distinguished by network pharmacology. Finally, we explore the function of hsa_circ_0032131 in OA chondrocytes stimulated by PBMCs in terms of inflammation and ECM breakdown and uncover putative epigenetic regulatory pathways involving hsa_circ_0032131, miR-502-5p, and TRAF2. We also investigated the underlying mechanisms of XFC in regulating inflammatory injury and ECM metabolism in OA chondrocytes. The flow chart of our project is illustrated in Fig. 1.

2.1 Recruitment of medical patients

The First Affiliated Hospital of Anhui University of Traditional Chinese Medicine's Ethics Committee authorized the experiment, and it was carried out in compliance with the Declaration of Helsinki Principles (Review No. 2022MCZQ01). The project involved the recruitment of 30 OA patients ^[17] who were inpatients at the Department of Rheumatology from January 2023 to May 2023and the physical evaluation of 30 healthy volunteers over the same time period. All subjects gave their informed consent. Clinical data were used to exclude secondary OA and other inflammatory joint disorders. All 30 patients with OA were treated with XFC (each capsule containing 0.4 g of raw drug) ,1.2g each time, 3 times a day, for 30 days. Age, body mass index (BMI), gender, c-reactive protein (CRP), erythrocyte sedimentation rate (ESR), immunoglobulin (Ig) A, IgM, IgG, complement C3 and complement C4 were all gathered as clinical data from all individuals.

2.2 Network pharmacological analyses

2.2.1 Screening of the targets and active components in XFC.

All of the compounds in XFC have been consulted and evaluated in TCM websites and literature. The compounds of Huangqi, Leigongteng and Yiyiren were acquired from TCMSP platform (https://tcmsp-e.com/tcmsp.php) ^[18]. Known criteria (OB ≥ 30% and DL ≥ 0.18) were implemented to evaluate potential compounds ^[19]. Drug-like (DL) qualities suggest how closely a molecule resembles well-known medications, while oral bioavailability (OB) implies how quickly a drug enters the bloodstream following oral administration. Additionally, Wugong-related compounds and targets that have been foreseen or verified through literature have been uncovered ^[20–21]. The targets for the aforementioned compounds were predicted and screened using the Swiss Target Prediction Tool (http://www.swisstargetprediction.ch/).

2.2.2 Verified OA-related genes.

Seven databases were investigated to uncover the confirmed targets for therapy in OA. The DisGeNET database was scanned for genes with evidence value equal to one for gene-disease association. In addition, OA-related genes in GeneCards, TTD, DrugBank, Malacards, OMIM, and PharmGkb databases were collected. Target IDs and gene symbols were labelled in accordance with the UniProtKB database. The Venn diagram was adopted to intersect the XFC active ingredient targets with the therapeutic targets of osteoarthritis to obtain the co-intersected targets.

2.2.3 Network analysis.

The co-intersected targets were added to the STRING 11.0 database for protein-protein interaction (PPI) network topology analysis (a composite score > 0.7 was standard). Cytoscape (version 3.7.2) software was applied to analyze and visualize the interaction networks. Six network topology parameters for common goals were computed with the CytoNCA plugin ^[22] (including "Betweenness", "Closeness" and "Degree", "Eigenvector", "LAC", " Network") as the basis for scoring. The importance of the node above in the network increases with the size of its parameter ^[22]. As key network targets, node targets with topological metrics greater than the median were selected. Pathway enrichment analysis was then implemented using Kyoto Gene Encyclopedia and Genome Database.

2.2.4 Molecular docking validation

Protein receptor structures were acquired from the RCSB protein database. The client software of Discovery Studio 2021 was subsequently utilized to open the protein structures. From the PubChem database, the proper small molecule structures were retrieved. AutoDock Vina performs molecular docking of processed small molecules and proteins ^[23].

2.3 Extraction of PBMCs and cell co-culture

Subjects’ venous blood was collected using EDTA anticoagulation tubes and PBMCs were isolated and extracted using Ficoll gradient centrifugation. Human primary osteoarthritic chondrocytes (HUM-iCell-s044) and human primary chondrocytes (HUM-iCell-s018) were purchased from Saibaikang iCell Bioscience Inc (Shanghai, China). The cells were incubated at 37°C in a 5% by volume CO2 incubator using Dulbecco’s modified Eagle medium (DMEM, Thermo Fisher Scientific, USA), which contains 10% fetal bovine serum (FBS).

We separated 3–6 generations of chondrocytes for the experiments. The cells are inoculated into a new dish at a ratio of 1:3 and cultured with the appropriate complete medium until the cell density reaches 80–90%. PBMCs and chondrocytes were co-cultured in transwells for 48 hours with chondrocytes in the basolateral chamber and apical chamber, respectively. The chondrocytes were then grown in the basolateral chamber, while the PBMCs were cultured in the apical chamber. Each transwell chamber's cells were harvested when cell confluence amounted to 70–90%. Chondrocyte cells were stimulated with PBMCs for the co-culture cell model (PBMCs-CH) setup.

2.4 Preparation of Xinfeng capsule drug serum

Referring to our previously conducted study ^[24], 30 male, pathogen-free SD rats (weighing 180–220 g; SCXK2020-0001, Laboratory Animal Center of Anhui Medical University) were randomized into two groups at random: normal (10 rats) and XFC (20 rats). The XFC group received a gavage of XFC suspension (2.4 g/100g) at a dosage of 2 ml/100g body mass. In addition, the normal group was given an equal amount of 0.9% saline. The drug was administered once in the morning and once at night for seven consecutive days. One hour after the previous administration, blood was collected from the abdominal aorta, and normal rat serum and XFC-containing serum were then separated and froze at -80℃. The animal experimental ethics committee of Anhui University of Traditional Chinese Medicine approved the animal protocol under the following number: AHUCM-RATS-2023020.

2.5 Cell transfection

MiR-502-5p mimics, inhibitors, and counterpart negative controls (NCs), including si-NC, miR-NC, and inhibitor-NC, were all purchased from Shenggong Biological Engineering Co., LTD (Shanghai, China). The short hairpin RNA (shRNA) targeting circ_0000205 (si-circ_0032131) was also obtained from this company. Both the circ_0032131 complete sequence and the TRAF2 coding domain sequence were separately cloned into the pCD5-ciR vector and the pcDNA (zeo+) vector (Gemma Pharmaceutical Technology Co., LTD., Shanghai, China) to create the overexpression plasmids for the two genes. In accordance with the manufacturer's recommendations, the Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA) kit was applied to transfect.

2.6 Cell Counting Kit-8 (CCK-8) Assays for Cell Viability

At 37°C and 5% CO_2, cells were transferred to 96-well plates (5–10×10⁴/ml). Next, 8 µL of CCK-8(BIOSS, Beijing, China) reagent was added to each well, and incubated for another 1–4 h. Finally, the absorbance value of each well was tested at OD450 nm of the enzyme-linked immunoassay detector.

2.7 Flow cytometry assay

Pancreatic digestion followed by centrifugation was used to extract the cells. Cells were then rinsed with ice-cold phosphate-buffered saline (PBS, Hyclone, Shanghai, China) before being re-suspended in 1 ×binding buffer. These cells were then treated in accordance with the Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) kit's instructions (MultiSciences Biotech Co., Ltd., Hangzhou, China) from the manufacturer. Apoptotic cells were checked using a flow cytometry (Beckman Coulter, Shanghai, China) assay and the apoptosis rate was determined.

2.8 Reverse transcriptional quantitative polymerase chain reaction (RT-qPCR)

TRIzol reagent (Life technologies, California, USA) was adopted to extract the total RNA from the cells. CDNA is created via the PrimeScript RT kit (TaKaRa, Japan). SYBR Premix ExTaq kit (TaKaRa, Japan) was employed for real-time quantitative PCR at the ABI 7300. Actin or U6 small nuclear RNA served as the internal reference gene. The classic 2^−ΔΔCt methodology was employed to calculate the fold changes. The experiment was carried out three times. Table 1 contains a list of primer sequences.

Table 1

Primer sequences used in the qRT-PCR reaction.
Gene	Amplicon size (bp)	Forward primer (5'→3')	Reverse primer (5'→3')
circ-0032131	197	GCGTGTTGCTCTATGAGATG	TCTGCCAGTTTACAGTGACC
β-actin	96	CCCTGGAGAAGAGCTACGAG	GGAAGGAAGGCTGGAAGAGT
U6	94	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT
si-circ-0032131-1#	NA	GCAGUAGACUGGUGGGCAAUG	UUGCCCACCAGUCUACUGCAG
si-circ-0032131-2#	NA	GGCGUGUUGCUCUAUGAGAUG	UCUCAUAGAGCAACACGCCCA
si-circ-0032131-3#	NA	CCAGAGAUCCUCCAGGAAAUG	UUUCCUGGAGGAUCUCUGGAG
TARF2	168	GAAGGGAGCATTCCTAGACC	TGGCAAGCTCTCACACTTTA
miR-502-5p	61	ACACTCCAGCTGGGATCCTTGCTATCTGG	TGGTGTCGTGGAGTCG

2.9 Dual-Luciferase reporter (DLR) and RNA immunoprecipitation (RIP).

The starBase website was used to forecast the potential binding sites between miR-502-5p and circ-0032131 or TARF2. To create wild type (WT) versions of circ-0032131 (circ-0032131 WT) and TARF2 3'UTR WT luciferase reporters, the full length of circ-0032131 and a fragment of TARF2's 3'untranslated region (3'UTR) were independently produced by the PCR method. Additionally, the seed locations of the TARF2 3'UTR MUT and circ-0032131 MUT luciferase reporters were altered based on the respective WT vectors to produce the mutant types (MUT) of the luciferase reporters. The luciferase reporter and miR-502-5p or miR-NC were co-transfected as directed, and three duplicates of each reaction were carried out. The Dual-Lucy Assay Kit was utilised to measure the luciferase activity. Following the manufacturer's instructions, the Magna RIPTM RNA Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA, USA) and Ago2 Ab were applied to perform the RIP test on the primary chondrocytes, using lgG as a control.

2.10 Enzyme-linked immunosorbent assay (ELISA).

Following the directions on the ELISA kit (Wuhan Genmei Science and Technology Co., Ltd., Wuhan, China), serum levels of IL-1, TNF-α, IL-4, and IL-10 were detected.

2.11 Western blot (WB).

To extract total protein, cells were lysed with Beyotime's RIPA buffer (Shanghai, China). Bicarbonate acid (BCA, Beyotime, Shanghai, China) protein test was performed to determine the total protein level. The obtained protein samples received a 1:4 addition of 5 SDS-PAGE protein uploading buffer (Solarbio, Beijing, China). The proteins were then electrophoretically transferred to a PVDF membrane (Millipore, Shanghai, China), which was then sealed with 5% skimmed milk and left at room temperature for one hour. The following primary antibodies were added: anti- ADAM metallopeptidase with thrombospondin type 1 motif 5 (ADAMTS5) (1:1000, Abcam, Cambridge, UK), anti- collagen type II alpha 1 chain (COL2A1) (1:1000, Abcam, Cambridge, UK), anti-TRAF2 (1:1000, Bioss, Beijing, China), anti- matrix metallopeptidase 13 (MMP13) (1:1000, Abcam, Cambridge, UK), and anti-GAPDH (1:1000, Zsbio, Beijing, China). After being washed, the cells were treated for two hours with an HRP-conjugated secondary antibody (1:20,000). Finally, the ECL luminescence kit was performed to test the proteins, and the ImageJ software was applied to analyze the film strips. GAPDH was used as an internal reference. All experiments were repeated 3 times.

2.12 Immunofluorescence (IF) staining.

Co-cultured cells (5×10⁴ cells per well) were seeded overnight. Drops of 0.5% TritonX-100 (ebiogo, Jiangsu, China) were capped and incubated in a 37°C incubator for 30 min. Afterwards, the cells were exposed to anti-TRAF2(1:200, Bioss, Beijing, China) and rabbit anti-type II collagen (1:200, Abcam, Cambridge, UK) at 4°C, subsequently were treated at 25–30°C with a secondary goat anti–rabbit IgG antibody (1:400, Bioss, Beijing, China). The nuclei were subsequently stained for 6 minutes with DAPI (ebiogo, Jiangsu, China). Drop by drop, anti-fluorescence quenching agent was introduced. A laser confocal microscope (LSM8800, Carl Zeiss, Shanghai, China) was adopted to take pictures of the TRAF2 staining, and Image-Pro Plus 6.0 software was performed to evaluate the results.

2.13 Statistical analyses

Data analysis and graph processing, where necessary, were carried out using SPSS 22.0 and GraphPad Prism 8.0 software. A t-test or, if applicable, a nonparametric Kruskal-Wallis test was used to determine whether the difference between the two groups was statistically significant. The pearson correlation coefficient was applied for correlation analysis. The mean and standard deviation (SD) were chosen to display the data.

3.1 Baseline patient characteristics

Of the 60 subjects included, 30 healthy control group (HC) (23 males and 7 females) and thirty individuals in the OA group (25 males and 5 females) were enrolled. Regarding gender, age, BMI, IGA, IGM, C3 and C4, there was no discernible difference between the two subject groups (p > 0.05) (Table 2). The difference between the two groups in CRP, ESR and IGG was statistically significant, and the indexes improved after XFC treatment (p < 0.05) (Table 2). Meanwhile, COL2A1, IL-4, and IL-10 levels decreased, whereas MMP13, IL-1β, ADAMTS5, and TNF-α expression levels increased in PBMCs from OA patients (p < 0.01). XFC therapy significantly raised the expression of IL-4, COL2A1, and IL-10 while decreasing the expression of MMP13, IL-1β, ADAMTS5, and TNF-α (p < 0.01) (Fig. 2A-2B). These results indicated that there were ECM metabolic disorders and inflammatory responses in PBMCs from OA patients, and XFC could regulate inflammatory responses and ECM metabolism.

Table 2

Baseline traits of each group's patients.
Variables	HC(n = 30)	OA (n = 30)		p1-value	p2- value
		Pre-treatment	Post-treatment
Gender, Male/female(n)	7/23	5/25	/
Age(year)	56.07 ± 7.10	56.77 ± 7.07	/	> 0.05	/
BMI (kg/m2)	24.33 ± 3.32	24.25 ± 4.13	/	> 0.05	/
ESR (mm/h)	2.37 ± 1.92	31.10 ± 8.72	9.43 ± 1.92	0.000	0.000
CRP (mg/L)	0.30 ± 0.25	21.06 ± 9.48	5.61 ± 3.07	0.000	0.038
IGA(g/L)	1.82 ± 0.59	2.33 ± 1.03	1.87 ± 0.61	0.052	0.051
IGG(g/L)	9.77 ± 1.07	10.86 ± 2.83	8.09 ± 2.64	0.000	0.001
IGM(g/L)	0.95 ± 0.32	1.09 ± 0.58	1.01 ± 0.57	0.053	0.468
C3(g/L))	1.10 ± 0.23	1.15 ± 0.23	1.08 ± 0.31	0.925	0.161
C4(g/L)	0.26 ± 0.07	0.27 ± 0.08	0.23 ± 0.10	0.472	0.053

p1: HC vs. Pre-treatment; p2: Pre-treatment vs. Post-treatment.

3.2 Network pharmacological analysis

3.2.1 Target collection and construction of active ingredient-target maps

Through the TCMSP database, 20 active compounds and 186 targets for Huangqi, 51 active compounds and 141 targets for Leigongteng, and 9 active ingredients and 26 targets for Yiyiren were screened. In addition, 39 compounds and 96 targets of Wugong that have been forecasted or confirmed were gained through the relevant literature ^[20–21]. The compositional information of herbs is shown in Supplementary Table 1. All targets were summarized, duplicate targets and standardised names were removed and corrected to get a total of 286 target genes (Fig. 3B, Supplementary Table 2).

Proven targets for the therapy of osteoarthritis were obtained from seven databases including Disgenet (1827), DrugBank (150), GeneCards (1835), Malacards (63), OMIM (6), PharmGkb (9), and TTD (32). Disease targets were converted into target-human gene IDs in the UniProt database, and duplicates were removed, yielding 2924 targets (Fig. 3A, Supplementary Table 2).

We generated the XFC-component-target network to better comprehend the intricate interactions between components and their related targets. Furthermore, there were 374 nodes (4 plants, 84 ingredients, 286 target) in the network (1236 edges). Components appeared to regulate numerous targets to generate therapeutic effects (Fig. 3C). In particular, nine substances, including quercetin, kaempferol, nobiletin, stigmasterol, 7-O-methylisomucronulatol, triptolide, hederagenin, formononetin, and scolopendrine, which acted on 136,54,37,36,36,32,31,31, and 31 targets, specifically, become the key active compounds for the XFC because of their significant roles in this network. Further, we built a network diagram of these 9 key active compounds with their targets (Fig. 3D).

3.2.2 Discovery of the fundamental mechanisms of XFC in the course of OA therapy.

To probe the underlying mechanism of XFC for the treatment of OA, the candidate targets of XFC were intersected with the therapeutic targets of OA by Venn diagrams, and 172 common targets were obtained (Fig. 3B, Supplementary Table 2). For network topology analysis, the 172 common objectives were imported into the STRING 11.0 database (Fig. 4A). The six network topology parameters for the PPIs were calculated using the CytoNCA plugin as a basis for scoring. Key targets were identified as frequent targets with topological parameters above the median. We carried out three screenings. The final screening threshold was then set as follows: degree > 37, eigenvector > 0.208, LAC > 40.807, betweenness > 2.412, closeness > 0.824, and network > 32.121 (Fig. 4B-4D).

Ten core targets were finally obtained, including interleukin 1 beta (IL1B), mitogen-activated protein kinase 14 (MAPK14), interleukin 1 alpha (IL1A), matrix metallopeptidase 13 (MMP13), the tumour necrosis factor (TNF), NFKB inhibitor alpha (NFKBIA), collagen type II alpha 1 chain (COL2A1), interleukin 4 (IL4), TNF receptor associated factor 2 (TRAF2), and vascular endothelial growth factor A (VEGFA), which has topological significance and likely plays a crucial role (Fig. 4D).

The top ranked results were filtered according to the physiological and pharmacological importance of the enrichment analysis. The numbers of GOBP, GOCC and GOMF were 2385, 53 and 171, respectively. The figure shows the enrichment results with the top 10 p-values as indicated by graphical p-value bars (Fig. 5A). GOBP primarily contained the regulation of mononuclear cell proliferation, the response to tumour necrosis factor, and the response to inflammatory response; GOCC included the collagen-containing extracellular matrix, and the RNA polymerase II transcription regulator complex, and so on; and GOMF consisted of metallopeptidase activity, extracellular matrix binding, nuclear receptor activity.

In addition, we identified 179 related signaling pathways (Fig. 5B). The enrichment results demonstrated that XFC for OA mainly involved the following: TNF signaling pathway, osteoclast differentiation, NF-kappa B signaling pathway, cytokine-cytokine receptor cytokine-cytokine receptor interaction. Based on the above outcomes, it is likely that the key mechanisms of XFC treatment of OA involve regulation of the TNF pathway, inflammatory response, and extracellular matrix metabolism. Some targets are closely related to these signaling pathways and regulate the aforementioned signaling pathways separately, as shown in Fig. 5C. Interestingly, the ten core targets appeared more frequently.

3.2.3 Molecular docking.

To confirm the affinity of the core elements in XFC to the core objectives, a molecular docking approach was carried out. The nine vital elements in XFC with the ten primary targets all had lowest binding energies that were less than − 5 kcal/mol, as shown in Fig. 6, showing superior binding. The following are the strongest binding energy pairings between each main target and the detected components: IL1B to stigmasterol (-7.7 kcal/mol), IL1A to hederagenin(-9.6 kcal/mol), MAPK14 to quercetin(-9.1 kcal/mol), MMP13 to formononetin(-11.2 kcal/mol), TNF to triptolide(-6.7 kcal/mol), NFKBIA to hederagenin(-9 kcal/mol), IL4 to quercetin(-7.8 kcal/mol), TRAF2 to quercetin(-7.0 kcal/mol), COL2A1 to quercetin(-7.1 kcal/mol),VEGFA to formononetin(-7.4 kcal/mol) (Fig. 6–7). According to Fig. 6, it was inferred that kaempferol, quercetin, and formononetin had a predominant function in binding to the major targets mentioned above due to their high affinity (binding energy of -10 kcal/mol).

3.3 Circ_0032131 is over-expressed in PBMCs from OA patients.

Circ_0032131 and TRAF2 were elevated in comparison to the HC group, while miR-502-5p was downregulated (Fig. 8A). It indicated that there was abnormal expression of circ_0032131, TRAF2, and miR-502-5p in PBMCs of OA patients. The ROC curve revealed that circ_0032131 was a valuable indicator (AUC = 0.9244,95%CI = 0.8551–0.9938) (Fig. 8B). Additionally, it was demonstrated that circ_0032131 had a negative correlation with miR-502-5p and a positive correlation with TRAF2 (Fig. 8C, Supplementary Table 3). In addition, the correlation heatmap also showed that circ_0032131 was positively correlated with ESR, IGG, IGM, C4, and IL-1β, and negatively correlated with COL2A1, IL-10, and IL-4; miR-502-5p was positively correlated with IL-10 and COL2A1, and negatively correlated with C4 and TNF-α; TRAF2 was positively linked with ESR, CRP, C3, TNF-α, and ADAMTS5(Fig. 8C, Supplementary Table 3). These findings revealed that circ_0032131 had uncommonly high levels of expression in the PBMCs of OA patients and that it was associated with inflammatory mediators and ECM metabolism.

3.4 Screening of co-culture concentration and time.

Type II collagen immunofluorescence staining was carried out to verify whether the extracted primary cells were chondrocytes or not. As illustrated in Fig. 9A, the cultured cells stained positively for type II collagen fluorescence. At 24, 48, and 72 hours, cell viability was assessed using the CCK8 assay, and various ratios were established as 0:1, 1:1, 2:1, 3:1, 5:1, and 8:1, respectively. The results revealed that the cell viability of PBMCs-CH cells in the 5:1 and 8:1 groups was statistically increased at 24h compared to that of the 0:1 group (p < 0.05); and the cell viability of cells in the 2:1, 3:1, 5:1, and 8:1 groups was statistically enhanced at 48h, and at 72h (p < 0.05). Secondly, cell viability increased significantly (p < 0.05) in 3:1, 5:1, 8:1 at 48h and 72h compared to each ratio group at 24h. The ideal time to take action may be 48 hours because there was no statistically significant difference between each ratio's cell viability at 48 and 72 hours (p > 0.05). The ratio groups were examined after 48 hours, and the results indicated that the 3:1 group's cell viability was higher than that of the 2:1 group's and that there was no statistically significant difference between the cell vitality of the 3:1 group and that of the 5:1 and 8:1 groups (p > 0.05). Therefore, 3:1 was ultimately considered as the optimal stimulation ratio and 48h as the optimal duration of action in this research, and this ratio and duration were applied in all subsequent studies (Fig. 9B).

3.5 Effects of OA-PBMCs on osteoarthritic chondrocytes.

We investigated the level of circ_0032131, miR-502-5p, TRAF2, ECM products, and inflammatory factors in the co-culture model. The outcomes demonstrated that in the NC-PBMCs + OA-CH and Model groups as compared to the NC-CH group, the levels of circ_0032131, TRAF2, ADAMTS5, IL-1, MMP13, and TNF-α was raised, whereas the level of COL2A1, miR-502-5p, IL-4, and IL-10 was decreased. By comparison with the NC-PBMCs + OA-CH group, circ_0032131 and TRAF2 expression was elevated and miR-502-5p was decreased in the Model group (p < 0.01); cartilage synthesis product (COL2A1) expression was decreased, and cartilage decomposition products (MMP13 and ADAMTS5) expression were increased; and inflammation-suppressing factors (e.g. IL-4, IL-10) expression was decreased and pro-inflammatory factors (e.g., IL-1β, TNF-α) expression was elevated (Fig. 9C-9E). These results revealed that co-cultured cells exhibited elevated circ_0032131, TRAF2, decreased miR-502-5p, imbalance of inflammatory factors and ECM metabolism, and that stimulation of PBMCs in OA patients enhanced inflammation and ECM metabolism disorders in chondrocytes.

3.6 Circ_0032131 suppresses cell proliferation while accelerating chondrocyte apoptosis and ECM degradation.

To clarify the potential function of circ_0032131 in co-cultured cells, a series of functional experiments using siRNA and pc-DNA were performed. The si-circ_0032131#2 with the greatest interference efficiency was chosen for further studies based on the RT-qPCR results (Fig. 10A). CKK8 assay and flow cytometry revealed that knockdown of circ_0032131 knockdown via siRNA increased cell viability (Fig. 10B) and reduced high apoptosis rate (Fig. 10E). In addition, deletion of circ_0032131 might down-regulate the level of ADAMTS5 and MMP13 and up-regulate the level of COL2A1, and these results were confirmed by WB (Fig. 10D). Circ_0032131 blockade could down-regulate the expression of inflammation-suppressing factors and up-regulate pro-inflammatory factors (Fig. 10C). Thus, blockade of circ_0032131 attenuated chondrocyte injury by promoting proliferation, inhibiting apoptosis and ECM degradation. In contrast, the over-expression of circ_0032131 accelerated this process.

3.7 Circ_0032131 functions as a ceRNA and indirectly controls the levels of TRAF2 by sponging miR-502-5p.

Circ_0032131 targets the miR-502-5p gene in cartilage tissue, according to prior research ^[25]. Therefore, we hypothesized that circ_0032131 may also target miR-502-5p and regulate its downstream activity in PBMCs-stimulated chondrocytes. The direct connection between miR-502-5p and circ_0032131 was further examined using DLRA. The results demonstrated that co-transfection of circ_0032131-WT and miR-502-5p mimics significantly reduced luciferase activity in chondrocytes, whereas no influence effect of miR-502-5p mimics on luciferase activity was detected after co-transfection with the circ_0032131-MUT group (Fig. 11A). Similarly, the dual luciferase reporter assays revealed that TRAF2 is a direct target of miR-502-5p. (Fig. 11B). Figure 11 also displays the sequence pattern of the binding site between miR-502-5p and TRAF2 (Fig. 11B). Argonaute2 (Ago2) antibody can be utilized for capturing mature miRNAs. Ago2 protein is a crucial part of the RNA-induced silencing complex (RISC). The level of miR-502-5p and TRAF2 was elevated in the si-circ_0032131 group comparing with the si-NC group (p < 0.001), as illustrated in Fig. 11C-11D. After si-circ_0032131, AGO2 bound more miR-502-5p and TRAF2, implying that circ_0032131 could competitively adsorb miR-502-5p and inhibit the entry of miR-502-5p into the RISC complex to degrade TRAF2.

Additionally, we validate the use of trials involving gain and loss functions. The data indicated that circ_0032131 overexpression decreased miR-502-5p mRNA expression (Fig. 11E) and TRAF2 expression increased (Fig. 11F-11G), and its deletion may reverse its level (Fig. 11E-G). Whereas miR-502-5p overexpression decreased TRAF2 levels in these chondrocytes, its deletion may increase its levels (Fig. 11H-11J). In addition, miR-502-5p was elevated (Fig. 11K) and TRAF2 was reduced (Fig. 11L) after si-circ_0032131 transfection, and the inhibitory effect of si-circ_0032131 after co-transfection of chondrocytes with miR-502-5p inhibitor (Fig. 11K-11L) or pcDNA3.1- TRAF2 (Fig. 11M) was obviously reversed.

These outcomes imply that circ_0032131 may serve as a ceRNA by sponging miR-502-5p and indirectly regulating TRAF2 expression.

3.8 MiR-502-5p reverses the impact of circ_0032131 on ECM metabolism and inflammatory response in OA chondrocytes.

The silencing efficiency of this mimics and inhibitor-miRNA was detected (Fig. 12A). To investigate the relationship between miR-502-5p and the functional role of circ_0032131 in chondrocytes, rescue experiments were conducted. We co-transfected miR-502-5p inhibitor with si-circ_0032131. The miR-502-5p inhibitor group displayed higher levels of TRAF2, MMP13, ADAMTS5, IL-1, and TNF-α in comparison to inhibitor-NC, and lower expression of COL2A1, IL-4, and IL-10 (Fig. 12C-12G). Compared with si-circ_0032131, si-circ_0032131 and miR-502-5p inhibitor co-transfected cells showed decreased viability (Fig. 12B), increased apoptosis (Fig. 12E-F), elevated TRAF2 expression (Fig. 12G), elevated pro-inflammatory factors (IL-1β, TNF-α) (Fig. 12C), and decreased inhibitory factors decreased (IL-4, IL-10) (Fig. 12C). Anti-miR-502-5p co-transfection could also lessen the protective effects of circ_0032131 interference on ECM synthesis, rescuing the levels of ADAMTS5 and MMP13 protein expression while reducing COL2A1 levels (Fig. 12D).

These results revealed that depletion of miR-502-5p could attenuate the role of circ_0032131 in chondrocytes, suggesting an inverse interaction between circ_0032131 and miR-502-5p.

3.9 TRAF2 as an exact target for miR-502-5p and positively modulated by circ_0032131.

Firstly, the overexpression vector and silencing efficiency were detected, indicating that the vector construction was successful (Fig. 13A). The levels of TRAF2 were decreased by miR-502-5p overexpression, and its deletion might raise those levels (Fig. 11H-11J). Moreover, the reduction in TRAF2 expression caused by the circ_0032131 knockdown was partially restored by the miR-502-5p inhibitor (Fig. 11L,12G). The role of circ_0032131 and TRAF2 in controlling the OA phenotype was then clarified. In comparison to si-circ_0032131, si-circ_0032131 and pcDNA3.1-TRAF2 co-transfected cells showed decreased viability (Fig. 13B), increased apoptosis (Fig. 13C,13D), elevated pro-inflammatory mediators (IL-1β, TNF-α), and decreased anti-inflammatory mediators (IL-4, IL-10) (Fig. 13E). The expression of MMP13 and ADAMTS5 in chondrocytes elevated in the presence of pcDNA3.1-TRAF2 in accordance with the level of TRAF2 mean optical density (Fig. 13G), while the expression of COL2A1 was suppressed (Fig. 13F). Knockdown of circ_0032131 restored the inhibitory effect of overexpression of TRAF2 in chondrocytes compared to the pcDNA3.1-TRAF2 group. The above experiments imply that circ_0032131 promotes chondrocyte inflammatory factor secretion and ECM degradation through the miR-502-5p/TRAF2 pathway.

3.10 XFC inhibits inflammatory response and chondroprotection via circ_0032131 and miR-502-5p/TRAF2 axis.

In order to screen the optimal concentration of XFC drug serum containing XFC, we set up media containing 5%, 10%, 20% and 40% of XFC drug serum for cell culture and detected the viability of PBMCs-CH at 24, 48, and 72 hours. The co-culture cell viability gradually increased with increasing XFC concentration compared to the model blank group (p < 0.05). After 24 hours of culture, the proliferative viability of the 5% XFC and 10% XFC cells was lower than that of the 20% XFC at the same time period, and the concentration of 40% XFC did not change significantly. After 48 hours of culture, 40% XFC concentration cell viability was lower than 20% XFC, while 5% and 10% cell proliferation viability was lower than 20% XFC. After 72h of further incubation, the proliferation viability of 20%XFC cells was higher than that of other concentration groups. The maximum value was reached at 48h in 20% XFC. Therefore, serum containing 20% XFC drug was selected for subsequent experiments (Fig. 14A).

Next, as a model of PBMCs-induced chondrocytes, circ_0032131 (Fig. 14B) and TRAF2 (Figs. 14D, 14F, 14H) expressions were decreased and miR-502-5p (Fig. 14C) expression was increased after the intervention of 20% XFC-containing drug serum compared with 20% normal rat serum (p < 0.01). Simultaneously, the protein expression of COL2A1 was elevated, and the MMP13 and ADAMTS5 proteins expression was declined (Fig. 14F), pro-inflammatory mediators reduced, and anti-inflammatory mediators rose (Fig. 14E). On the basis of XFC-containing serum intervention, the circ_0032131 overexpression plasmid was then transfected. The outcomes demonstrated that chondrocyte apoptosis, ECM metabolism, and inflammation were partially reverted by 20% XFC drug-containing serum in response to circ_0032131 overexpression (p < 0.01) (Fig. 14). These outcomes revealed that XFC inhibited PBMCs-induced chondrocyte inflammation and cartilage degradation via circ_0032131 and the miR-502-5p/TRAF2 axis.

There is increasing evidence that OA is a dynamic process that results from joint injury and re-modelling imbalance, with the major cause being an excess of pro-inflammatory substances that trigger chondrocyte apoptosis and matrix deterioration ^[26]. With a comprehensive and synergistic approach, herbal medicine has drawn interest in the cure of OA by preserving the body's equilibrium ^[27]. By integrating clinical observations, network pharmacological techniques, and in-vitro studies, we have methodically evaluated the mechanism of action of Xinfeng capsule in osteoarthritis in our study. Clinical observation indicated that inflammation and cartilage metabolic imbalance existed in PBMCs of OA patients. Network pharmacology has revealed that many of the targets of XFC anti-OA are involved in inflammation and cartilage metabolism. Therefore, we hypothesize that anti-inflammation and chondroprotection are important effects of XFC capsules in the treatment of OA, and provide experimental evidence in patients with PBMCs-stimulated chondrocytes. Overall, this study suggests that XFC may attenuate the OA through a mechanism involving circ_0032131 and the miR-502-5p/TRAF2 axis.

First, it happened that the peripheral blood mononuclear cells of OA patients had inflammation and disturbed cartilage metabolism by comparing the clinical data of OA patients and healthy participants. This was demonstrated by decreased COL2A1, IL-4, and IL-10, and elevated expression of MMP13, IL-1β, ADAMTS5, and TNF-α in PBMCs from OA patients. Inflammatory mediators can further trigger ECM degradation and disrupt endochondral homeostasis ^[28]. Reduction of COL2A1 accelerates chondrocyte hypertrophy and can act as a signaling molecule to regulate chondrocyte differentiation ^[29]. The main matrix metalloproteinase implicated in cartilage degradation is MMP-13, which has a unique capacity to cleave type II collagen ^[30]. The expression and activity of MMP-13 and ADAMTS5^[31] can be enhanced via cartilage ECM breakdown products. Inflammatory response and hyperactivation of matrix remodelling are hence crucial processes in osteoarthritis. Then, no clinically effective medications to treat OA have been developed. A notable development in recent years is the emergence of prospective OA treatment alternatives that target matrix remodelling, including small interfering RNA (siRNA), miRNAs, and other medications.

The investigation of the Chinese medicine compounding mechanism of action is made possible by network pharmacology, which offers novel ideas for research and technical tools. Finally, we collected nine key compounds via the XFC component-target-OA network. Ten core therapeutic targets were filtered by network topology parameter analysis. Functional enrichment analysis indicated that Xinfeng capsule may protect against osteoarthritis by regulating tumour necrosis factor, inhibiting inflammation, regulating extracellular matrix metabolism and regulating the proliferation of single nucleated cells. The outcomes of the aforementioned network analysis offer a quite thorough and macroscopic mechanistic perspective on Xinfeng capsule treatment for osteoarthritis. Interestingly, the core targets were also involved with inflammatory response (IL1A, IL1B, IL4), tumour necrosis factor (TNF, TRAF2), and extracellular matrix (MMP13, COL2A1). The molecular docking results, demonstrated that nine key compounds in XFC stably bound to the above core targets, especially kaempferol, quercetin, formononetin. A previous study reported that quercetin could alleviate osteoarthritis in rats by inhibiting inflammation reaction and apoptosis of chondrocytes ^[32]. Because of its anti-inflammatory and anti-injurious qualities, formononetin may offer a great deal of promise in the treatment of OA ^[33]. Kaempferol can further protect bones by reducing inflammation, osteoclast autophagy, oxidative stress, and osteoblast apoptosis ^[34]. Initially, we investigated the network pharmacology, which mostly regulates inflammation, extracellular matrix metabolism, and tumour necrosis factor, as the mechanism of action of Xinfeng capsule against OA. Further in vitro experiments were performed to verify this.

CircRNA is linked to the progression of OA. The expression of hsa_circ_0032131 was elevated in the peripheral blood of OA patients and correlated with clinical immuno-inflammatory factors (ESR, IGG, IGM, C4) inflammatory indicators (IL-1β, IL-10, IL-4) and COL2A1. However, as valuable indicators, there are limited reports on the biological mechanisms of circ_0032131 modulating the OA process, which would be valuable for further studies. The production of important pro-inflammatory cytokines such TNF-α, IL- 1β, and MMPs is encouraged by monocytes, which are regarded to be a dominant joint-specific determinant. This could contribute to the immediate response of inflammation and joint deterioration ^[35]. Additionally, these cells are a rich source of chemokines that draw more leukocytes into inflamed joints, aggravating the disease process ^[36]. In order to create a in vitro cellular model that accurately represents the in vivo condition of OA patients, chondrocytes were stimulated with PBMCs in osteoarthritis. The results revealed that the expression of circ_0032131, TRAF2 and pro-inflammatory cytokines was increased in OA chondrocytes after PBMCs stimulation in OA patients, while the expression of miR-502-5p, chondrocyte synthesis products, and anti-inflammatory cytokines was decreased, which also further suggested that circ_0032131 was involved in inflammation and chondrogenic metabolism in OA.

Knockdown of circ_0032131 promoted chondrocyte proliferation, while suppressing apoptosis and ECM degradation, and the release of inflammatory cytokines. These results elucidated that circ_0032131 plays a significant role in the development of OA and may be a potential target. CircRNA has been demonstrated to regulate transcriptional or post-transcriptional levels of gene expression. In a previous study, circ_0032131 proved to be located in the cytoplasm with miR-502-5p ^[25]. The present research also showed that circ_0032131 is a binding chaperone for miR-502-5p in OA chondrocytes. Rescue experiments revealed that miR-502-5p inhibitors also reversed the inhibitory impact of circ_0032131 knockdown on chondrocyte damage. TRAF2 was elevated in OA cartilage tissue and targeted by miR-502-5p. Additionally, circ_0032131 were positively correlated with TRAF2. Functionally, TRAF2 overexpression eliminated the inhibitory effect of circ_0032131 knockdown on PBMCs-induced chondrocyte injury. Thus, circ_0032131 can positively regulate TRAF2 expression through sponge miR-502-5p to regulate chondrocyte matrix metabolism and inflammatory responses.

Herbal medicine is a natural resource of compounds with numerous advantages in the treatment of OA. Xinfeng capsule is a Chinese patent drug based on chinese medicine theory for the treatment of OA. A multicentre, randomised, double-blind, controlled (ClinicalTrials.gov number. NCT01774877) demonstrated that XFC is an effective and safe therapy for OA, significantly improving visual analogue scale for pain, Short Form-36 quality of life, WOMAC index total scores, and Lequesne index ^[37]. In addition, using data mining techniques, we discovered a long-range connection between the patient's comprehensive assessment index and the XFC treatment received, that is, the patient's clinical inflammation index and joint pain symptoms got better following XFC treatment ^[38]. The findings of this research revealed that XFC could increase chondrocyte viability and inhibit PBMCs-stimulated chondrocyte inflammation and cartilage degradation, and its mechanism of action might be through the circ_0032131 and miR-502-5p /TRAF2 axis.

In conclusion, this study illustrated that the mechanism of anti-OA of Xinfeng capsule may be to inhibit inflammation and catabolism of chondrocytes by regulating circ_0032131 and miR-502-5p /TRAF2 axis. Xinfeng capsule maybe an alternative treatment for OA.

Nevertheless, there are still several limitations of our research. First, due to the incomplete information in the public database of herbal medicines, there may be compounds that have been missed, which may lead to bias in our study. Second, our results did not distinguish the detailed mechanism of circ_0032131 and miR-502-5p/TRAF2 axis by Xinfeng capsule. Xinfeng capsule may alleviate OA through other signalling pathways.In future work, we will undertake animal experiments to further validate the mechanism of Xinfeng capsule in regulating OA inflammation and cartilage metabolism. Third, the microenvironment of OA chondrocytes is intricate, with various cell types interacting with one another. The cell co-culture system was adopted in our research, which was to observe the interrelationship between two and more cell types, in order to be free from the influence of complex factors in vivo. At the same time, in order to simulate the role of overall regulation of drug therapy for OA, OA chondrocytes were stimulated with PBMCs, which represent the systemic immune response of OA. The combination of whole and local reflects the holistic and global view of the study. It is also a characteristic feature of this study.

Funding Statement

This work was supported by the Anhui Famous Traditional Chinese Medicine Liu Jian Studio Construction Project (Traditional Chinese Medicine Development Secret[2018]No.11),the Ministry of Science and Technology National Key Research and Development Program Chinese Medicine Modernization Research Key Project(No.2018YFC1705204), Anhui Province Traditional Chinese Medicine Leading Talent Project(Traditional Chinese Medicine Development Secret[2018] No. 23), the Anhui key Research and Development Program Foreign Science and Technology Cooperation Project (No. 201904b11020011) and the Anhui Provincial Education Department Project (No. 2022AH050449).

Data Avail Ability Statement

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethics Approval and Consent to Participate

The research protocol and procedures have been approved by the Ethics Committee of the First Affiliated Hospital of Anhui University of Chinese Medicine (Review No. 2022MCZQ01). The animal study was scrutinized by the Animal Ethics Committee of Anhui University of Traditional Chinese Medicine (No. AHUCM-RATS-2023020).

Author Contributions

All authors reviewed and approved the final published version. Conceptualization: Qiao Zhou and Jian Liu; writing and original draft preparation: Qiao Zhou; supervision: Jian Liu；methodology: Qiao Zhou, Yuedi Hu and Yajun Qi.

Disclosure

The authors declare that they have no conflicts of interest to report regarding the present study.

Zhou Q, Jian L, Liu J, Xin L, Fang YY, Wan L, Hung D, Wen JT. DNA methylation as a mediator of epigenetic regulation in the pathogenesis and precision medicine of osteoarthritis: An updated review. Biocell.2023,12(1):1-5. doi:10.32604/biocell.2023.026698.
Nguyen TH, Duong CM, Nguyen XH, Than UTT. Mesenchymal Stem Cell-Derived Extracellular Vesicles for Osteoarthritis Treatment: Extracellular Matrix Protection, Chondrocyte and Osteocyte Physiology. Pain and Inflammation Management. Cells. 2021;10(11):2887. doi:10.3390/cells10112887.
Maldonado M, Nam J. The role of changes in extracellular matrix of cartilage in the presence of inflammation on the pathology of osteoarthritis. Biomed Res Int. 2013; 2013:284873. doi:10.1155/2013/284873
Li HZ, Lin Z, Xu XH, Lin N, Lu HD. The potential roles of circRNAs in osteoarthritis: a coming journey to find a treasure. Biosci Rep. 2018;38(5): BSR20180542. doi:10.1042/BSR20180542.
Li G, Luo H, Ding Z, Liang H, Lai Z, Chen S, Huang Y. Silencing of circ_0000205 mitigates interleukin-1β-induced apoptosis and extracellular matrix degradation in chondrocytes via targeting miR-766-3p/ADAMTS5 axis. Innate Immun. 2022; 28(2):79-90. doi: 10.1177/17534259221077078.
Li G, Tan W, Fang Y, Wu X, Zhou W, Zhang C, Zhang Y, Liu Y, Jiu G, Liu D. circFADS2 protects LPS-treated chondrocytes from apoptosis acting as an interceptor of miR-498/mTOR cross-talking. Aging (Albany NY). 2019;11(10):3348-3361. doi: 10.18632/aging.101986.
Wang Y, Wu C, Zhang F, Zhang Y, Ren Z, Lammi MJ, Guo X. Screening for Differentially Expressed Circular RNAs in the Cartilage of Osteoarthritis Patients for Their Diagnostic Value. Genet Test Mol Biomarkers. 2019;23(10):706-716. doi: 10.1089/gtmb.2019.0108.
Wang Y, Wu C, Yang Y, Ren Z, Lammi MJ, Guo X. Preliminary Exploration of hsa_circ_0032131 Levels in Peripheral Blood as a Potential Diagnostic Biomarker of Osteoarthritis. Genet Test Mol Biomarkers. 2019;23(10):717-721. doi: 10.1089/gtmb.2019.0036.
Kong H, Sun ML, Zhang XA, Wang XQ. Crosstalk Among circRNA/lncRNA, miRNA, and mRNA in Osteoarthritis. Front Cell Dev Biol. 2021; 9:774370. doi: 10.3389/fcell.2021.774370.
Zhang, G., Sun, Y., Wang, Y., Liu, R., Bao, Y., & Li, Q. MiR-502-5p inhibits IL-1β-induced chondrocyte injury by targeting TRAF2. Cellular immunology.2016;302, 50-57. doi:10.1016/j.cellimm.2016.01.007.
Jiang J, Zhang J, Wu C, Guo X, Chen C, Bao G, Sun Y, Chen J, Xue P, Xu G, Cui Z. Up-regulation of TRAF2 inhibits chondrocytes apoptosis in lumbar facet joint osteoarthritis. Biochem Biophys Res Commun. 2018;503(3):1659-1665. doi: 10.1016/j.bbrc.2018.07.096.
Karl I, Jossberger-Werner M, Schmidt N, Horn S, Goebeler M, Leverkus M, Wajant H, Giner T. TRAF2 inhibits TRAIL- and CD95L-induced apoptosis and necroptosis. Cell Death Dis. 2014;5(10): e1444. doi: 10.1038/cddis.2014.404.
Gao L, Wang F, Meng M. Chromatographic fingerprinting and quantitative analysis for the quality evaluation of Xinfeng capsule.Acta Chromatographica.2020;33(1):pp.1-7.doi:10.1556/1326.2020.00743.
Bao B, Liu J, Wan L, Zhang Y, Long Y, Sun G. Xinfeng capsule inhibits immune inflammation in osteoarthritis by inhibiting the miR- 23a-3p/PETN/PI3K/AKT/mTOR pathway. Nan Fang Yi Ke Da Xue Xue Bao. 2021;41(4):483-494. doi: 10.12122/j.issn.1673-4254.2021.04.02. PMID: 33963706.
Hu XX, Wu YJ, Zhang J, Wei W. T-cells interact with B cells, dendritic cells, and fibroblast-like synoviocytes as hub-like key cells in rheumatoid arthritis. Int Immunopharmacol. 2019;70:428-434. doi: 10.1016/j.intimp.2019.03.008.
Naqvi MA, Memon MA, Jamil T, Naqvi SZ, Aimulajiang K, Gadahi JA, Xu L, Song X, Li X, Yan R. Galectin Domain Containing Protein from Haemonchus contortus Modulates the Immune Functions of Goat PBMCs and Regulates CD4⁺ T-Helper Cells In Vitro. Biomolecules. 2020;10(1):116. doi: 10.3390/biom10010116.
Cui A, Li H, Wang D, Zhong J, Chen Y, Lu H. Global, regional prevalence, incidence and risk factors of knee osteoarthritis in population-based studies. E Clinical Medicine. 2020;26:29-30:100587. doi: 10.1016/j.eclinm.2020.100587.
Ru J, Li P, Wang J, Zhou W, Li B, Huang C, Li P, Guo Z, Tao W, Yang Y, Xu X, Li Y, Wang Y, Yang L. TCMSP: a database of systems pharmacology for drug discovery from herbal medicines. J Cheminform. 2014;6:13. doi: 10.1186/1758-2946-6-13.
Zhou Q, Jian L, Liu J, Xin L, Fang YY, Wan L, Hung D, Wen JT. Exploration of the oxidative-inflammatory potential targets of Coicis Semen in osteoarthritis: Data mining and systematic pharmacology. BIOCELL.2023;47(7):1623–1643. doi.org/10.32604/biocell.2023.028331.
Hakim MA, Yang S, Lai R. Centipede venoms and their components: resources for potential therapeutic applications. Toxins (Basel). 2015;7(11):4832-4851. doi:10.3390/toxins7114832.
Ma JX, Wang B, Li HS, Yu J, Hu HM, Ding CF, Chen WQ. Uncovering the mechanisms of leech and centipede granules in the treatment of diabetes mellitus-induced erectile dysfunction utilising network pharmacology. J Ethnopharmacol. 2021;265:113358. doi: 10.1016/j.jep.2020.113358.
Tang Y, Li M, Wang J, Pan Y, Wu FX. CytoNCA: a cytoscape plugin for centrality analysis and evaluation of protein interaction networks. Biosystems. 2015; 127:67-72. doi:10.1016/j.biosystems.2014.11.005.
Ding J, Tang S, Mei Z, Wang L, Huang Q, Hu H, Ling M, Wu J. Vina-GPU 2.0: Further Accelerating AutoDock Vina and Its Derivatives with Graphics Processing Units. J Chem Inf Model. 2023;63(7):1982-1998. doi: 10.1021/acs.jcim.2c01504.
Sun Y, Liu J, Xin L, Wen J, Zhou Q, Chen X, Ding X, Zhang X. Xinfeng capsule inhibits inflammation and oxidative stress in rheumatoid arthritis by up-regulating LINC00638 and activating Nrf2/HO-1 pathway. J Ethnopharmacol. 2023;301:115839. doi: 10.1016/j.jep.2022.115839.
Xu J, Ma X. Hsa_circ_0032131 knockdown inhibits osteoarthritis progression via the miR-502-5p/PRDX3 axis. Aging (Albany NY). 2021;13(11):15100-15113. doi: 10.18632/aging.203073.
You B, Zhou C, Yang Y. MSC-EVs alleviate osteoarthritis by regulating microenvironmental cells in the articular cavity and maintaining cartilage matrix homeostasis. Ageing Res Rev. 2023;85:101864. doi: 10.1016/j.arr.2023.101864.
Li W, Yu L, Li W, Ge G, Ma Y, Xiao L, Qiao Y, Huang W, Huang W, Wei M, Wang Z, Bai J, Geng D. Prevention and treatment of inflammatory arthritis with traditional Chinese medicine: Underlying mechanisms based on cell and molecular targets. Ageing Res Rev. 2023;89:101981. doi: 10.1016/j.arr.2023.101981.
Chow YY, Chin KY. The Role of Inflammation in the Pathogenesis of Osteoarthritis. Mediators Inflamm. 2020;2020:8293921. doi: 10.1155/2020/8293921.
Lian C, Wang X, Qiu X, Wu Z, Gao B, Liu L, Liang G, Zhou H, Yang X, Peng Y, Liang A, Xu C, Huang D, Su P. Collagen type II suppresses articular chondrocyte hypertrophy and osteoarthritis progression by promoting integrin β1-SMAD1 interaction. Bone Res. 2019;7:8. doi:10.1038/s41413-019-0046-y.
Hu Q, Ecker M. Overview of MMP-13 as a Promising Target for the Treatment of Osteoarthritis. Int J Mol Sci. 2021;22(4):1742. doi: 10.3390/ijms22041742.
Jiang L, Lin J, Zhao S, Wu J, Jin Y, Yu L, Wu N, Wu Z, Wang Y, Lin M. ADAMTS5 in Osteoarthritis: Biological Functions, Regulatory Network, and Potential Targeting Therapies. Front Mol Biosci. 2021;8:703110. doi: 10.3389/fmolb.2021.703110.
Wang H, Yan Y, Pathak JL, Hong W, Zeng J, Qian D, Hao B, Li H, Gu J, Jaspers RT, Wu G, Shao M, Peng G, Lan H. Quercetin prevents osteoarthritis progression possibly via regulation of local and systemic inflammatory cascades. J Cell Mol Med. 2023;27(4):515-528. doi: 10.1111/jcmm.17672.
Gambari L, Cellamare A, Grassi F, Grigolo B, Panciera A, Ruffilli A, Faldini C, Desando G. Overview of Anti-Inflammatory and Anti-Nociceptive Effects of Polyphenols to Halt Osteoarthritis: From Preclinical Studies to New Clinical Insights. Int J Mol Sci. 2022;23(24):15861. doi: 10.3390/ijms232415861.
Wong SK, Chin KY, Ima-Nirwana S. The Osteoprotective Effects of Kaempferol: The Evidence From In Vivo And In Vitro Studies. Drug Des Devel Ther. 2019;13:3497-3514. doi: 10.2147/DDDT.S227738.
Roberts CA, Dickinson AK, Taams LS. The interplay between monocytes/macrophages and CD4(+) T cell subsets in rheumatoid arthritis. Front Immunol. 2015;6:571. doi: 10.3389/fimmu.2015.00571.
Haubruck P, Pinto MM, Moradi B, Little CB, Gentek R. Monocytes, Macrophages, and Their Potential Niches in Synovial Joints -Therapeutic Targets in Post-Traumatic Osteoarthritis? Front Immunol. 2021;12:763702. doi:10.3389/fimmu.2021.763702.
Liu J, Wang Y, Sun Y, Huang C, Chen X, Zhang W, He L, James Cheng-Chung W. Efficacy and safety of Xinfeng capsule in the treatment of osteoarthritis: a multicenter, randomized, double-blinded, controlled trial. J Tradit Chin Med. 2020;40(2):284-295. PMID: 32242394.
Wen JT, Xin L, Wan L, Fang YY, Dong WZ, Liu J. Effect of traditional Chinese medicine invigorating spleen unit therapy on inflammatory markers in patients with osteoarthritis based on random walk model. Zhongguo Zhong Yao Za Zhi. 2019;44(5):1053-1057. doi: 10.19540/j.cnki.cjcmm.20181205.002.

No competing interests reported.

SupplementaryTableS1.docx
Supplementary Table 1: Information about Huangqi, Leigongteng and Yiyiren and Wugong.
SupplementaryTableS2.docx
Supplementary Table 2: Collection of target genes.
SupplementaryTableS3.docx
Supplementary Table 3: Results of correlation analysis.

Download PDF

Version 1

posted

You are reading this latest preprint version

Chinese herbal compound Xinfeng capsule inhibits cartilage extracellular matrix degradation and inflammation in osteoarthritis by modulating circ_0032131 and the miR-502-5p/TRAF2 axis

Status:

Version 1

Abstract

Objective

Materials and methods

Results

Conclusion

Figures

1. Introduction

2. Materials and methods

2.1 Recruitment of medical patients

2.2 Network pharmacological analyses

2.2.1 Screening of the targets and active components in XFC.

2.2.2 Verified OA-related genes.

2.2.3 Network analysis.

2.2.4 Molecular docking validation

2.3 Extraction of PBMCs and cell co-culture

2.4 Preparation of Xinfeng capsule drug serum

2.5 Cell transfection

2.6 Cell Counting Kit-8 (CCK-8) Assays for Cell Viability

2.7 Flow cytometry assay

2.8 Reverse transcriptional quantitative polymerase chain reaction (RT-qPCR)

2.9 Dual-Luciferase reporter (DLR) and RNA immunoprecipitation (RIP).

2.10 Enzyme-linked immunosorbent assay (ELISA).

2.11 Western blot (WB).

2.12 Immunofluorescence (IF) staining.

2.13 Statistical analyses

3. Results

3.1 Baseline patient characteristics

3.2 Network pharmacological analysis

3.2.1 Target collection and construction of active ingredient-target maps

3.2.2 Discovery of the fundamental mechanisms of XFC in the course of OA therapy.

3.2.3 Molecular docking.

3.3 Circ_0032131 is over-expressed in PBMCs from OA patients.

3.4 Screening of co-culture concentration and time.

3.5 Effects of OA-PBMCs on osteoarthritic chondrocytes.

3.6 Circ_0032131 suppresses cell proliferation while accelerating chondrocyte apoptosis and ECM degradation.

3.7 Circ_0032131 functions as a ceRNA and indirectly controls the levels of TRAF2 by sponging miR-502-5p.

3.8 MiR-502-5p reverses the impact of circ_0032131 on ECM metabolism and inflammatory response in OA chondrocytes.

3.9 TRAF2 as an exact target for miR-502-5p and positively modulated by circ_0032131.

3.10 XFC inhibits inflammatory response and chondroprotection via circ_0032131 and miR-502-5p/TRAF2 axis.

4. Discussion

5. Conclusions

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1