Plant materials and growth conditions
Maize (Zea mays L. cv. Zhengdan 958) and tobacco (Nicotiana benthamiana) were cultured with Hoagland's solution (pH 6.0) in a growth chamber at 26°C/22°C (day/night) for 2 weeks. The nutrient solution was replaced daily. The photoperiod of the growth chamber was 14 h/10 h (day/night), and the photosynthetic effective radiation was 600 mol−2 s−1.
Amplification and sequence analysis of ZmDHN11
First-strand cDNA was obtained by using 5 μg of total RNA, which was extracted from young maize leaves using Plant RNA Reagent according to the manufacturer’s instructions (TIANGEN, China). The entire coding sequence of ZmDHN11 was amplified with specific primers (forward GGATCCCAGTCCATTATTGCCGTC, BamHI site underlined and reverse GAGCTCGTGTTGCACCTGTGCT, SacI site underlined). The hydropathic profiles of the ZmDHN11 protein were constructed by the ProtScale method (http://expasy.org/tools/protscale.html).
Subcellular localization
The ZmDHN11 gene was inserted into the reconstructed binary vector pBI121-GFP, which generated a C-terminal fusion protein with the green fluorescent protein (GFP) gene controlled by the cauliflower mosaic virus (CaMV) 35S promoter. Constructs were transformed into the Agrobacterium tumefaciens strain LBA4404, and the transformation of tobacco plants was performed by the leaf disk transformation method (Liu et al., 2013b).
Gene expression analyses of ZmDHN11 under different stress conditions using real-time PCR
Two-week-old maize was treated with 20% PEG6000 (w/v), 100 μM ABA, 250 mM NaCl and low temperature (4℃). Leaves collected from the different treated plants at the indicated time points were immediately frozen in liquid nitrogen and stored at -80℃. First-strand cDNA synthesis was performed as described above. All cDNAs were used in real-time PCRs (qRT-PCR) performed using primers (forward 5'-GAAGAGCAGTCGCCATGTCT-3' and reverse 5'-CTCCACGATGCCTTCCTTGT-3') and SYBR Green qRT-PCR SuperMix (TransGene, China). The maize actin gene was amplified along with the ZmDHN11 gene, which were used to normalize the amount of template.
Protein purification
The expression and purification of ZmDHN11 was performed as described with minor changes (Liu et al., 2016). The open reading frame (ORF) of ZmDHN11 was ligated into the expression system (Novagen) of pET30 Escherichia coli strain BL21 (DE3). The recombinant protein 6×His tag was expressed at the N-terminus according to the protocol of the manufacturer (pET system). The ZmDHN11 fusion protein was purified by affinity chromatography using a Ni- column and then exchanged in low-medium salt buffer (100 mM NaCl, 50mM Tris-HCl at pH 8.0) using a HiPrep desalting column (GE Healthcare). After determining the purity of the fusion protein on an SDS-PAGE gel, the samples were stored at −20 °C.
Water deficit inactivation of lactate dehydrogenase
LDH (lactate dehydrogenase, Roche, U.K.) in rabbit muscle was diluted with 25 mM Tris-HCl at pH 7.5. Water deficit treatment was assayed according to a previously published method (Liu et al., 2014). For water deficit treatment, LDH was treated by vacuum drying for 1 hour. The enzymatic activity of the untreated LDH was referred to as 100%. The values represent the average of three independent experiments. The hydrophilic proteins polylysine (Invitrogen) and lysozyme (Amresco) were used as controls. For LDH activity, the buffer was 25 mM Tris-HCl (pH 7.5), which contained 0.15 mM NADH (Roche) and 2 mM pyruvate (sigma). At 25°C, NADH transformed into NAD, and the activity of LDH wsa the rate of decrease in absorbance at 340 nm over 1 minute by using a spectrophotometer.
The phosphorylation analyses of ZmDHN11
Phosphorylation was performed as previously described (Liu et al., 2017b). Casein kinase (CKII, New England Biolabs) was used to phosphorylate ZmDHN11. The 5 μg of recombinant proteins, 100 U of casein kinase CKII, 1X reaction buffer (20 mM Tris-HCl, 50 mM KCl, 10 mM MgCl2) and 200μM ATP were mixed in a total reaction volume of 25μl. The reaction mixtures were incubated for 2 h at 30℃ and then analyzed by SDS-PAGE. A Pro-Q Diamond Phosphoprotein Gel Staining Kit (Invitrogen) was used to detect phosphoproteins according to the manufacturer's instructions. The details of the experiment are as follows. The gel was incubated the in 100 mL of fix solution (50% methanol and 10% acetic acid) at room temperature with gentle agitation for 30 minutes. Incubate the gel in 100mL of ultrapure water with gentle agitation for 10 minutes. Next, the gel was incubated in a volume of Pro-Q Diamond phosphoprotein gel stain that was equivalent to 10 times the volume of the gel. Then, the gel was incubated in 100 mL of destain solution (50 mL of 1 M sodium acetate, pH 4.0, 750 mL of ultrapure water and 200 mL of acetonitrile) with gentle agitation for 30 minutes at room temperature. The gel was washed twice with ultrapure water at room temperature for 5 minutes per wash. Finally, the stained gels were observed by using a UV transilluminator.
Identification of transgenic tobacco transcription levels
The transcription levels of the ZmDHN11 transcripts in transgenic tobacco plants were analyzed by qRT-PCR. The tobacco actin gene was amplified by using primers (forward 5'-GATGAAGATACTCACAGA-3' and reverse 5'-ATAGTCAAGAGCAATGTA-3') along with the ZmDHN11 gene to normalize the expression of the target gene.
The expression of ZmDHN11 in Pichia yeast GS115
The correct sequences of ZmDHN11 and the AOXI promoter were connected to plasmid Ppic3.5K (Invitrogen, USA). Five micrograms of linearized plasmid Ppic3.5K -ZmDHN11 was transformed into the Pichia GS115 strain by the LiCl method. The same strain transformed with the empty body of Ppic3.5K was used as a negative control. All yeast cells were transformed and transferred to MD plates (4×10-5 biotin, 1.34% YNB and 2% glucose), and then identified by PCR.
Osmotic tolerance assays of yeast transformants
The osmotic tolerance assays of yeast were assayed according to a previously published method (Liu et al., 2014). The recombinant colonies were inoculated in 25 mL of BMGY medium (2% peptone, 1% yeast extract, 1.34% YNB, 10 mM K3PO4, 4×10-5 biotin and 1% glycerin). After incubation at 28℃ for 18 h, the yeast cells were collected by centrifugation, resuscitated in 200mL induction BMMY medium (2% peptone, 1% yeast extract, 1.34% YNB, 10mM K3PO4, 0.5% methanol and 4×10-5 biotin), and incubated at 28℃ for 4 days. Methanol was added every 24 h for a final concentration of 0.5%. The yeast transformants Ppic3.5K-ZmDHN11 and Ppic3.5K were cultured to OD600 = 0.8, and then 2 mL of culture was inoculated into 150 mL of BMGY medium supplemented with 800 mM mannitol. At each time point, the OD600 of 3 mL of culture was measured by a spectrophotometer. Growth was measured at least three times.
Histochemical detection of O2-
O2- accumulation was detected by NBT staining methods. The methods were performed as previously described (Liu et al., 2013a). Two-week-old control lines and transgenic lines were treated with 250 mM mannitol for 7 days, and then the seedlings were infiltrated with 0.5 mg/mL nitroblue tetrazolium (NBT) for 24 h in the dark to detect O2-. Then the seedlings were decolorized by boiling in ethanol (95%) for 15 minutes. After cooling, the seedlings were extracted at room temperature with fresh ethanol and then photographed by using a stereomicroscope. The experiment was repeated three times.
Osmotic stress treatments and assays in plants
Six-week-old control lines and transgenic lines were treated with 20% PEG6000 for 5 days, and then 0.5 g of leaves was collected for MDA (malondialdehyde) measurements. Relative electrolytic leakage and MDA content were determined as described by Liu et al., 2014. Peroxidase (POD) and superoxide dismutase (SOD) were measured as described in Liu et al., 2017b.The experiments were repeated more than three times.