Cell Culture and Treatment.
J774A.1 cells were obtained from Beina Chuang Lian Biology Research Institute (BNCC300973, Beijing, China). Cells were cultured in DMEM medium (Gibco) with 10% fetal bovine serum (Gibco) at 37℃ in a 5% CO2 incubator. J774A.1 cells were infected with lentiviral vector particle-CX3CL1 and Ubi-MCS-3FLAG-SV40-Cherry-IRES-negative control according to manufacturer’s protocol (Shanghai Genechem Co., Ltd.) to achieve FKN-overexpression. Stable cell lines were selected by applying puromycin in culture medium. Cells were divided into 12 groups as follows: (1) Control group; (2) LPS group: cells were infected with LPS (L2880, Sigma-Aldrich, St. Louis, MO, USA) 1μg/ml for 12 h; (3) Wnt3a (Wnt/β-catenin signaling pathway activator) group: cells were infected with Wnt3a (ab81484, Abcam, Shanghai, China) 50 ng/ml for 48 h; (4) ICG-001(Wnt/β-catenin signaling pathway inhibitor) group: cells were infected with ICG-001 (S2662, Selleckchem, Houston, TX, USA) 10 μg/ml for 48 h; (5) Wnt3a+LPS group: cells were pretreated with Wnt3a (50 ng/ml, 36 h) and then co-treated with 1μg/ml LPS for 12 h; (6) ICG-001+LPS group: cells were pretreated with ICG-001(10 μg/ml, 36 h) and then co-treated with 1μg/ml LPS for 12 h; (7) EX-FKN group; (8) Ex-FKN+LPS group: EX-FKN cells infected with LPS (1μg/ml, 12 h); (9) EX-FKN+Wnt3a group: EX-FKN cells infected with Wnt3a 50 ng/ml for 48 h; (10) EX-FKN+ICG-001 group: EX-FKN cells were infected with ICG-001 10 μg/ml for 48 h; (11) EX-FKN+Wnt3a +LPS group: EX-FKN cells were pretreated with Wnt3a (50 ng/ml, 36 h) and then co-treated with 1μg/ml LPS for 12 h; (12) EX-FKN+ICG-001+LPS group: EX-FKN cells were pretreated with ICG-001(10 μg/ml, 36 h) and then co-treated with 1μg/ml LPS for 12 h.
Mice.
Two-three months-old (25±3g) specific pathogen-free (SPF) WT C57BL/6 mice (FKN+/+) and FKN-KO C57BL/6 mice (FKN-/-) were purchased from Shanghai Genechem Animal Co. Ltd (NO. SYXK 2015-0008). For FKN-KO mice, CRISPR/Cas9 technology was used to construct sgRNA sequence (CX3CL1 -sgRNA1:CTGGCAGGTTATCACGGGTTGGG; CX3CL1-sgRNA2:TGGCAGTA ACTCATACGTCCTGG) that targets the FKN-gene locus. The surviving embryos after injection with CRISPR/Cas9 mRNA were raised to adulthood and the founders with FKN Knock-out were screened. Mice were housed under 12/12-h light/dark cycle with free access to food and water (ad libitum) for 1 week before the experiments. All experiments followed theanimal experimentation ethics at Youjiang Medical University for Nationalities (NO. SYXK 2017-0004) and all procedures were performed according to the National Institute of Health Guidelines.
Six-eight weeks age of mice were randomly grouped (12 groups containing 36 mice):(1) Control group, WT Mice intraperitoneal (IP) injection of 500 μL saline per day; (2) LPS group, WT Mice challenged with LPS (10 mg/kg, 24 h) by IP injection; (3) Wnt3a group, WT Mice Tail vein injection of recombinant Wnt3a protein (2 μg/kg) for 21 consecutive days; (4) ICG-001 group, WT Mice IP injection of ICG-001(5 mg/kg) for 7 consecutive days; (5) Wnt3a+LPS group, WT Mice Tail vein injection of recombinant Wnt3a protein (2 μg/kg) for 21 consecutive days, LPS (10 mg/kg) was IP injected into WT mice on the last day; (6) ICG-001+LPS group, WT Mice IP injection of ICG-001(5 mg/kg) for 7 consecutive day plus LPS (10 mg/kg) was IP injected into WT mice on the last day; (7) FKN-KO group, FKN-KO Mice IP injection of 500 μL saline per day; (8) FKN-KO+LPS group, FKN-KO mice challenged with LPS (10 mg/kg, 24 h) by IP injection; (9) FKN-KO+Wnt3a group, FKN-KO Mice Tail vein injection of recombinant Wnt3a protein (2 μg/kg) for 21 consecutive days; (10) FKN-KO+ICG-001 group, FKN-KO Mice IP injection of ICG-001(5 mg/kg) for 7 consecutive days; (11) FKN-KO+Wnt3a+LPS group, FKN-KO Mice Tail vein injection of recombinant Wnt3a protein (2 μg/kg) for 21 consecutive days plus LPS (10 mg/kg) was IP injected into FKN-KO mice on the last day; (12) FKN-KO+ICG-001+LPS group, FKN-KO Mice IP injection of ICG-001(5 mg/kg) for 7 consecutive days,LPS (10 mg/kg) was IP injected into FKN-KO mice on the last day.
Renal Function Measurement
All mice serum was collected for creatinine (Scr) and Blood Urea Nitrogen (BUN) assays used to evaluate the renal function. Scr and BUN levels of mice were examined using the Blood Urea Nitrogen Assay kit (C013-2-1, Jiancheng BioengineeringInstitute,Nanjing, China) and Creatinine Assay kit (C011-2-1, Jiancheng Bioengineering Institute,Nanjing, China) according to the manufacturer’s instructions.
RNA-sequencing Assay
Total RNA was extracted with Trizol Reagent (Invitrogen). Agarose gel electrophoresis was used to assess RNA integrity. Total RNA was purified with Qia Quick PCR kit and PCR amplification was performed. RNA-seq library for sequencing was constructed by Illumina HiSeqTM 2500. ABI Step OnePlus Real-Time PCR System (Life Technologies) was used for quantification and Pooling. The sequence was performed according to the PE150 mode of Hiseq2500.
Co-Immunoprecipitation (Co-IP) Assay
J774A.1 cells were lysed with a pre-cooled IP lysis buffer for 30 min. Cells lysates were preprocessed with magnetic bead and then incubated with FKN antibody or control IgG at 4℃ overnight. The antibody was captured on magnetic bead and inspected using Western blot with anti-Wnt-4 and anti-β-catenin.
Cells Viability Assay
Cells viability was analyzed using Cell Counting Kit-8 kit (M4839, AbMole, Beijing, China). J774A.1 cells were seeded into 96-well plates at 5× 103 cells per well. Cells were treated with Wnt3a (25, 50, 75 ng/ml) and ICG-001 (5, 10, 15 μM/ml) for 24, 48 and 72 h. A total of 10 μl CCK-8 was added to each well and incubated 1h at 37℃ in a 5% CO2 incubator after the treatment with Wnt3a and ICG-001. The TriStar LB 941 multimode microplate reader (Berthold Technologies, Germany) at 450 nm was used in OD assays.
Cell Apoptosis Assay
The fluorescein isothiocyanate-Annexin V/propidium iodide (FITC-Annexin V/PI) apoptosis kit (556547, BD Biosciences, USA) was used to detected cell apoptosis. Cells were seeded into 6-well plates and cultured for 48 h. The cells of each group were collected, rinsed three times with 1×PBS and then centrifuged for 3 min. The cells were then adjusted to 1×106 cells/ml and incubated for 15 minutes in a binding buffer containing annexin V-FITC and PI. The apoptosis was detected through flow cytometry using a FACS Canto II (BD Biosciences, USA) within 1 h.
ELISA
Supernatants from all samples were collected. Cyclin D1(SBJ-M0517, Senbeijia Bioengineering Institute, Nanjing, China), TNF-α (E-EL-M0049c, Cusabio Biotech Co., Ltd) and ARG-1 (CSB-EL002005MO, Cusabio Biotech Co., Ltd) were detected according to manufacturer's instructions using ELISA Kits. The absorbance was measured using the TriStar LB 941 multimode microplate reader at 450 nm.
Western Blotting
All samples which had 40 μg total protein were loaded on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to the polyvinylidene fluoride (PVDF) membrane. The membrane was incubated overnight at 4℃ with rabbit anti-FKN (DF12376, 1:500, Affinity), rabbit anti-iNOS (AF0199, 1:500, Affinity), rabbit anti-Wnt-4 (DF9040, 1:500, Affinity), rabbit anti-β-catenin (AF6266, 1:500, Affinity), rabbit anti-c-Myc (AF0358, 1:500, Affinity), rabbit anti-CyclinD1 (AF0931, 1:500, Affinity), rabbit anti-TNF-α (DF7014, 1:500, Affinity), rabbit anti-IL-10 (DF0175, 1:500, Affinity), anti-ARG-1 (DF6657, 1:500, Affinity), rabbit monoclonal FKN antibody (ab25091, 1:1000, Abcam), rabbit monoclonal anti-Wnt-4(ab262696, 1:1000, Abcam), rabbit monoclonal anti-β-catenin (ab6302, 1:1000, Abcam), mouse anti-β-actin (AF7018, 1:1000, Affinity), mouse anti-β-tubulin (AF7010, 1:10000, Affinity) and mouse anti-GAPDH (AF7021, 1:1000, Affinity). The membrane was then incubated with Goat anti-rabbit IgG (S0001, 1:5000, Affinity), Goat anti-mouse IgG (S0002, 1:5000, Affinity) for 50 min at room temperature. Then the enhanced chemiluminescence substrate (KF003, Affinity) and visualized using Tanon-5200 (Tanon, Shanghai, China).
HE Staining and PAS Staining
Kidney tissue samples were fixed in 10% formalin and then embedded in paraffin for histopathology. A total of 3-4 µm serial sections were stained followed by routine de-waxed and hydrated. These sections were then stained with hematoxylin-imidine Red (HE) or periodic Acid-Schiff (PAS) according to standard procedures. These sections were visualized using a light microscope (H550S, NIKON, Japan).
Immunofluorescence Assay
J774A.1 cells (5×103 cells/well) were seeded into glass bottom cell culture dish (IBIDI, Germany) for 72 h. J774A.1 cells were then washed three times with 1×PBS and fixed in 4% paraformaldehyde at room temperature for 30 min. Cells were permeabilized with 1 ml of 0.1% Triton X-100 for 20 min. Cells were incubated with fluorescently labeled primary antibodies (anti-FKN; anti-β-catenin; anti-iNOS; anti-ARG-1; anti-β-tubulin) followed by Goat anti-rabbit IgG (H+L) FITC-conjugated antibody(S0008, 1:200, Affinity) and Goat Anti-Mouse IgG (H+L) Fluor594-conjugated antibody (S0005, 1:200, Affinity).. Finally, cells were incubated with DAPI for 10 min and imaged using an Olympus Fluoview 3000 Confocal Laser Scanning Microscope (FV3000, Olympus and Tokyo, Japan).
Mice kidney sections were prepared using standard procedures. The primary anti-bodies included anti-F4/80, anti-CD11b, anti-iNOS or anti-ARG-1 followed by secondary antibodies staining. All sections were visualized under Olympus Fluoview 3000 Confocal Laser Scanning Microscope.
Statistical Analysis
All data are expressed in the form of mean±standard deviation. SPSS23.0 and GraphPad Prism 8.0 were used to analyze statistical data. Statistically significance was confirmed as p<0.05. Each experiment was repeated three times.