Ameliorative Effects of Bone Marrow-derived Mesenchymal Stem Cells and Hyaluronic Acid on Monosodium Iodoacetate-Induced Ankle Osteoarthritis in Wistar Rats: Roles of Th1/Th2/Th17 cytokines, MMP-13, TGF-β1 and antioxidant defense system

doi:10.21203/rs.3.rs-3302885/v1

Download PDF

Article

Ameliorative Effects of Bone Marrow-derived Mesenchymal Stem Cells and Hyaluronic Acid on Monosodium Iodoacetate-Induced Ankle Osteoarthritis in Wistar Rats: Roles of Th1/Th2/Th17 cytokines, MMP-13, TGF-β1 and antioxidant defense system

https://doi.org/10.21203/rs.3.rs-3302885/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: There is currently no cure for osteoarthritis [OA], and the few pharmacological therapy options available have drawbacks. Additionally, there is no effective treatment that would guarantee a full recovery from OA. Therefore, the goal of this investigation was to determine if bone marrow mesenchymal stem cells [BMMSCs] and/or hyaluronic acid [HA] were effective in treating experimentally-induced ankle osteoarthritis in Wistar rats caused by monosodium iodoacetate [MIA].

Methods: In five groups of ten rats each, fifty male Wistar rats were distributed. Saline was injected into the right tibiotarsal joint of individuals in group I on two days in a row, whereas those in group II received an injection of 2 mg of MIA [dissolved in saline] into the same joint. Those in groups III [MIA-BMMSCs], IV [MIA-HA], and V [MIA-BMMSCs+HA] were injected with MIA similarly to those in group II and also received intra-articular injections of BMMSCs [1×10⁶ cells/rat], HA [75 µg/rat], and BMMSCs [1×10⁶ cells/rat] alongside HA [75 µg/rat] respectively, in the tibiotarsal joint at the ends of the 2^nd, 3^rd and 4^th weeks after MIA injection. The leg circumference, arthritis score, and morphological changes of the ankle joint were evaluated weekly from the beginning to the end of the experiment. For the purpose of identifying oxidative stress, antioxidant, and inflammatory state indicators, sera were collected. For histological and molecular research, the ankles of the right hind leg were excised out and fixed in neutral buffered formalin.

Results: In addition to raising GSH and GST levels, BMMSCs and HA decreased serum LPO. Additionally, BMMSC and HA significantly decreased ankle MMP-13 mRNA and TGF-β1 protein expressions as well as TNF-α and IL-17 serum levels. Rats with MIA-induced OA had higher serum IL-4 levels after receiving BMMSC and HA. BMMSC and HA caused a steady decrease in joint injury and cartilage degradation, according to histological investigations.

Conclusion: Based on the findings, it is possible to infer that BMMSC and/or HA have anti-arthritic effects that may be mediated by the augmentation of the antioxidant and anti-inflammatory effects in Wistar rats with MIA-induced osteoarthritis. The suppression of MMP-13 and TGF-β1 expressions play an important role in the improvement effects BMMSC and/or HA on OA in Wistar rats.

Biological sciences/Biochemistry

Biological sciences/Chemical biology

Biological sciences/Stem cells

Health sciences/Biomarkers

Health sciences/Rheumatology

Osteoarthritis

Anti-inflammatory effects

Antioxidant potency

bone marrow mesenchymal stem cells

Hyaluronic acid

Osteoarthritis [OA], which is the most common joint disease, is a chronic degenerative disease that affects cartilage, synovial membranes, and bones of joints. It is characterized by the deterioration of articular cartilage, synovitis, joint effusion, and new peri-articular bone formation, all of which result in pain, joint stiffness, and joint dysfunction [1–4]. There are numerous risk factors for OA, including aging, hereditary factors, and trauma; however, aging is the most common risk factor for the disease [5]. Existing conventional therapies for OA, which are mostly directed to the management of clinical symptoms, chiefly incorporate the use of usual analgesics, non-steroidal anti-inflammatory drugs [NSAIDs], and lubricants [hyaluronic acid], in addition to surgical interventions such as microfracture and drilling. Yet, all of these treatments fail to guarantee a complete OA cure [6].

To date, only a few effective treatments are available for OA, which highlights the need for the development of novel effective remedies for OA. Cell therapy is an interesting therapeutic choice for various types of arthritis, as it might have the potential to avert further damage to the cartilage [7–10]. Recently, numerous experiments on the effects of intra-articular mesenchymal stem cells [MSCs] on experimental and clinical arthritis were published and exhibited that stem cells were effective in curing cartilaginous defects and have a suppressive influence on OA [11–13]. MSCs are a kind of cells that are able to differentiate into various mesenchymal tissues, involving cartilage, bone, muscle, tendon, and others. MSCs can be isolated from the bone marrow easily and further proliferated in culture, preserving the ability to differentiate in response. They have self-renewal ability, anti-inflammatory properties, and regenerative properties; so, MSCs have the potential for the regeneration of damaged tissues and, thus, could be used as a treatment for OA [14].

MSCs are the ideal cell type to use in the repair of damaged joints in different arthritic disorders [15]. In animal models of arthritis, MSCs injected intraperitoneal or intravenous have resulted in several curative effects, ranging from significant amelioration to no effect; so, the results still remain inconclusive. The explanation for this may be the differences in the route of administration. The intra-articular administration of MSCs, directly to the affected tissues, might be more advantageous than any other route of administration [16]. Among different MSCs, bone marrow-derived MSCs [BMMSCs] were demonstrated to be efficient in reducing the development of OA in several animal models [12, 17].

Intra-articular hyaluronic acid [HA] was proposed as a treatment to ameliorate the mechanical functions of joint. It possesses analgesic, anti-inflammatory, mechanical, and chondroprotective properties [18]. HA treatment can restore articular viscosity by substituting the dysfunctional synovial fluid, which that was formed due to changes associated with the early inflammatory response changes [19].

n line with previous publications, we aimed to assess the effectiveness of intra-articular BMMSCs, HA, and a combination of HA and BMMSCs in the repair of damaged joint repairjoints, diminishing joint swelling, and the amelioration of inflammation of the osteoarthritic ankle induced by monosodium iodoacetate in a rat model.

Chemicals

Monosodium iodoacetate was obtained from Sigma Chemical Company [Sigma-Aldrich, St. Louis, MO, Switzerland]. Hyaluronic acid, orthovisc® [15 mg/ml] of high molecular weight ranging 1000–2900 KDa was obtained from Anika Therapeutics, Inc. Bedford, USA. DMEM [Dulbecco’s modified Eagle’s medium], penicillin/streptomycin solution, trypsin/EDTA, and FBS [fetal bovine serum] were purchased from Lonza, Belgium. Sodium hydrogen carbonate was purchased from LOBA Chemie, India. Culture flasks and consumables of culture were purchased from Greiner Bio-One [Germany]. All other consumed reagents and chemicals were of high purity grade.

Preparation of complete culture medium

For preparing the complete culture medium, penicillin/streptomycin solution, sodium hydrogen carbonate, and FBS were added to 89% DMEM, based to the methods employed by Sun et al. [20].

Isolation and culture of BMMSCs

The procedure used for isolating and culturing BMMSCs in the present study is based on the techniques used by Chaudhary and Rath [21] and Ahmed et al. [22].

Cell viability analysis

The tyrpan blue dye exclusion test was applied to assess the viability of the isolated and cultured cells. This technique is based on the theory that the survived cells do not take up the dye, whereas dead cells do. After washing them twice in PBS, the cells were re-suspended in DMEM and viability percent was assessed by adding equal volumes of 0.2% tyrpan blue [100 µL] and cell suspension [100 µL].

Labeling of BMMSCs

Labeling of BMMSCs was accomplished based according to the technique of Aboul-Fotouh et al. [23] by incubating BMMSCs with ferumoxides solution [25 µg Fe/mL, Feridex, Berlex Laboratories] in a culture medium for 24 hours with adding 375 ng/mL of polylysine one-hour pre-incubation. The labeling was histologically detected by using Prussian’s blue stain. After incubation, the Feridex-labeled BMMSCs were washed in PBS, treated with trypsin, and then re-washed and re-suspended in 0.01 Mol/L PBS at a cell number of 1×10⁶ cells/mL.

Morphological examination of BM-MSCs

BMMSCs were observed under a Biobase inverted microscope to confirm the characteristics of adherent spindle shaped BMMSCs with their in vitro growth characteristics according to El–Ghanayem et al. [24]. Also, BMMSCs were identified by their adherence to the plastic surfaces of tissue culture flasks when maintained under standard culture conditions.

The BMMSCs suspended in DMEM with viability percent more than 95% were rapidly injected into the ankle joint of osteoarthritic rats at a dose of 1 × 10⁶ cells/rat.

Gene expression analysis by quantitative real-time PCR [qRT-PCR]

BMMSCs were characterized via RT-qPCR detection of four genes; i.e., CD34 and CD45 as negative markers, and CD73 and CD105 as positive markers. Primer sequences specific for CD34, CD45, CD105, CD73, and the β-actin housekeeping gene were used [Table 1].

Table 1

Primer sequence for qRT-PCR of positive and negative markers of rat BMMSCs
Gene symbol	Forward	Reverse	Gene bank
CD73	TGTTGGGACCAGCAACTCAA	TTTGAGGCTCAGTGGTAGCC	NM_021576.2
CD105	GGCAGCTTCAACAACCATCA	GGATGGACTAGATCGGAGCC	XM_032900290.1
CD45	TGTGAACATACGGATTGTGA	ACTTTAACTTAACAAACTGC	AF251010.1
CD34	GCGAGGCTTTCAACACAACC	ACTCCACTGTCTTGATTCCC	XM_032903804.1
β-actin	TGACAGGATGCAGAAGGAGA	TAGAGCCACCAATCCACACA	NM_031144.3

Experimental animals

Adult male Wistar rats [n = 50] weighing 100–130 grams and aged 8–10 weeks were used. The animals were obtained from VACSERA, Helwan, Egypt. For 1 week, the animals were retained under monitoring and strict care to rule out any communicable diseases. In the animal house of the Zoology Department, Faculty of Science, Beni-Suef University, Egypt, the animals were kept in cages with good-aerated stainless-steel coverings at a 10–12 hours/day natural daily lighting cycle and a temperature of 20°C–25°C, and were given a balanced diet and water ad libitum. The experiment was done under the guidelines of Institutional Animal Care and Use Committee [IACUC], Beni-Suef University, Beni-Suef, Egypt [Approval number: BSU/020–107]. The study is reported in accordance with ARRIVE guidelines.

Monosodium iodoacetate [MIA]-Induced OA

After one week of adaptation, OA was experimentally induced in rats by injecting MIA in a dose level of 2 mg/50 µL of isotonic sterile saline using a 21-gage needle into the tibiotarsal joint of the right hind limb on two consecutive days, as formerly illustrated by Möller et al. [25] and Ragab et al. [10]. Before the injection of MIA, the animals were anesthetized by intramuscular injection of ketamine [70 mg/kg/ b.wt] and xylazine [7 mg/kg/b.wt].

Experimental design and animal grouping

After receiving MIA injections, the rats were randomly allotted into 5 groups of 10 rats as follows Fig. 1:

Group I [Normal control] consisted of normal rats, which received 50 µL of sterile 0.9% NaCl by injection at the ends of 0, 2, 3, and 4 weeks into the ankle joint of each rat's right hind leg.

Rats in Group II [Osteoarthritic control] received MIA via intra-articular injection into the right tibiotarsal joint over the course of two days. At the ends of 2, 3, and 4 weeks following the MIA injection, the rats in this group additionally got 50 µL of isotonic sterile saline intra-articular injections into the tibiotarsal joint of the right hind leg.

Group III [MIA + BMMSCs] consisted of osteoarthritic rats that intra-articularly treated with BMMSCs by injection into the tibiotarsal joint of the right hind leg at a dose level of 1×10⁶ cells/rat at the ends of 2, 3, and 4 weeks after the MIA injection.

Group IV [MIA + HA] was made up of osteoarthritic rats that intra-articularly treated with 50 µL of 15 mg/ml HA [orthovisc® [15 mg/mL] by injection into the tibiotarsal joint of the right hind leg at the ends of 2, 3, and 4 weeks after the MIA injection.

Group V [MIA + BMMSCs + HA] consisted of osteoarthritic rats that were intra-articularly treated with BMMSCs and 50 µL of HA by injection into the tibiotarsal joint of the right hind leg at the ends of 2, 3, and 4 weeks after the MIA injection.

Blood samples were taken from each rat's jugular vein at the conclusion of the experiment under diethyl ether inhalation anesthesia, placed in gel with clot activator, and centrifuged at 3000 rpm for 15 minutes. Quickly removed and stored at 20°C until needed, the clear, non-hemolyzed supernatant sera were used. Each animal had its right ankle joint quickly removed. Phosphate-buffered formalin was used to fix three samples from each group for histopathological analysis. The rest of the ankles of each group were kept at − 20°C until they were used in molecular and Western blot tests.

Measurement of leg circumference

Using a thread that was wrapped around the leg at the area of the ankle, the circumference of the right hind leg at the region of the ankle was measured as a gauge of the rate of paw edema and swelling in various groups. The thread's length was then determined using a ruler. From the zero-days to the conclusion of the experiment following MIA, the measurements were anticipated once a week. To demonstrate the gross morphology, a high-resolution camera was also used to take pictures of the right legs.

Assessment of clinical signs of inflammation and Scoring of arthritis

The rats were observed for clinical signs of arthritis every week [from day zero to the end of the experiment] following the injection of MIA. Swelling in at least one joint or paw was taken into consideration when MIA-induced arthritis was suspected to have occurred. According to the methodology employed in a prior paper [26], the degree of arthritis was graded in each paw as follows: 0 = normal; 0.5 = slight redness of ankle joint or digits; 1 = mild but distinct redness and ankle swelling; 2 = moderate redness and ankle swelling; 3 = severe redness and entire paw swelling, including digits; more than two joints involved; 4 = maximally inflamed limb with involvement of more than one joint.

Determination of serum cytokine levels

Special ELISA [Enzyme-Linked Immunosorbent Assay] kits from R&A Systems, USA were used to measure the serum levels of tumor necrosis factor-α [TNF-α], interleukin-17 [IL-17], and interleukin-4 [IL-4].

Determination of serum oxidative stress and antioxidant defense system biomarkers

Based on the methods described by Ahmed et al. [27], serum glutathione [GSH] levels, lipid peroxidation [LPO] product [malondialdehyde, MDA], and GSH-S-transferase [GST] activities were determined.

qRT-PCR assay for matrix metalloproteinase 13 [MMP-13] mRNA of ankle joint

RNA extraction kit that enables purification of high-quality RNA from tissues [ankle joint articular tissues] was purchased from Qiagen, USA. The method was carried out according the company’s instructions. Real-time qPCR amplification and analysis were performed using an Applied Biosystem with software version 3.1 [StepOne™, USA]. The qPCR assay with the primer sets was optimized at the annealing temperature. The primer sequence for MMP-13 was as follow: Forward: 5′-CCCTGGAATTGGCGACAAAG-3′; Reverse: 5′GCATGACTCTCACAATGCGATTAC-3′ [28].

Western blot analysis

Western blot analysis was performed as previously illustrated [29–31]. Ankle samples preserved at -20 ^oC were used to study the effect of BMMSCs and/or HA on the expression level of transforming growth factor beta1 [TGF-β1]. Briefly, ankles were homogenized in RIPA [radioimmunoprecipitation assay] buffer complemented with proteinase inhibitor, centrifuged, and the protein concentration was estimated in the clear homogenate supernatant by Bradford reagent. Thirty milligrams of proteins were separated on SDS-PAGE [sodium dodecyl sulphate-polyacrylamide gel electrophoresis], conveyed to nitrocellulose membranes, and blocked in 5% skimmed milk dissolved in a mixture of tris-buffered saline [TBS] Tween 20 [TBST]. Then, the loaded membranes were incubated with 1^ry antibodies against TGF-β1. After washing with TBST, the membranes were probed with the corresponding 2^ry antibodies and developed using an improved chemiluminescence assay kit [BIORAD, USA].

Western blot as well as ELISA and qRT-PCR were performed at the Laboratory of Biochemistry Department, Kasr Al Ainy Faculty of Medicine, Cairo University, Egypt.

Histopathological investigation

After sacrifice [six weeks], the right ankle joint of rats in the different groups were dissected out and fixed in 10% phosphate-buffered formalin. Then, decalcification process was carried out by using 10% formic acid solution, which was replaced twice weekly for 2 weeks, and the endpoint of decalcification was detected physically with a surgical blade. After complete decalcification, the samples were washed with PBS, dehydrated in a graded ethyl alcohol series, and embedded in paraffin wax. Sagittal sections measuring 5 µm in thickness by slidge microtome. The tissue sections were collected on glass slides and stained with hematoxylin and eosin [H & E] [32]. The prepared H & E-stained sections were examined to detect histological lesions. After histological examinations, sections were graded according to the system illustrated by Allam et al. [33] for pannus formation [synovial hypertrophy], inflammation represented by inflammatory cell infiltration, cartilage erosion, and bone damage. For each histological lesion, 4 grades were characterized; 0 = no lesion, 1 = mild, 2 = moderate, 3 = severe.

Histochemical Investigation

Prussian’s blue [Pb] staining technique for detection of iron oxide labeled therapeutic MSCs was used according to the method of Ellis [34]. Labeled therapeutic MSCs in joint tissues were marked by blue staining color.

Statistical analysis

Statistical analysis was carried out by SPSS [version 25], IBM software, USA [35]. Data were presented as mean ± standard error [SE], and statistical comparisons were analyzed by Duncan's test post hoc. Values of p < 0.05 were deemed significant however those of p > 0.05 were deemed non-significant.

Molecular characterization of BMMSCs

To characterize the isolated BMMSCs, qRT-PCR was performed to detect the expression of CD73, CD105, CD45 and CD34. It was noticed that the purified adherent cells at the end of incubation period exhibited high expressions of specific biomarkers of BMMSCs including CD73 and CD105 and very weak expressions of CD45 and CD34 which are specific biomarkers for hematopoietic stem cells [Figure 2].

Morphological feature

Figures 3 [a-o] showed the gross changes in the right legs of normal, osteoarthritic and osteoarthritic treated rats. The right hind leg ankles exhibited marked swelling and redness at the 4th, 5th and 6th weeks of MIA injection [Figure 3d-f] in comparison with those of normal rats [Figure 3a-c]. These deteriorated signs more pronounced as the period extended from the 4th to 6th weeks.

The treatment of MID-induced osteoarthritic Wistar rats with BMMSCs, HA and BMMSCs plus HA resulted in a remarkable amelioration of these morphological signs as showed in pictures g, h and i, pictures j, k and l, and pictures m, n and o of Fig. 3 at the 4th, 5th and 6th weeks, respectively.

Effect on right hind leg paw circumference

The change of right hind leg paw circumference in MIA-administered rats through six weeks after MIA administration and as a result of BMMSCs and/or HA treatment was shown in Table 2. The osteoarthritic control animals exhibited a significant [P < 0.05] increase in the hind leg paw edema; the recorded percentage increases were 95%, 68%, 65%, 64%, 61% and 50% at the 1st, 2nd and 3rd, 4th, 5th and 6th weeks respectively in relation to the normal control group. The treatment of the osteoarthritic rats with BMMSCs, HA, and BMMSCs + HA produced a significant decline of the elevated level of paw edema recording percentage changes − 17%, -22%, -17% respectively at the end of the experiment in comparison with the osteoarthritic control animals.

Table 2

Effect of BMMSCs and/ or HA treatments on right hind leg circumference at paw region (cm) of osteoarthritic rats
Paw edema Group	(Zero-day)	%	(3rd day)	%	(2nd wk)	%	(3rd wk)	%	(4th wk)	%	(5th wk)	%	(6^th wk)	%
Normal	1.5 ± 0.03^a	-	1.5 ± 0.03^b	-	1.7 ± 0.05^b	-	1.7 ± 0.05^b	-	1.7 ± 0.05^d	-	1.7 ± 0.05^d	-	1.8 ± 0.04^c	-
Osteoarthritic control	1.6 ± 0.05^a	5	3.0 ± 0.05^a	95	2.8 ± 0.04^a	68	2.8 ± 0.05^a	65	2.8 ± 0.03^a	64	2.7 ± 0.03^a	61	2.7 ± 0.03^a	50
Osteoarthritic + BMMSCs	1.7 ± 0.06^a	6	2.9 ± 0.06^a	-3	2.8 ± 0.05^a	-1	2.7 ± 0.03^a	-3	2.7 ± 0.04^c	-5	2.6 ± 0.04^b	-6	2.2 ± 0.07^b	-17
Osteoarthritic + HA	1.6 ± 0.06^a	4	2.9 ± 0.04^a	-2	2.9 ± 0.06^a	3	2.7 ± 0.06^a	-1	2.6 ± 0.04^b	-9	2.5 ± 0.05^c	-11	2.1 ± 0.04^b	-22
Osteoarthritic + BMMSCs + HA	1.6 ± 0.06^a	3	2.9 ± 0.04^a	-2	2.9 ± 0.05^a	2	2.8 ± 0.05^a	0	2.6 ± 0.05^bc	-7	2.5 ± 0.03^bc	-9	2.3 ± 0.05^b	-17
Data are expressed as mean ± standard error of mean (n = 6). In the same column, values with different superscript letters are significantly different at P < 0.05. Percentage changes were calculated by comparing osteoarthritic control with normal and osteoarthritic treated groups with osteoarthritic control.

Clinical score of arthritis

The change of clinical score of arthritis in MIA-administered rats through six weeks after MIA administration and as a result of BMMSCs, and/or HA treatment was shown in Table 3.

Table 3

Effect of BMMSCs and/ or HA treatments on clinical score of arthritis in osteoarthritic rats
Cl. score Croup		3rd day	%	2nd wk	%	3rd wk	%	4th wk	%	5th wk	%	6^th wk	%
Normal	0	0.2 ± 0.08^b	-	0.2 ± 0.08^b	-	0.2 ± 0.08^b	-	0.1 ± 0.07^c	-	0.1 ± 0.07^c	-	0.1 ± 0.07^c	-
osteoarthritic control	0	3.8 ± 0.13^a	1800	2.8 ± 0.20^a	1300	2.7 ± 0.16^a	1200	2.5 ± 0.25^a	2400	2.4 ± 0.22^a	2300	2.1 ± 0.2^a	2000
Osteoarthritic + BMMSCs	0	3.6 ± 0.17^a	-5	2.7 ± 0.21^a	-4	2.6 ± 0.16^a	-8	2.4 ± 0.25^a	4	2.0 ± 0.23^b	-13	0.7 ± 0.2^b	-67
Osteoarthritic + HA	0	3.7 ± 0.15^a	-3	2.8 ± 0.20^a	0	2.5 ± 0.16^a	-8	2.1 ± 0.13^b	-16	1.8 ± 0.21^b	-29	0.6 ± 0.1^b	-74
Osteoarthritic + BMMSCs + HA	0	3.7 ± 0.15^a	-3	2.7 ± 0.21^a	-4	2.4 ± 0.16^a	-8	2.5 ± 0.21^a	0	2.0 ± 0.21^b	-17	0.8 ± 0.2^b	-67
Data are expressed as mean ± standard error of mean (n = 6). In the same column, values with different superscript letters are significantly different at P < 0.05. Percentage changes were calculated by comparing osteoarthritic control with normal and osteoarthritic treated groups with osteoarthritic control.

The gross signs of arthritis started from the first day after MIA administration with slight swelling and redness, reaching a significant level [P < 0.05] at day 3 [acute osteoarthritis] and then exhibited slight gradually decrease in the clinical score until day 14 [chronic osteoarthritis] in MIA-administered rats. After treatment of the osteoarthritic rats with BMMSCs and/or HA, a significant decrease in the arthritis score was noticed in BMMSCs, HA, and BMMSCs + HA groups comparing with that in osteoarthritic rat.

Effect on serum TNF-α, IL-17 and IL-4 levels

Data describing the effect of BMMSCs and/or HA on the levels of pro-inflammatory and anti-inflammatory cytokines in serum of MIA-administered rats were represented in Table 4. The injection of MIA to rats induced a significant upregulation [P ˂ 0.05] of serum TNF-α level [399%] and IL-17 level [265%] and a significant downregulation [P ˂ 0.05] in serum IL-4 level [-56.91%] compared to normal group. The treatment of osteoarthritic rats with BMMSCs and/or HA caused a significant improvement [P ˂ 0.05] in serum TNF-α and IL-17 levels in relation to the osteoarthritic control. On the other hand, the serum IL-4 level was significantly enhanced due to BMMSCs and/or the HA treatments. Although the effects of BMMSCs, HA and BMMSCs ± HA on serum IL-4 level were similar, the effects of BMMSCs and HA on serum TNF-α and IL-17 levels were more potent than their combination.

Table 4

Effect of BMMSCs and/ or HA treatments on serum TNF -α, IL-17 (pro-inflammatory cytokines) and IL-4 (anti-inflammatory cytokine) levels in osteoarthritic rat
Parameters Groups	TNF-α (Pg/mL)	% change	IL-17 (Pg/mL)	% change	IL-4 (Pg/mL)	% change
Normal	16.6 ± 1.1^d	-	35.5 ± 1.4^e	-	117.6 ± 1.1^a	-
osteoarthritic control	82.7 ± 3.6^a	399	129.5 ± 1.4^a	265	48.8 ± 1.1^c	-59
osteoarthritic + BMMSC	30.6 ± 3.2^c	-63	60.7 ± 2^d	-53	96.4 ± 0.5^b	98
osteoarthritic + HA	29.0 ± 1.5^c	-65	70.4 ± 2.5^c	-46	97.4 ± 1.6^b	100
Osteoarthritic + BMMS + HA	43.6 ± 4.1^b	-47	76.1 ± 0.8^b	-41	96.3 ± 4^b	97
Data are expressed as mean ± standard error of mean (n = 6). In the same column, values with different superscript letters are significantly different at P < 0.05. Percentage changes were calculated by comparing osteoarthritic control with normal and osteoarthritic treated groups with

Effect on oxidative stress and antioxidant defense bioindicators

The effects of BMMSC and/or HA on serum oxidative stress and antioxidant defense biomarkers of MIA osteoarthritis were represented in Figs. 4 [LPO], Figs. 5 [GST] and Figs. 6 [GSH].

LPO was increased in osteoarthritic control Wistar rats. The intra-articular injections of arthritic rats with BMMSCs, HA and HA + BMMSCs produced a marked decrease of the elevated LPO. HA + BMMSCs was more potent in improving the LPO in osteoarthritic rats.

The intra-articular injection of MIA to Wistar rats significantly [P ˂ 0.05] decreased the serum GSH content as well as GST activities as compared to normal animals. As a result of BMMSCs treatment, all of the deleterious effects of MIA on the antioxidants were significantly [P ˂ 0.05] enhanced. In addition, HA significantly improve GSH content and the GST activity.

Effect on joint MMP-13

Data describing the effect of BMMSCs, HA and BMMSCs in combination with HA on joint tissue MMP-13 mRNA expression of MIA-administered Wistar rats were illustrated in Fig. 7. The MMP-13 mRNA expression vigorously increased in MIA-administrated rats as compared to normal group, while in all treated groups, the level of MMP-13 was significantly decreased [P < 0.05].

Effect on joint TGF-β1

The effect of BMMSCs and/or HA treatments on joint TGF-β1of MIA-administered rats were represented in Figs. 8 and 9. MIA-induced osteoarthritic rats showed a significant [P < 0. 05] increase in joint TGF-β1 protein expression in comparison with the normal non-arthritic rats. Supplying the MIA-induced osteoarthritic rats with either BMMSCs and/or HA by intra-articular injection significantly [P < 0. 05] resulted in TGF-β1 protein expression downregulation.

Effect on histopathological score

Ankle histological lesions were scored on a 0–3 scale in H&E-stained sections by a blinded pathologist. The present data revealed a significant [p < 0.05] decrease in the total histopathological score and in synovitis, pannus formation, bone erosion, and cartilage destruction of osteoarthritic rats treated with BMMSCs and/or HA compared to osteoarthritic control ones [Figure 10].

Histopathological changes of right ankle joint

H&E-stained section photomicrographs of ankle joint articular tissues of non-arthritic Wistar rats, revealed absence of inflammation and intact histological structures of the joints [bones, cartilages and fibrous joint capsules] [Figures 11a and 11b]. Photomicrographs of osteoarthritic control rats, however, showed striking histopathological changes, including synovial swelling, hyperplasia with infiltrations of numerous mononuclear leucocytic cells [lymphocytes, macrophages, and occasionally plasma cells], extensive pannus formation, and severe destruction [Figures 11c and 11d].

On the other hand, ankle joint photomicrographs of osteoarthritic rats supplemented with HA by intra-articular injection depicted mild signs of osteoarthritis [Figures 12c and 12d] while those treated with BMMSCs [Figures 12a and 12b], as well as concurrently treated with BMMSCs and HA [Figures 12e and 12f] exhibited less severe osteoarthritis pathology with moderate degree of inflammation. Microscopically, osteoarthritic rats indicated inflammation of the synovial membrane [synovitis] characterized by multiplicities of synovial lining cells, in 2–3 layers as well as proliferation of the underling blood vessels, which was associated with peri-vascular edema and diffused cellular infiltrations consisting of mononuclear leucocytic cells. Many ankle specimens had lesions caused by inflammatory cells that spread to the surrounding muscles and connective tissue in the peri-articular region. There were modest lesions of proliferative fibroblast-like cells and synovial sloughing in several synovial membrane regions. At the edge of the articular cartilage and at the level of the cartilage-bone, pannus development in the form of a single or multiple proliferating granulation tissue containing hyperplastic synoviocytes and inflammatory cells was also seen. Some arthritis-affected rats' articular cartilages showed superficial fibrillation linked to cell deaths or proliferations, uneven articular surfaces, and in some cases, mid-zone articular cartilages. Additionally, osteoclast activity and fibroplasia were seen in conjunction with the destruction and degeneration of the articular bone. However, HA-treated MIA-induced osteoarthritic Wistar rats exhibited milder forms of the previously known arthritic histological abnormalities. However, the histological lesions of arthritis in the osteoarthritic rats treated with BMMSCs and the group that received both BMMSCs and HA simultaneously exhibited mild to moderate severity.

Prussian blue [Pb] stained ankle sections

Rat ankle sections, of osteoarthritic groups treated with BMMSCs showed multiple Pb + ve cells. Many stem cells were detected under the synovial membrane and within the joint capsule connective tissue, and were stained blue with Prussian blue reflecting that the cells contained iron [Figures 13a and 13b].

Because of its short duration, simple measures, and parallels to human OA, MIA-induced OA is a popular experimental animal model for preclinical research; this experimental animal model is used with a high degree of validity for evaluating the anti-osteoarthritic properties of various agents [36]. On day 3, the mean clinical score for arthritis of the injected ankle was the greatest in the present study. Edema at the injection site decreased over time, and the lowest swelling was reached in the sixth week. These findings are consistent with those of Ma et al. in a previous investigation [37]. The elevated clinical score was significantly lower in the BMMSC, HA, and BMMSC + HA-treated rats than in the osteoarthritic control at the end of the experiment.

In this experiment, the right hind leg paw circumference was used as a measure of paw edema and gross swelling rate. Classically, anti-inflammatory effects in OA have been assessed via a change in paw volume [38]. In comparison to the rats in the normal group, all osteoarthritic control and osteoarthritic-treated rats displayed considerable swelling of the injected ankle three days after MIA injection. Treatment with BMMSC, HA, or BMMSC + HA effectively decreased the enlarged right hind paw circumference in osteoarthritic rats. The reduction in circumference as a result of treatment with BMMSC and HA reflects a reduction in swelling rate, which could be attributed to improved edema, attenuation of the inflammatory process, and suppression of synovial hyperplasia, as confirmed by the histopathological results of joints in this study and as revealed by previous investigations [2, 39, 40].

Inflammation and inflammatory responses are essential contributors in the development and progression of OA. Pro-inflammatory and inflammatory cytokines have long been recognized as important mediators in the development and progression of OA [10, 40, 41, 42, 43, 44]. The dysregulation of these CD4⁺ T cells cytokines has been identified as a crucial role in the pathogenesis of OA [Figure 14] [45]. T-helper 1 [Th1] cells release pro-inflammatory cytokines like TNF-α, IL-1β, interferon-gamma [IFN-], IL-2, IL-12, IL-6, and IL-8, whereas T-helper 2 [Th2] cells release anti-inflammatory cytokines like IL-4, IL-5, IL-10, and IL-13 [46]. In addition, Th17 secret another proinflammatory cytokine, IL-17. In the current study, the osteoarthritic rats exhibited a profound elevation in the serum concentrations of Th1 cytokine [TNF-α] and Th17 cytokine [IL-17] and a significant depletion in Th2 cytokine [IL-4] level after 6 weeks of MIA injection in comparison with normal control. These findings confirmed the dominance of Th1 and Th17 on Th2 in MIA-induced OA [Figure 14] and are in parallel with the data of Li et al. [47], who revealed that after MIA treatment, serum TNF-α and IL-17 expression was considerably higher in rats with OA than in healthy rats. The increased amounts of pro-inflammatory cytokines may indicate their important impacts in the pathophysiology of experimental arthritis [41, 44]. TNF-α is a key inflammatory mediator implicated in the induction of chronic inflammatory conditions [48] and it has been reported to be linked to the progression of OA and rheumatoid arthritis [7, 8, 47, 49, 50, 51]. IL-17 has the potential to cause matrix damage and inflammation in OA patients [52]. The present results are also in accordance with Ahmed et al. [9], Saber et al. [51], Ahmed et al. [53], Ahmed et al. [54], and Zhang et al. [55] who reported a significant drop in IL-4 expression in arthritic rats in relation to normal control.

The administration of BMMSC, HA and BMMSC + HA to osteoarthritic rats, in the present study, significantly downregulated the elevated levels of proinflammatory cytokines, TNF-α and IL-17, and upregulated the anti-inflammatory cytokines including IL-4. These finding confirmed the dominance of Th2 on Th1 and Th17 in osteoarthritic rats treated with BMMSC, HA, or BMMSC + HA, which have anti-inflammatory effects [Figure 14]. Despite the effects of BMMSCs, HA and BMMSCs + HA on serum IL-4 levels were similar, the effects of BMMSCs and HA on serum TNF-α and IL-17 levels were more efficient than their combination. When Th2 predominates in inflamed tissues, IL-4 is produced in high amounts to counteract the inflammatory effects by lowering the production and activity of pro-inflammatory cytokines [56]. IL-4 is thought to have chondroprotective properties by reducing both proteoglycan breakdown and MMP production in articular cartilages [57]. The results in the present study was consistent with Ahmed et al. [7] and Ahmed et al. [9] who revealed a significant downregulation of ankle TNF-α expression and serum TNF-α level respectively and with Abd-Elhalem et al. [58], Endrinaldi et al. [59] and Ahmed et al. [8] who reported a significant rise in IL-4 expression and its blood levels in arthritic rats treated with MSC. Furthermore, Mao et al. [60] reported that MSC therapy successfully suppressed the expression of IL-17 in collagen-induced arthritis in mice, according to a prior study, suggesting that MSCs may achieve their immunosuppressive activity by downregulating IL-17 expression. In concurrence with the presented study, Wang et al. [61] also found that the treatment of osteoarthritic rats with HA and human amniotic MSCs separately or in combination effectively reduced TNF-α levels and increased IL-4 levels in plasma and synovial fluid in knee of osteoarthritic rats after 28 days and 56 days after MIA injection. Overall, these findings show that the three therapies in the current study reduce MIA-induced inflammation during OA by downregulating pro-inflammatory mediators and increasing anti-inflammatory effects [Figure 14].

Oxidative stress appears to play a role in the pathogenesis of OA. Oxidative stress affects both cells and extracellular matrix. In the presence of antioxidant defense system attenuation, the elevated levels of reactive oxygen species [ROS] signal disease development [62]. Several studies have found that ROS not only have the capability to oxidize and thereby cause damage to many of the components of a joint, but also play a role in regulating different inflammatory processes that contribute to the disease's etiology [Figure 14] [63,64,65,66].

The level of LPO, a marker of a degenerative process in which oxidative stress destroys cell membranes and other lipid-containing structures, increased considerably in the serum of osteoarthritic control rats in relation to the normal group in the current study. Many studies have demonstrated that the amount of LPO is elevated in MIA-induced OA, which is consistent with our findings [8, 65, 66]. GSH and GST, for example, are key antioxidant systems that protect the cell from free radicals [67]. Endogenous antioxidant enzymes are widely known for avoiding oxidative damage by neutralizing reactive oxygen species [ROS] before any other molecules may become targets [68]. In the current study, a significant reduction in the levels of these antioxidants in osteoarthritic rats provides substantial evidence of oxidative damage's role in MIA-induced OA. GSH is an important antioxidant since it has been proven to have a vital function in cellular resistance to oxidative stress. It is produced endogenously in the liver and serves as the body's initial line of defense against peroxidation. As a result, in chronic arthritis, the amount of GSH appears to be a reflux mechanism to guard against extracellular free radicals [69]. The osteoarthritic group had a substantial drop in serum GSH content in the current investigation. This is consistent with other previous publications [70, 71]. GST is one of the most important elements of the cellular defense system against oxidative stress [72]. In the current investigation, it was discovered that GST activity was significantly reduced in MIA-induced osteoarthritic rats as compared to normal rats. Similar effects on GST and other antioxidant enzyme levels were noted by Pathak et al. [65] and Hamdalla et al. [71] in the serum of rats with osteoarthritis associated with increase in MIA level as marker of LPO. Due to enhanced turnover to detoxify extra lipoperoxidation products, GST activity was lower in MIA-induced OA. In human osteoarthritic chondrocytes, GST has been demonstrated to have a role in cellular defenses against oxidative stress-induced cell death [73]. Chemopreventive drugs that target and modulate these physiological defense mechanisms have become a part of numerous treatment regimens.

Treatments with BMMSC, HA, and BMMSC plus HA resulted in a profound downregulation in LPO levels in the current investigation. When compared to the osteoarthritic control group, GSH content and GST activity were dramatically improved and raised near to normal levels. These findings are concurrence with those of previous studies, which found that MSCs improved the oxidative stress environment by lowering LPO and increasing GSH levels [58, 74]. According to Aniss et al. [39], HA treatment decreased oxidative stress and boosted the antioxidant defense system, which is compatible with the findings of the present study. The TNF-α-stimulated gene/proteins generated by MSCs, which reduce ROS production and, as a result, reduce chronic inflammation, are thought to play a role in the antioxidant function of MSCs [75]. Other results showed that HA also decreased the harmful effects of ROS and reactive nitrogen species on mitochondrial DNA integrity and repair, ATP generation, and cell survival [76].

Numerous variables have been identified as contributing to the pathophysiology of OA. Degradation of the extracellular matrix [ECM], which is seen as a direct result of the activity of matrix-degrading enzymes, is a characteristic of OA. By reducing the extracellular matrix, matrix metalloproteinases [MMPs], such as MMP13, are important enzymes that target cartilage for breakdown [77]. This MMP is produced in response to inflammatory mediators found in tissues and OA joint fluid, such as interleukin-1-beta [IL-1] and tumor necrosis factor [TNF-α] [Figure 14] [78]. MMP13 mRNA expression was found to be considerably higher in the joints of MIA-osteoarthritic control rats in our study compared to normal rats. This is in line with the findings of [79], who discovered that MIA-induced OA's high MMP-13 level implied ongoing cartilage disintegration. The enhanced inflammatory cytokines like TNF-α, which were demonstrated in the current study, may have stimulatory effects that led to the rise in MMP-13 expression. BMMSC, HA, and BMMSC + HA substantially decreased the elevated MMP-13 mRNA synthesis in the joint in osteoarthritic rats. These findings concur with those of several earlier research. MMP-13 mRNA expression was dramatically reduced in rats with OA following MSC therapy, according to Song et al. [80] and Li et al. [81] research. By limiting the expression of enzymes that break down the extracellular matrix, other researchers found that administering HA to OA-affected rats led to a substantial drop in the mRNA expression levels of MMP-3, MMP-9, and MMP-13 [82, 83].

TGF-β is a cytokine that affects both healthy and OA-affected joints. However, the function of this cytokine in a normal, healthy joint differs significantly from that of an OA-affected joint [84]. TGF-1β signalling plays a crucial role in the growth, remodeling, and maintenance of bone and cartilage in a healthy joint [84]. In OA-affected joints, however, persistent and high levels of active TGF-β1 were noticed [85]. Chondrocyte apoptosis and cartilage degradation in OA were reported to be caused by mechanical stress-induced upregulation of TGF-β1 [Figure 14] [86]. Multiple intra-articular injections of TGF-1β, despite the fact that it appears to enhance chondrogenesis, may also worsen osteoarthritis [87]. When compared to control rats in the current investigation, MIA-induced osteoarthritic rats had a significantly higher production of the TGF-β1 protein in the joints. This effect was similar to the one observed by Waly et al. [88], who reported that serum TGF-β1 levels were significantly elevated in the OA group after MIA administration. When compared to osteoarthritic control rats, the administration of BMMSC and/or HA to MIA-induced rats dramatically reduced the production of the TGF-β1 protein. This is consistent with the findings of a prior study by Abdelmawgoud and Saleh [74], who found that injecting MSCs into arthritic rats led to a rapid reversal of tissue inflammation and a decreased tissue level of TNF-α and TGF-β1. This drastic effect was accompanied by a reduced tissue level of TNF-α and TGF-β1. The current findings are in line with those of the study by Kanazawa et al. [89], which showed that TGF-β1 was much lower in the group of arthritis sufferers treated with HA than in the group of arthritis sufferers in the control condition. Treatment with BMMSC plus HA is associated with higher joint TGF-β1 protein expression than normal. Assembly, it can be suggested that the decrease in TGF-β1 protein expression by treatments of osteoarthritic rats with BMMSCs and HA could have an important impact in the prevention of chondrocyte apoptosis and cartilage damages [Figure 14].

In this work, rats with MIA-induced osteoarthritis had detrimental histological alterations in their ankle joints, including synovial hyperplasia, degraded articulating cartilage, and pannus development. These histological alterations may be brought on by an increase in oxidative stress, a weakened antioxidant defense system, an increase in pro-inflammatory and inflammatory cytokines [TNF-α and IL-17], and a reduction in anti-inflammatory cytokine levels [IL-4]. Histopathological analysis of rats given MIA injections revealed periarticular inflammation, severe synovitis, bone resorption, and cartilage degradation. These findings are consistent with prior research that found the MIA group to have degenerative articular cartilage alterations [e.g., synovial thickening, cartilage loss, and osteophyte development] [90]. These results are consistent with Suhaeb et al. [91], Chiang et al. [5], and Chen et al. [92], who identified the potential anti-osteoarthritic effects of BMMSC treatment. Treatment with BMMSC and/or HA was associated with a significant reduction in joint cartilage and synovial membrane inflammation, as well as a significant restoration of histopathological alterations, when compared to the osteoarthritic control group. Lower levels of pro-inflammatory cytokines [TNF-α and IL-17], MMP-13, and greater levels of anti-inflammatory cytokines were associated with these advantages [IL-4]. According to our findings, all treatments significantly reduced paw edema, arthritic score, and system and ankle measurements. The enhancement of antioxidant defense system, as well as the repression of oxidative stress and inflammation, may be responsible for these advantages [Figure 14].

In comparison to osteoarthritic rats, treatment with HA decreased the severity of MIA-induced OA by inhibiting inflammation, pannus development, cartilage degradation, and bone resorption. This result is similar with Jimbo et al. [93], who discovered that HA had chondroprotective properties. Histological analysis showed that cartilage degradation was considerably decreased in MIA-induced osteoarthritic rats treated with HA compared to MIA-induced osteoarthritic control rats. Intra-articular HA injections are also thought to cause synovial cells to secrete endogenous HA, increasing the viscosity of the joint fluid. Another proposed mechanism is the chondroprotective impact that HA and aggrecan have when used together. This causes strongly negatively charged aggregates to form, which absorb water and improve cartilage durability. HA's biochemical actions prevent the inflammatory process from building up to the point where it destroys joints [91]. In contrast to our findings, Chiang et al. [5] found that HA alone had no meaningful therapeutic advantages in slowing the progression of OA. This ineffectiveness might be attributed to the use of sub-optimal HA dosage for cartilage regeneration, single-dose injections, or a long time between OA induction and HA injection.

In addition, when MIA-induced osteoarthritic rats were treated with a combination of HA and BMMSC for six weeks following MIA induction, OA development was significantly reduced compared to osteoarthritic rats. These findings suggested that intra-articular injections of BMMSCs paired with HA might effectively slow the development of OA while also promoting cartilage repair. These findings corroborate those of Chiang et al. [5], who found that combining HA and MSCs effectively suppressed OA-related histological alterations in rabbits. According to Wang et al. [61], HA can boost the effects of MSCs on cartilage healing in a synergistic manner. The restorative process is thought to be due to the fact that adding HA to MSCs boosts their overall activity, including chondrogenic differentiation, proliferation, colonisation, and regenerative modulation. Choong et al. [95] found that HA had no additional effect on MSC during intra-articular injections of HA-MSCs. The local tissue environment was responsible for the transition of MSCs into functional lineage-committed cells like chondrocytes. This might explain why BMMSC did not deliver the predicted better regeneration potential in the HA-BMMSC combo. The combination of the two had no extra impacts on BMMSC's ability to heal injured cartilage, as indicated by the fact that the histopathological scores in the HA-BMMSCs group were not statistically different from those treated with HA and BMMSCs independently in the current investigation.

The current findings demonstrate that BMMSCs and HA have substantial anti-inflammatory, antioxidant, and anti-arthritic effects in Wistar rats with MIA-induced osteoarthritis. When BMMSC and HA were given together, there was no further preventative or therapeutic impact of either BMMSC or HA against MIA-induced OA in Wistar rats, suggesting that using either HA or BMMSCs alone successfully lowers OA development. BMMSC and/or HA's anti-osteoarthritic actions may be mediated by their ability to regulate inflammation and oxidative stress, as well as diminish MMP-13 production. However, further research is needed to determine the efficacy and safety of BMMSCs and HA in the treatment of OA in both animals and humans.

osteoarthritis

MIA

monosodium iodoacetate

BMMSCs

bone marrow mesenchymal stem cells

hyaluronic acid

NSAIDs

non-steroidal anti-inflammatory drugs

IACUC

Institutional Animal Care and Use Committee

ELISA

Enzyme-Linked Immunosorbent Assay

TNF-α

tumor necrosis factor-α

IL-17

interleukin-17

IL-4

interleukin-4 .

LPO

lipid peroxidation

MDA

malondialdehyde

GST

GSH-S-transferase

MMP-13

matrix metalloproteinase 13

TGF-β1

transforming growth factor beta1

ROS

reactive oxygen species

Conflicts of Interest: The authors declare no conflict of interest.

Ethical Approval: All animal approaches are in harmony with the standard guidelines of the Institutional Animal Care and Use Committee [IACUC], Beni-Suef University, Beni-Suef, Egypt [Approval number: BSU/020-107]. The study is reported in accordance with ARRIVE guidelines.

Author Contributions: Conceptualization, GHR, WA, UH, HA, SA, KA and OMA,; methods, FMH, WA, EAM, FSA, HSA and OMA; Supervision, GHR, WA, UH and OMA; Formal and Statistical analysis, FMH and OMA; Resources, WA, FMH, EAM, FSA, HSA and OMA; Writing—original draft preparation, FMH, EAM, HA, SA, KA and OMA; Writing—review and editing, GHR, FMH, WA, UH, FSA, HSA , HA, SA, KA and OMA.

Funding: No External Funding

Acknowledgement: The authors are thankful to Prof. Dr. Laila Rashed, Department of Medical Biochemistry and Molecular Biology, Faculty of Medicine, Cairo University, Cairo, Egypt for performing Western blot analysis and Prof. Dr. Dina Sabry, Department of Medical Biochemistry and Molecular Biology, Faculty of Medicine, Cairo University, Cairo, Egypt for performing qRT-PCR analysis.

Data Availability Statement: All data are found in the article

Consent to Participate: Not applicable

Consent to Publish: All authors have read and agreed to the published version of the manuscript.

Legrand CB, Lambert CJ, Comblain FV, Sanchez C, Henrotin YE. Review of soluble biomarkers of osteoarthritis: Lessons from animal models. Cartilage 2017; 8[3]: 211-233.
Fan MP, Si M, Li BJ, Hu GH, Hou Y, Yang W, et al. Cell therapy of a knee osteoarthritis rat model using precartilaginous stem cells. Eur. Rev. Med. Pharmacol. Sci. 2018; 22: 2119-2125.
Kimmerling KA, Gomoll AH, Farr J, Mowry KC. Amniotic suspension allograft modulates inflammation in a rat pain model of osteoarthritis. Journal of Orthopaedic Research, 2020; 38[5]: 1141-1149.
Bao J, Chen Z, Xu L, Wu L, Xiong Y. Rapamycin protects chondrocytes against IL-18-induced apoptosis and ameliorates rat osteoarthritis. Aging [Albany NY], 2020; 12[6]: 5152.
Chiang ER, Ma HL, Wang JP, Liu CL, Chen TH, Hung SC. Allogeneic mesenchymal stem cells in combination with hyaluronic acid for the treatment of osteoarthritis in rabbits. PloS one, 2016; 11[2]: e0149835.
Feng C, Luo X, He N, Xia H, Lv X, Zhang X, Lin X. Efficacy and persistence of allogeneic adipose-derived mesenchymal stem cells combined with hyaluronic acid in osteoarthritis after intra-articular injection in a sheep model. Tissue Engineering Part A, 2018; 24[3-4]: 219-233.‏
Ahmed EA, Ahmed OM, Fahim HI, Ali TM, Elesawy BH, Ashour MB. Potency of bone marrow-derived mesenchymal stem cells and indomethacin in complete Freund’s adjuvant-induced arthritic rats: Roles of TNF-α, IL-10, iNOS, MMP-9, and TGF-β1. Stem Cells International 2021; 2021: 6665601.
Ahmed RH, Galaly SR, Moustafa N, Ahmed RR, Ali TM, Elesawy BH, et al. Curcumin and mesenchymal stem cells ameliorate ankle, testis, and ovary deleterious histological changes in arthritic rats via suppression of oxidative stress and inflammation. Stem Cells Int. 2021b; 2021:3516834.
Ahmed EA, Ahmed OM, Fahim HI, Mahdi EA, Ali TM, Elesawy BH, et al. Combinatory effects of bone marrow-derived mesenchymal stem cells and indomethacin on adjuvant-induced arthritis in Wistar rats: Roles of IL-1β, IL-4, Nrf-2, and oxidative stress. Evid Based Complement Alternat Med. 2021c; 2021:8899143.
Ragab GH, Halfaya FM, Ahmed OM, Abou El-Kheir, W, Mahdi EA., Ali, TM, et al. Platelet-rich plasma ameliorates monosodium iodoacetate-induced ankle osteoarthritis in the rat model via suppression of inflammation and oxidative stress. Evidence-Based Complementary and Alternative Medicine 2021; 2021: 6692432.
Delco ML, Goodale M, Talts JF, Pownder SL, Koff MF, Miller AD, et al. Integrin α10β1-selected mesenchymal stem cells mitigate the progression of osteoarthritis in an equine talar impact model. The American Journal of Sports Medicine, 2020; 48[3]: 612-623.‏
Zhu C, Wu W, Qu X. Mesenchymal stem cells in osteoarthritis therapy: a review. American Journal of Translational Research, 2021; 13[2], 448–461.
Xiang XN, Zhu SY, He HC, Yu X, Xu Y, He C. Mesenchymal stromal cell-based therapy for cartilage regeneration in knee osteoarthritis. Stem Cell Res. Ther. 2022;13: 14.
Harrell CR, Markovic BS, Fellabaum C, Arsenijevic A, Volarevic, VMesenchymal stem cell-based therapy of osteoarthritis: Current knowledge and future perspectives. Biomedicine and Pharmacotherapy 2019; 109, 2318-2326.‏
Augello A, Tasso R, Negrini SM, Cancedda R, Pennesi G. Mesenchymal stem cells prevent tissue damage in collagen‐induced arthritis. Arthritis & Rheumatism, 2007; 56[4]: 1175-1186.‏
Kehoe O, Cartwright A, Askari A, El Haj AJ, Middleton J. [2014]: Intra-articular injection of mesenchymal stem cells leads to reduced inflammation and cartilage damage in murine antigen-induced arthritis. Journal of translational medicine, 12[1], 157
Al Faqeh H, Hamdan BMYN, Chen HC, Aminuddin BS, Ruszymah BHI. The potential of intra-articular injection of chondrogenic-induced bone marrow stem cells to retard the progression of osteoarthritis in a sheep model. Experimental Gerontology 2012; 47[6], 458-464.‏
Neuenschwander HM, Moreira JJ, Vendruscolo CP, Fülber J, Seidel, SR, Michelacci YM et al. Hyaluronic acid has chondroprotective and joint-preserving effects on LPS-induced synovitis in horses. Journal of Veterinary Science, 2019; 20[6]: e67. ‏
Kloppenburg M, Kroon FP, Blanco FJ, Doherty M, Dziedzic KS., Greibrokk, E, et al. 2018 update of the EULAR recommendations for the management of hand osteoarthritis. Annals of the Rheumatic Diseases, 2019; 78[1]:16-24.‏
Sun X, Jiang H, Yang, H. In vitro culture of bone marrow mesenchymal stem cells in rats and differentiation into retinal neural-like cells. Journal of Huazhong University of Science and Technology-Medical Sciences 2007; 27: 598-600.
Chaudhary JK, Rath, PC. A simple method for isolation, propagation, characterization, and differentiation of adult mouse bone marrow-derived multipotent mesenchymal stem cells. Journal of Cell Science & Therapy. 2017; 8[1]: 1-12.
Ahmed OM, Hassan M.A, Saleh AS. Combinatory effect of hesperidin and mesenchymal stem cells on the deteriorated lipid profile, heart and kidney functions and antioxidant activity in STZ-induced diabetic rats. Biocell 2020; 44[1]: 2.
Aboul-Fotouh GI, Zickri, MB, Metwally HG, Ibrahim IR, Kamar SS, Sakr W. Therapeutic effect of adipose derived stem cells versus atorvastatin on amiodarone induced lung injury in male rat. International Journal of Stem Cells 2015; 8[2]: 170.
Ghanayem YEA, Ashour FA, Rashed LA, Zoair MAH, Abd El – Hai OM. The Role of Bone Marrow Derived Mesenchymal Stem Cells In Attenuation Of Renal Failure In Adult Male Albino Rats. Al-Azhar Medical Journal, 2016; 45[1], 135-148.‏
Möller KÄ, Klein S, Seeliger F, Finn A, Stenfors C, Svensson CI. Monosodium iodoacetate-induced monoarthritis develops differently in knee versus ankle joint in rats. Neurobiology of Pain 2019; 6: 100036.‏
Wijekoon HS, Kim S, Bwalya EC, Fang J, Aoshima K, Hosoya K, et al. Anti-arthritic effect of pentosan polysulfate in rats with collagen-induced arthritis. Research in Veterinary Science, 2019; 122: 179-185.‏
Ahmed OM, Abd El-Twab SM, Al-Muzafar HM, Adel Amin K, Abdel Aziz SM, Abdel-Gabbar M. Musa paradisiaca L. leaf and fruit peel hydroethanolic extracts improved the lipid profile, glycemic index and oxidative stress in nicotinamide/streptozotocin-induced diabetic rats. Vet Med Sci. 2020; 00:1–12.
Fukushima E, Monoi N, Mikoshiba S, Hirayama Y, Serizawa T, Adachi K, et al. Acetaminophen reduces ibuprofen-induced gastric damage. Journal of Pharmacology and Experimental Therapeutics 2014; 349 [1]: 165-173.
Tawfik NG; Mohamed WR, Mahmoud HS, Alqarni MA, Naguib IA, Fahmy AM, et al. Isatin counteracts diethylnitrosamine/2-acetylaminofluorene-induced hepatocarcinogenesis in male Wistar rats by upregulating anti-Inflammatory, antioxidant, and detoxification pathways. Antioxidants 2022; 11: 699.
Yassin NYS, AbouZid SF, El-Kalaawy AM, Ali TM, Almehmadi MM, Ahmed OM. Silybum marianum total extract, silymarin and silibinin abate hepatocarcinogenesis and hepatocellular carcinoma growth via modulation of the HGF/c-Met, Wnt/β-catenin, and PI3K/Akt/mTOR signaling pathways. Biomedicine & Pharmacotherapy 145, 2022: 112409.
Yassin NYS, AbouZid SF, El-Kalaawy AM, Ali TM, Almehmadi MM, Ahmed OM. Silybum marianum total extract, silymarin and silibinin abate hepatocarcinogenesis and hepatocellular carcinoma growth via modulation of the HGF/c-Met, Wnt/β-catenin, and PI3K/Akt/mTOR signaling pathways. Biomed Pharmacother. 2022; 145: 112409. [32] Suvarna KS, Layton C, Bancroft JD. Bancroft's theory and practice of histological techniques E-Book. Elsevier Health Sciences. p. 2017. ‏
Allam G, Mahdi EA, Alzahrani AM, Abuelsaad AS. Ellagic acid alleviates adjuvant induced arthritis by modulation of pro-and anti-inflammatory cytokines. Central-European Journal of Immunology, 2016; 41[4], 339.
Ellis R. Perl’s Prussian blue stains protocol. South Australia: Pathology Division, Queen. 2007.
IBM Corp. Released 2017. IBM SPSS Statistics for Windows, Version 25.0. Armonk, NY: IBM Corp.
South S, Crabtree K, Vijayagopal P, Averitt D, Juma, S. Dose Dependent Effects of Whole Blueberry on Cartilage Health and Pain in a Monosodium Iodoacetate [MIA] Induced Rat Model of Osteoarthritis. Current Developments in Nutrition 2020; 4 [Supplement 2]: 477-477.
Ma Y, Guo H, Bai F, ZHanG M, Yang L, DenG J, et al. A rat model of knee osteoarthritis suitable for electroacupuncture study. Experimental Animals, 2018; 17-0142.
Gui B, Zhang J, Wang S, Rong, G. Anti-osteoarthritic and anti-Inflammatory activities of diazine: In vitro and in vivo studies. Medical science monitor: International Medical Journal of Experimental and Clinical Research 2018; 24: 76.
Aniss NND, Zaazaa AM, Saleh MRA. Anti-arthritic effects of platelets rich plasma and hyaluronic acid on adjuvant-induced arthritis in rats. Pharmacology 2020; 16[1]: 33-46.
Halfaya FM, Ragab GH, Hagag U, Ahmed OM, Abou Elkheir W. Effect of Platelet-rich Plasma on MMP-13, ARE and TGF β1 in MIA-Induced Osteoarthritis in Rats. J Vet Med Res. 2021; 27 [2]: 109–118.
Liu YL, Lin HM, Zou R, Wu JC, Han R, Raymond LN, Qin ZH. Suppression of complete Freund's adjuvant-induced adjuvant arthritis by cobratoxin. Acta Pharmacologica Sinica 2009; 30[2]: 219-227.
Chen C, Zhang C, Cai L, Xie H, Hu W, Wang T, et al. Baicalin suppresses IL-1β-induced expression of inflammatory cytokines via blocking NF-κB in human osteoarthritis chondrocytes and shows protective effect in mice osteoarthritis models. International Immunopharmacology 2017; 52: 218-226.
Lu J, Feng, X, Zhang H, Wei Y, Yang Y, Tian Y, Bai L. Maresin-1 suppresses IL-1β-induced MMP-13 secretion by activating the PI3K/AKT pathway and inhibiting the NF-κB pathway in synovioblasts of an osteoarthritis rat model with treadmill exercise, Connective Tissue Research, 2021; 62[5]: 508-518.
Halfaya FM, Ragab GH, Hagag U, Ahmed OM, Abou Elkheir W. Efficacy of hyaluronic acid in the treatment of MIA-induced ankle osteoarthritis in rats and its effect on antioxidant response element. J. Vet. Med. Res. 2021; 27 [2]: 119– 127.
Paramalingam SS, Thumboo J, Vasoo S, Thio ST, Tse C, Fong, KY. In vivo pro-and anti-inflammatory cytokines in normal and patients with rheumatoid arthritis. Annals Academy of Medicine Singapore 2007; 36[2]: 96.‏
Luckheeram RV, Zhou R, Verma AD, Xia B. CD4⁺T cells: differentiation and functions. Clin Dev Immunol. 2012; 2012: 925135.
Li H, Xie S, Qi Y, Li H, Zhang R, Lian, Y. TNF α increases the expression of inflammatory factors in synovial fibroblasts by inhibiting the PI3K/AKT pathway in a rat model of monosodium iodoacetate induced osteoarthritis. Experimental and Therapeutic Medicine, 2018; 16[6]: 4737-4744.
Han L, Song JH, Yoon JH, Park YG, Lee SW, Choi YJ, et al. TNF-α and TNF-β Polymorphisms are Associated with Susceptibility to Osteoarthritis in a Korean Population. Korean Journal of Pathology, 2012; 46[1]: 30.
Ahmed OM, EL-Abd SF, El Mahdi EA, Abdou EA. Curcumin ameliorative efficacy on type 1 diabetes mellitus coexisted with rheumatoid arthritis in Wistar rats. Merit Research Journal of Medicine and Medical Science. 2015; 3[7]: 256–270.
Ahmed OM, Ashour MB, Fahim HI, Ahmed NA. The role of Th1/Th2/Th17 cytokines and antioxidant defense system in mediating the effects of lemon and grapefruit peel hydroethanolic extracts on adjuvant-induced arthritis in rats. Journal of Applied Pharmaceutical Science 2018; 8 [10]; 069-081.
Saber MS, Fahim HI, Ahmed OM, Ahmed NA, Abdel-Gabbar M. Assessment of the preventive effects of Silybum marianum [L.] Gaertn. seeds hydroethanolic extract and silymarin on complete Freund’s adjuvant induced arthritis in Wistar rats. Annals of Phytomedicine 2020; 9[2]: 172–182.
Mimpen JY, Carr AJ, Dakin SG, Snelling SJ. Inhibition of interleukin-17-induced effects in osteoarthritis-an in vitro study. Osteoarthritis and Cartilage 2018; 26: S118.
Ahmed OM, Soliman HA, Mahmoud B, Gheryany RR. Ulva lactuca hydroethanolic extract suppresses experimental arthritis via its anti-inflammatory and antioxidant activities. Beni-Suef University Journal of Basic Applied Science 2017; 6[4]:394–408.
Ahmed OM, Ashour MB, Fahim HI, Ahmed NA. Citrus limon and paradisi fruit peel hydroethanolic extracts prevent the progress of complete freund’s adjuvant-induced arthritis in male Wistar rats. Adv. Anim. Vet. Sci. 2018; 6[10]: 443-455.
Zhang X, Yang Y, Li X, Zhang H, Gang Y, Bai L. Alterations of autophagy in knee cartilage by treatment with treadmill exercise in a rat osteoarthritis model. International Journal of Molecular Medicine 2019; 43[1]: 336-344.
Goldring MB. The role of the chondrocyte in osteoarthritis. Arthritis and Rheumatism: Official Journal of the American College of Rheumatology 2000; 43[9]:1916-1926.
Van Meegeren, M. E., Roosendaal, G., Jansen, N. W., Wenting, M. J., van Wesel, A. C., van Roon JA, Lafeber FP. IL-4 alone and in combination with IL-10 protects against blood-induced cartilage damage. Osteoarthritis and Cartilage 2012; 20[7]: 764-772.
Abd-Elhalem SS, Haggag NZ, El-Shinnawy NA. Bone marrow mesenchymal stem cells suppress IL-9 in adjuvant-induced arthritis. Autoimmunity 2018; 51[1]: 25-34.
Endrinaldi E, Darwin E, Zubir N, Revilla G. The Effect of Mesenchymal Stem Cell Wharton’s Jelly on Matrix Metalloproteinase-1 and Interleukin-4 Levels in Osteoarthritis Rat Model. Open Access Macedonian Journal of Medical Sciences 2019; 7[4]: 529.
Mao F, Xu WR, Qian H, Zhu W, Yan YM, Shao QX, et al. Immunosuppressive effects of mesenchymal stem cells in collagen-induced mouse arthritis. Inflammation Research, 2010; 59[3]: 219-225.
Wang A-T, Zhang Q-F, Wang N-X, Yu C-Y, Liu R-M, Luo Y, Zhao Y-J, et al. Cocktail of Hyaluronic Acid and Human Amniotic Mesenchymal Cells Effectively Repairs Cartilage Injuries in Sodium Iodoacetate-Induced Osteoarthritis Rats. Front. Bioeng. Biotechnol. 2020; 8:87.
Yamada EF, Salgueiro AF, Goulart ADS, Mendes VP, Anjos BL, Folmer V et al. Evaluation of monosodium iodoacetate dosage to induce knee osteoarthritis: Relation with oxidative stress and pain. International Journal of Rheumatic Diseases, 2019; 22[3]: 399-410.
Kunsch C, Sikorski JA, Sundell CL. Oxidative stress and the use of antioxidants for the treatment of rheumatoid arthritis. Current Medicinal Chemistry-Immunology, Endocrine & Metabolic Agents 2005; 5[3]: 249-258.
Tokarz P, Kaarniranta K, Blasiak J. Role of antioxidant enzymes and small molecular weight antioxidants in the pathogenesis of age-related macular degeneration [AMD]. Biogerontology, 2013; 14[5]: 461-482.
Pathak NN, Balaganur V, Lingaraju MC, Kant V, Kumar D, Kumar D, Sharma AK, Tandan SK. Effect of atorvastatin, a HMG-CoA reductase inhibitor in monosodium iodoacetate-induced osteoarthritic pain: implication for osteoarthritis therapy. Pharmacol Rep. 2015; 67[3]:513-9.
Zahan OM, Serban O, Gherman C, Fodor D. The evaluation of oxidative stress in osteoarthritis. Medicine and Pharmacy Reports. 2020; 93[1]: 12.
Bhattacharyya A, Chattopadhyay R, Mitra S, Crowe SE. Oxidative stress: an essential factor in the pathogenesis of gastrointestinal mucosal diseases. Physiological Reviews, 2014; 94[2]: 329-354.
Lobo V, Patil A, Phatak A, Chandra N. Free radicals, antioxidants and functional foods: Impact on human health. Pharmacognosy Reviews. 2010; 4[8]: 118.
Chen Y, Singh S, Matsumoto A, Manna SK, Abdelmegeed MA, Golla, S, et al. Chronic glutathione depletion confers protection against alcohol-induced steatosis: implication for redox activation of AMP-activated protein kinase pathway. Scientific Reports, 2016; 6[1]: 1-13.
Cifuentes DJ, Rocha LG, Silva LA, Brito AC, Rueff-Barroso CR, Porto LC, et al. Decrease in oxidative stress and histological changes induced by physical exercise calibrated in rats with osteoarthritis induced by monosodium iodoacetate. Osteoarthritis and Cartilage 2010; 18[8]:1088-1095.
Hamdalla HM, Ahmed RR, Galaly SR, Ahmed OM, Naguib IA, Alghamdi BS, et al. Assessment of the efficacy of bone marrow-derived mesenchymal stem cells against monoiodoacetate-induced osteoarthritis model in Wistar rats. Stem Cells International, 2022; 2022: in press
Canter PH, Wider B, and Ernst E. The antioxidant vitamins A, C, E and selenium in the treatment of arthritis: A systematic review of randomized clinical trials. Rheumatology, 2007; 46[8]: 1223-1233.
Vaillancourt F, Fahmi H, Shi Q, Lavigne P, Ranger P, Fernandes JC, et al. 4-Hydroxynonenal induces apoptosis in human osteoarthritic chondrocytes: the protective role of glutathione-S-transferase. Arthritis Research & Therapy, 2008; 10[5]: R107.
Abdelmawgoud H, Saleh A. Anti-inflammatory and antioxidant effects of mesenchymal and hematopoietic stem cells in a rheumatoid arthritis rat model. Adv Clin Exp Med. 2018; 27[7]: 873-880
He Z, Hua J, Qian D, Gong J, Lin S, Xu C, Song Z. Intravenous hMSCs ameliorate acute pancreatitis in mice via secretion of tumor necrosis factor-α stimulated gene/protein 6. Scientific Reports 2016; 6: 38438.
Grishko V, Xu M, Ho R., Mates A, Watson S, Kim JT, Pearsall AW. Effects of hyaluronic acid on mitochondrial function and mitochondria-driven apoptosis following oxidative stress in human chondrocytes. Journal of Biological Chemistry, 2009; 284[14]: 9132-9139.‏
De Santis M, Di Matteo B, Chisari E, Cincinelli G, Angele P, Lattermann C, et al. The Role of Wnt Pathway in the Pathogenesis of OA and Its Potential Therapeutic Implications in the Field of Regenerative Medicine. Biomed. Res. Int. 2018; 2018:7402947.
Yan Z, Xiong J, Zhao C, Qin C, He C. Decreasing cartilage damage in a rat model of osteoarthritis by intra-articular injection of deoxycholic acid. International Journal of Clinical and Experimental Medicine 2015; 8[6]: 9038.
Lu J, Zhang T, Sun H, Wang S, Liu M. Protective effects of dioscin against cartilage destruction in a monosodium iodoacetate [MIA]-indcued osteoarthritis rat model. Biomedicine & Pharmacotherapy 2018; 108: 1029-1038.
Song F, Tang J, Geng R, Hu H, Zhu C, Cui W, Fan W. Comparison of the efficacy of bone marrow mononuclear cells and bone mesenchymal stem cells in the treatment of osteoarthritis in a sheep model. Int. J. Clin. Exp. Pathol. 2014; 7[4]: 1415-26.
Li J, Zhu X, Shao Q, Xu F, Sun, G. Allogeneic adipose-derived stem cell transplantation on knee osteoarthritis rats and its effect on MMP-13 and DDR2. Experimental and Therapeutic Medicine 2019; 18[1]: 99-104.
Hashizume M, Koike N, Yoshida H, Suzuki M, Mihara, M. High molecular weight hyaluronic acid relieved joint pain and prevented the progression of cartilage degeneration in a rabbit osteoarthritis model after onset of arthritis. Modern Rheumatology 2010; 20[5]: 432-438.
Kim, SE, Lee JY, Shim KS, Lee S, Min K, Bae JH, et al. Attenuation of inflammation and cartilage degradation by sulfasalazine-containing hyaluronic acid on osteoarthritis rat model. International Journal of Biological Macromolecules, 2018; 114: 341-348
Fang J, Xu L, Li Y, Zhao, Z. Roles of TGF-beta 1 signaling in the development of osteoarthritis. Histology and Histopathology, 2016; 31[11]: 1161-1167.
Van Der Kraan PM. Differential role of transforming growth factor-beta in an osteoarthritic or a healthy joint. Journal of Bone Metabolism, 2018; 25[2]: 65-72.
Zhang RK, Li GW, Zeng C, Lin, CX, Huang LS, Huang GX, et al. Mechanical stress contributes to osteoarthritis development through the activation of transforming growth factor beta 1 [TGF-β1]. Bone & Joint Research, 2018; 7[11]: 587-594.
Seidel SRT, Vendruscolo CP, Moreira JJ, Fülber J, Ottaiano TF, Oliva MLV, Michelacci YM, Baccarin RYA. Does Double Centrifugation Lead to Premature Platelet Aggregation and Decreased TGF-β1 Concentrations in Equine Platelet-Rich Plasma? Vet. Sci. 2019; 6[3]: 68.
Waly NE, Refaiy A, Aborehab NM. IL-10 and TGF-β: Roles in chondroprotective effects of Glucosamine in experimental osteoarthritis?. Pathophysiology, 2017; 24[1]: 45-49.
Kanazawa K, Hagiwara Y, Tsuchiya M, Yabe Y, Sonofuchi K, Koide M, Sekiguchi T, Itaya N, Ando A, Saijo Y, Itoi E. Preventing effects of joint contracture by high molecular weight hyaluronan injections in a rat immobilized knee model. Int. J. Clin. Exp. Pathol. 2015;8[4]:3426-40.
Jimbo S, Terashima Y, Takebayashi T, Teramoto A, Ogon, I. A novel rat model of ankle osteoarthritis induced by the application of monoiodoacetate. J Arthritis, 2017; 6[260], 2, ISO 690.
Suhaeb AM, Naveen S, Mansor A, Kamarul, T. Hyaluronic acid with or without bone marrow derived-mesenchymal stem cells improves osteoarthritic knee changes in rat model: a preliminary report. Indian Journal of Experimental Biology 2011; 50:383-390.
Chen W, Sun Y, Gu X, Hao Y, Liu X, Lin J, Chen, S. Conditioned medium of mesenchymal stem cells delays osteoarthritis progression in a rat model by protecting subchondral bone, maintaining matrix homeostasis, and enhancing autophagy. Journal of Tissue Engineering and Regenerative Medicine, 2019; 13[9]: 1618-1628.
Jimbo S, Terashima Y, Teramoto A, Takebayashi T, Ogon I, Watanabe K, Sato T, Ichise N, Tohse N, Yamashita T. Antinociceptive effects of hyaluronic acid on monoiodoacetate-induced ankle osteoarthritis in rats. J Pain Res. 2019 3;12:191-200.
Choong PF, Jee CSY, Leong CF, and Cheong SK. Effect of hyaluronan on mesenchymal stem cells. Med. J. Malaysia 2010; 65 Suppl B: 80-81.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Ameliorative Effects of Bone Marrow-derived Mesenchymal Stem Cells and Hyaluronic Acid on Monosodium Iodoacetate-Induced Ankle Osteoarthritis in Wistar Rats: Roles of Th1/Th2/Th17 cytokines, MMP-13, TGF-β1 and antioxidant defense system

Status:

Version 1

Abstract

Figures

Introduction

Material and methods

Chemicals

Preparation of complete culture medium

Isolation and culture of BMMSCs

Cell viability analysis

Labeling of BMMSCs

Morphological examination of BM-MSCs

Experimental animals

Monosodium iodoacetate [MIA]-Induced OA

Experimental design and animal grouping

Measurement of leg circumference

Assessment of clinical signs of inflammation and Scoring of arthritis

Determination of serum cytokine levels

Determination of serum oxidative stress and antioxidant defense system biomarkers

qRT-PCR assay for matrix metalloproteinase 13 [MMP-13] mRNA of ankle joint

Western blot analysis

Histopathological investigation

Histochemical Investigation

Statistical analysis

Results

Molecular characterization of BMMSCs

Morphological feature

Effect on right hind leg paw circumference

Clinical score of arthritis

Effect on serum TNF-α, IL-17 and IL-4 levels

Effect on oxidative stress and antioxidant defense bioindicators

Effect on joint MMP-13

Effect on joint TGF-β1

Effect on histopathological score

Histopathological changes of right ankle joint

Prussian blue [Pb] stained ankle sections

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1