Long Non-Coding RNA BCYRN1 Exerts an Oncogenic Rrole in Colorectal Cancer through Regulating miR-204-3p/KRAS Axis

doi:10.21203/rs.3.rs-33110/v1

Download PDF

Primary research

Long Non-Coding RNA BCYRN1 Exerts an Oncogenic Rrole in Colorectal Cancer through Regulating miR-204-3p/KRAS Axis

https://doi.org/10.21203/rs.3.rs-33110/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 14 Sep, 2020

Read the published version in Cancer Cell International →

You are reading this older preprint version

Read the latest preprint version →

Background: It has been well documented that long non-coding RNAs (lncRNAs) regulate numerous characteristics of cancer, including proliferation, migration, metastasis, apoptosis, even metabolism. LncRNA BCYRN1 (BCYRN1) is a newly identified brain cytoplasmic lncRNA with 200-nucleotide, which was discovered highly expressed in tumor tissues of cancer, including hepatocellular carcinoma, gastric cancer and lung cancer. However, the roles of BCYRN1 in colorectal cancer (CRC) remain obscure. This study was designed to reveal the acts of BCYRN1 in the occurrence and progression of CRC.

Methods: RT-PCR was used to detect the expression level of BCYRN1 in tumor tissues and CRC cell lines. Knock down BCYRN1 in CRC cells, evaluate cell proliferation changes by CCK-8 test, EdU test, and Ki-67 and PCNA expression; evaluate cell migration and invasion changes by wound healing assay, Transwell assay and invasion-related protein expression . Through flow cytometry analysis to assess whether BCYRN1 regulates apoptosis of CRC cells. The dual luciferase reporter gene detects the competitive binding of BCYRN1 to miR-204-3p. In vivo experiments to evaluate the effect of BCYRN1 on tumor development. TargetScan analysis and dual luciferase reporter gene detect the target gene of miR-204-3p. Rescue experiments verified the effect of BCYRN1 on CRC by regulating the effect of miR-204-3p on KRAS.

Results: We found that compared with normal tissues and human intestinal epithelial cells (HIECs), BCYRN1 levels were significantly increased in tumor tissues and cell lines of CRC. We further determined that knockdown of BCYRN1 inhibited proliferation, migration, invasion, and promoted apoptosis of CRC cells. In addition, bioinformatics analysis and dual luciferase reporter assay showed that BCYRN1 served as a competitive endogenous RNA (ceRNA) to regulate the development of CRC through competitively binding to miR-204-3p. Further studies proved that overexpression of miR-204-3p reversed the effects of BCYRN1 on CRC. Next, TargetScan analysis and dual luciferase reporter assay indicated that KRAS was a target gene of miR-204-3p and negatively regulated by miR-204-3p. A series of rescue experiments showed that BCYRN1 affected the occurrence and development of CRC by regulating the effects of miR-204-3p on KRAS. In addition, tumorigenic experiments in CRC model mice confirmed that down-regulated BCYRN1 effectively inhibited tumor growth.

Conclusions: Our findings suggested that BCYRN1 plays a carcinogenic role in CRC by regulating the miR-204-3p/KRAS axis.

Cancer Biology

lncRNA BCYRN1

miR-204-3p

KRAS

colorectal cancer

Colorectal cancer (CRC) has a high incidence and mortality in worldwide, specifically, ranking third in cancer morbidity and second in cancer mortality globally [1, 2]. Meanwhile, CRC has become one of the most common and dangerous malignancies in China [3]. The mainstay treatment of CRC is surgery, chemotherapy, radiotherapy and other comprehensive therapies, but the 5-year survival rate has not changed significantly in the past decades, which is still poor [4, 5]. Therefore, delivering high-efficiency CRC diagnosis and treatment should be the aim of all physicians in internal medicine research. The present study aims to provide an up-to-date molecular mechanism of CRC occurrence.

Recently, epigenetic changes have been reported to play important roles in the occurrence and progression of malignancies [6, 7]. Long non-coding RNAs (lncRNAs) are a class of transcripts with a length more than 200-nucleotides and has limited or non-protein coding potential [8–10]. Various researches demonstrated that lncRNAs participate in multi-level regulation of gene expression by targeting with microRNAs (miRNAs), mRNAs, and even proteins [11, 12]. Furthermore, growing evidences proved that lncRNAs regulate multiple characteristics of cancer, such as proliferation, migration, apoptosis, even metastasis [13, 14]. LncRNA BCYRN1 (BCYRN1) is a brain cytoplasmic lncRNA, which is newly identified and activated by c-MYC [15]. It has been reported that BCYRN1 is highly expressed in various tumor tissues [16], such as hepatocellular carcinoma [17], gastric cancer [18], and lung cancer [15], but is lower expressed in the healthy control (HC) tissues. Besides, BCYRN1 played an important role in inhibiting smooth muscle differentiation and vascular development in the cardiovascular system [19, 20]. However, little is known about the role of BCYRN1 in CRC, which aroused our great interest for the relationship of BCYRN1 and CRC.

MiRNAs are group of small, non-coding RNAs with the nucleotides about 22 and are identified as a negative regulator [21, 22]. Specifically, miRNA is involved in gene expression by binding to the complementary sequence location of 3'-untranslated region (3’-UTR) of target mRNA to disturb the structure stability and translation of mRNAs [23, 24]. Increasing evidences have demonstrated that miRNA played crucial roles in the cancer, cardiovascular disease and other diseases [22, 25] by regulating relative cell proliferation, migration, invasion and apoptosis [23]. On the other hand, lncRNA competitively binds to miRNA as a competitive endogenous RNA (ceRNA), resulting in the inability combination of the miRNA with its corresponding mRNA, thus regulating gene expression and function [11, 26, 27].

The present study aims to find out the function and underlying mechanism of BCYRN1 on CRC progression. Our research determined that BCYRN1 played an oncogenic role in CRC by regulating the miR-204-3p/KRAS axis, revealing a novel mechanism for the occurrence and development of CRC, and providing a novel therapeutic and prognosis target for CRC.

Experimental human tissues and animals

The research tissues of CRC patients and HC people were obtained from The Affiliated Cancer Hospital of Nanjing Medical University and all the patients signed the written consents. Tissue debris was immediately frozen in liquid nitrogen after surgery and stored at − 80 °C. All animal experiments were designed according to the standards of the Guide for the Care and Use of Laboratory Animals (NIH, 8th edition, 2011). The Ethics Committee of The Affiliated Cancer Hospital of Nanjing Medical University approved present research.

Cell culture

Four human CRC cell lines LoVo, HCT116, SW480, SW620 and human intestinal epithelial cells (HIECs) were purchased from American Type Culture Collection (ATCC, USA) and cultured in DMEM (Gibco, USA) contained with 10% fetal bovine serum (FBS; Gibco, USA), 100 IU/mL penicillin and 100 mg/mL streptomycin in humidified atmosphere containing 5% CO₂ at 37 °C.

Cell transfection

The shRNA-BCYRN1 (sh-BCYRN1), shRNA-KRAS (sh-KRAS) and corresponding shRNA negative control (sh-NC) transfection were performed using Lipofectamine 3000 reagent (Invitrogen, USA) conforming to the manufacturer’s introductions. Besides, RNAifectin™ transfection reagent, negative control (NC), miR-204-3p mimic and miR-204-3p inhibitor were obtained from Applied Biological Materials Inc. (Richmond, Canada). HIECs and CRC cells were cultured into 6-well plates for transfection, and the efficiency of transfection was determined by qRT-PCR.

RNA extraction and qRT-PCR

Total RNA was exacted from human tissues, mouse tissues and cells with a Trizol reagent (Life Technologies, USA). Reverse transcriptase experimments were performed with PrimeScript® RT reagent Kits (Takara Bio Inc, Japan) and StepOnePlus™ Real-Time PCR System (Applied Biosystems, USA). Next, the quantitative reactions were made with SYBR Green RT-PCR (Takara Biotechnology Co., Japan) by StepOnePlus™ system. GAPDH and U6 snRNA were used as the internal control, respectively. Primers were used for qPCR as follows: BCYRN1 sense: TAAGCTTGTAACCTGCACCCGATTCACAG; anti-sense: TGGCAGCATACTCCTGACCATACTACCCG; miR-204-3p sense: GGGAAGGCAAAGGGACGT; anti-sense: CTCAACTGGTGTCGTGGATGC; KRAS sense: AGGCCTGCTGAAAATGACTGAATAT; anti-sense: GCTGTATCGTCAAGGCACTCTT; GAPDH sense: 5’-GGAAAGCTGTGGCGTGAT-3’, anti-sense: 5’- AAGGTGGAAGAATGGGAGTT-3’; U6 sense: CTCGCTTCGGCAGCACAT; anti-sense: AACGCTTCACGAATTTGCGT.

Evaluation of cell proliferation

Cell proliferation was detected by cell counting kit-8 (CCK-8) report, 5-ethynyl-2’-deoxyuridine (EdU) incorporation test, a nucleoprotein Ki-67 and proliferating cell nuclear antigen (PCNA) expression. Firstly, for CCK-8 experiment, cells were seeded into a 96-well plate with 10% FBS DMEM for 24 h. Then, the medium was changed with serum free DMEM for CCK-8 kit (Beyotime Biotechnology, China) detection. The microplate reader (ELX800, USA) was used to determine the absorbance at 450 nm, which is reflecting cell viability and proliferation. Secondly, cells were seeded into a 24-well plate for EdU assessment. After 48-h transfection, DNA synthesis was examined with EdU incorporation assay (RiboBio, China). The proportion of EdU-positive cells was analyzed by a fluorescence microscopy (Axio Vert. A1, Germany). Lastly, cell proliferation was evaluated by Ki-67 and PCNA expression. Ki-67 is a nucleoprotein that is a marker of tumor proliferation [28]. PCNA acts on chromatin and is participated in all aspects of the DNA replication chain [25]. The expression levels of Ki-67 and PCNA can evaluate the status of cell proliferation.

Evaluation of cell migration and invasion

Cell migration and invasion were assessed with the Wound-Healing assay, Transwell assay and invasion-related proteins expression. For Wound-Healing assay, cells were seeded into a 6-well plate. A sterile 1 mL pipette tip was used to scratch the bottom of plate to form a gap. The images of cell migration were captured at 0 h and 24 h after transfection, respectively, with an inverted microscope (Axio Vert. A1, Germany). The average distance of migration was calculated, which reflects the cell migration capacity. For Transwell assay, cells were plated into the no FBS medium in the upper chamber of a 12-well Transwell with 8-µm pore size (Merck kGaA, Germany). 10% FBS medium was added into the lower chamber. After 24 h, the cells that migrated to the submembrane surface were stained with crystal violet. And stained cells were counted in 6 randomly selected regions. In addition, Cyclooxygenase-2 (Cox-2) is an enzyme complex that plays significant roles in metastasis and invasion of malignancies [29]. Matrix metalloproteinase (MMP) family, especially the gelatinases MMP-2 and MMP-9, are recognized as markers of tumor migration and invasion [30]. The expression of Cox-2, MMP-2 and MMP-9 can reflect the status of cell migration and invasion.

Flow cytometric analysis

Flow cytometric analysis was designed to evaluate whether BCYRN1 regulated the apoptosis of CRC cells. Consistently, cells were seeded into a 6-well plate. The cells were collected and stained with Annexin V-FITC (Beyotime Biotechnology, China) and propidium iodide (PI) regent after 48 h transfection according to the manufacturer’s instructions. Then, the cell apoptosis was determined by a flow cytometry (Becton Dickinson, USA).

Dual luciferase reporter assay

The partial sequences of BCYRN1 and 3'-untranslated region (3’-UTR) of KRAS containing the putative binding sites of miR-204-3p were synthesized and inserted into a luciferase reporter vector plasmid (Genepharma, China). According to the instruction, firefly luciferase reporter plasmid, equal amounts of miR-204-3p mimics or negative control mimics (NC) were transfected into cells, respectively. Then, the relative luciferase activities were detected by the Dual-Luciferase Reporter Assay System (Promega, USA) on Luminometer 20/20n (Turmer Biosystems, USA) after transfection for 48 h.

In vivo experiments

The nude mice were injected subcutaneously with CRC cells (about 10⁶ cells) into the right flanks. Then, sh-NC or sh-BCYRN1 was directly injected into the mice to knockdown the BCYRN1. Tumor size was measured every 5 day for total of 6 times. At the end of the experiments, mice were humanely sacrificed with overdose anesthesia for the collection of tumors. Each tumor was weighed to evaluate the effects of BCYRN1 on the development of tumors.

Immunohistochemistry

Tumors were obtained as above description, fixed in 4% paraformaldehyde, embedded in paraffin, and then cut into 10 µm sections. After de-paraffinization and block, the sections incubated with primary anti-Ki67 (1:100; Abcam, USA) overnight at 4 °C. The immunofluorescence images were captured with an Olympus BX51 microscope (Olympus, Japan) after incubating horseradish peroxidase-conjugated goat anti-rabbit antibody.

HE staining and TUNEL fluorescence staining

Hematoxylin-eosin (HE) staining and terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick-end labeling (TUNEL) staining were performed to detect cancer cell apoptosis of mouse tumor tissues. Briefly, mouse tumor tissues were prefixed, and the paraffin-embedded sections were stained with Hematoxylin-eosin and TUNEL (containing 2 µL TdT enzyme, 48 µL Fluorescent labeling solution and 50 µL TUNEL detection solution) according to the manufacturer’s instructions. The images were obtained with an Olympus BX51 microscope (Olympus, Japan) coupled with an Olympus DP70 digital camera.

Western blot analysis

The protein expression levels of Ki-67, PCNA, Cox-2, MMP-2, MMP-9, Bax, Bcl-2, Cleaved caspase-3, Cleaved caspase-9 and KRAS were detected by Western blot analysis. Total protein was extracted and separated with SDS-PAGE, then, transferred to PVDF membrane. Protein bands were visualized with Enhanced Chemiluminescence Detection Kit (Thermo Fisher Scientific, USA). All primary antibodies were obtained from Abcam (Cambridge, USA).

Statistical analysis

Experiments were conducted in a randomized, double-blinded situation. Data are expressed as mean ± SD. Student’s unpaired t-test was detected to compare the difference between two groups. One-way or two-way ANOVA followed by post hoc Bonferroni test was employed for multiple comparisons. Statistical significance was considered as *P < 0.05, **P < 0.01, and ***P < 0.001.

BCYRN1 is highly expressed in the tissues and cell lines of CRC

In our preliminary study, we noted that BCYRN1 was highly expressed in the CRC tissues (Fig. 1A). Then, we examined the expression levels of BCYRN1 in HIECs and four types of human CRC cell lines. Consistently, BCYRN1 expression was significantly increased in CRC cell lines (Fig. 1B). These data aroused our great interests that the BCYRN1 levels may be closely related to the development of CRC.

Knockdown of BCYRN1 inhibits proliferation and promotes apoptosis of CRC cells

To further illuminate the roles of BCYRN1 on CRC, a series of experiments were designed in LoVo and SW480 cells, respectively. Firstly, we used sh-BCYRN1 to down-regulate the endogenous BCYRN1, and the knockdown efficiency was shown in Fig. 2A. CCK-8 and EdU assays showed that down-regulation of BCYRN1 evidently decreased proliferation of LoVo and SW480 cells (Fig. 2B & C). Furthermore, knockdown of BCYRN1 obviously inhibited the expression of proliferation-related proteins, such as PCNA and Ki-67 (Fig. 2D). Subsequently, we detected cell apoptosis by flow cytometry analysis. The results showed that knockdown of BCYRN1 significantly increased apoptosis of LoVo and SW480 cells (Fig. 2E). In addition, several pro-apoptosis proteins, including Bax, cleaved caspase-3 and cleaved caspase-9 [31, 32] were highly expressed in LoVo and SW480 cells, when they were treated with sh-BCYRN1. In contrast, the expression of Bcl-2, an inhibitor for cell apoptosis [32], was abolished in sh-BCYRN1 group (Fig. 2F). These results indicated that BCYRN1 knockdown reduced the proliferation, while promoted the apoptosis of CRC cells.

Down-regulation of BCYRN1 decreases migration and invasion of CRC cells

Next, we investigated the effects of BCYRN1 expression on CRC cell migration and invasion. Both Wound-Healing and Transwell assays revealed that the migration and invasion of LoVo and SW480 cells were effectively suppressed by sh-BCYRN1 transfection (Fig. 3A & B). Consistently, migration- and invasion-related proteins, such as Cox-2, MMP-2 and MMP-9, were inhibited in LoVo and SW480 cells treated with sh-BCYRN1 (Fig. 3C). These consequences elucidated that the BCYRN1 levels were closely related with the migration and invasion properties of CRC cells.

MiR-204-3p is a target gene of BCYRN1

Recent report has shown that lncRNAs function as competing endogenous RNAs (ceRNAs) to competitively bind to miRNAs [11]. In order to illuminate the potential regulatory mechanism through which BCYRN1 affected CRC progression, we proceeded bioinformatic analysis by LncBase Predicted V.2 and found that BCYRN1 possessed a putative binding site for miR-204-3p (Fig. 4A). To determine the interaction of BCYRN1 and miR-204-3p, we performed dual luciferase reporter analysis and found significantly reduction in the luciferase activity of BCYRN1 WT when the LoVo or SW480 cells were transfected with miR-204-3p mimics. However, there was no notable difference in luciferase activity of BCYRN1 Mut between miR-204-3p mimics group and negative control (NC) group (Fig. 4B). Accordingly, down-regulation of BCYRN1 distinctly increased the expression miR-204-3p in LoVo and SW480 cells (Fig. 4C). In addition, qRT-PCR results revealed that miR-204-3p was significantly reduced in CRC tumor tissues and cell lines, especially in LoVo and SW480 cells (Fig. 4D & E). These data proved that miR-204-3p was a target gene of BCYRN1 and was negatively regulated by BCYRN1.

Effects of miR-204-3p on CRC cells proliferation, migration, invasion and apoptosis

We then studied the role of miR-204-3p in the regulation of CRC progression. Firstly, we used miR-204-3p mimics to treat LoVo and SW480 cells. The overexpression efficiency of miR-204-3p was showed in Fig. 5A. Then, we found that miR-204-3p up-regulation apparently inhibited cell proliferation as demonstrated by CCK-8 and EdU assays (Fig. 5B & C). In addition, the data of flow cytometry analysis revealed that miR-204-3p overexpression accelerated cell apoptosis (Fig. 5D). Consistently, the ability of CRC cell migration was obviously decreased by miR-204-3p mimics (Fig. 5E). These results concluded that miR-204-3p up-regulation inhibited CRC cell proliferation, migration and invasion, while promoted CRC cell apoptosis.

KRAS is a target gene of miR-204-3p

We further explored the underlying mechanism of miR-204-3p in CRC. TargetScan, a miRNA target prediction database, was used to predict the downstream gene of miR-204-3p. We found that KRAS was a possible target gene of miR-204-3p, which the predicted position of the combination is in location 310–317 of KRAS 3’-UTR (Fig. 6A). It is generally known that KRAS is a crucial carcinogenic factor [33]. Moreover, the results of dual luciferase reporter analysis confirmed that KRAS was indeed the target gene of miR-204-3p (Fig. 6B). More significantly, overexpression of miR-204-3p inhibited the expression of KRAS mRNA and protein in LoVo and SW480 cells (Fig. 6C & D). We next investigated the relationship between KRAS levels and CRC progress. We noted that KRAS was highly expressed in CRC tumor tissues and cell lines (Fig. 6E & F). These consequences manifested that KRAS was a target gene of miR-204-3p and was negatively regulated by miR-204-3p.

Effects of BCYRN1/miR-204-3p/KRAS axis on CRC cell proliferation, migration, invasion and apoptosis

To understand the effects of BCYRN1/miR-204-3p/KRAS axis on CRC progression, we designed a series of rescue experiments using miR-204-3p inhibitor, sh-KRAS and sh-BCYRN1 in LoVo and SW480 cells. All the knockdown efficiency of miR-204-3p and KRAS in CRC cells that treated with sh-BCYRN1 was showed in Fig. 7A. Then, we found that miR-204-3p inhibitor significantly facilitated proliferation of LoVo and SW480 cells treated with sh-BCYRN1, whereas sh-KRAS effectively reversed such effects (Fig. 7B & C). Furthermore, miR-204-3p inhibitor abolished the apoptosis of sh-BCYRN1-treated CRC cells, whereas the sh-KRAS relieved these phenomena (Fig. 7D). Besides, the migration of sh-BCYRN1 treated CRC cells was evidently increased in miR-204-3p inhibitor-treated group, while sh-KRAS reversed these roles (Fig. 7E). These data indicated that BCYRN1 deteriorated CRC progression at least in part by inhibiting miR-204-3p levels and promoting KRAS expression.

Knockdown of BCYRN1 inhibits the tumor growth

To evaluate the therapeutic potential of BCYRN1 in CRC patients, we performed BCYRN1 knockdown by using sh-BCYRN1 in CRC model mice. Encouragingly, knockdown of BCYRN1 significantly decreased the tumor volume and weight in CRC model mouse (Fig. 8A-C). HE staining, Immunohistochemical staining and TUNEL fluorescence staining showed that down-regulation of BCYRN1 inhibited Ki67 expression and promoted cancer cell apoptosis (Fig. 8D). More importantly, sh-BCYRN1 treatment obviously promoted the expression levels of miR-204-3p and decreased the expression of KRAS (Fig. 8E). These results revealed that knockdown of BCYRN1 inhibited the development of CRC.

Cancer mortality remains an enormous public health challenge on a global context [34]. Although new advances have been made in the genomic changes in most different cancers [35], the molecular mechanisms underlying the development of CRC are poorly understood. What's worse, compared with other malignancies, a large number of CRC patients have distant metastasis at the early stage of diagnosis, which leads to a low 5-year survival rate of about 10%-20% [36]. In addition, therapeutic methods are very limited in advanced CRC patients, mainly in combination with toxic drugs, such as 5-fluorouracil, irinotecan and/or oxaliplatin for chemotherapy. Therefore, the molecular mechanism involved in the occurrence and development of CRC needs to be explored urgently. Our current study revealed an important new mechanism for the occurrence of CRC and provided a novel idea for the effective treatment of CRC, briefly, to control the CRC progression through interference with BCYRN1.

LncRNA has been shown to play vital roles in the regulation of cancer progression [13, 14], which the mainly functions of lncRNA are recruiting chromatin modification complexes for transcriptional regulation [37] and interacting miRNA, mRNA, and/or protein for post-transcriptional regulation [11, 12]. It has been proved that, one of most common and crucial roles of lncRNA is served as a “miRNA sponge” [27, 38]. It means that lncRNA can be used as a bait to bind with a specific miRNA, resulting in the inability combination of the miRNA with its corresponding mRNA. BCYRN1 is a newly identified lncRNA with similar characteristics [15]. Previous researches have revealed that miRNAs, such as miR-125-5p, miR-149 and miR-490-3p, act as the target of BCYRN1 in hepatocellular carcinoma, human glioma and lung cancer respectively [17, 37, 40]. Our present study indicated that BCYRN1 was involved in the occurrence and development of CRC through specific binding to a new target miRNA: miR-204-3p. We found that BCYRN1 was highly expressed, while the expression levels of miR-204-3p were significantly reduced in the tissues and cell lines of CRC. Besides, knockdown of BCYRN1 distinctly increased the miR-204-3p expression. These findings provide new insights for the mechanism of CRC progression and treating CRC.

As mentioned above, miRNAs are involved in the regulation of cancer [22, 23]. Interestingly, miRNAs can be acted as a tumor suppressor gene [41] or as an oncogene [42] to regulate the biological characteristics of cancer. Cui ZH et al reported that miR-204-3p acts on its potential target gene fibronectin 1 (FN1) and inhibited its expression, thereby decreasing the growth of hepatocellular carcinoma tumor endothelial cells [43]. Recently, several studies have reported that the roles of miR-204-3p in ovarian cancer [44], lung adenocarcinoma [45] and bladder cancer [46], but the functions of miR-204-3p on CRC remain obscure. Our current research showed that miR-204-3p was a potential target gene of BCYRN1 and was negatively regulated by BCYRN1. We further investigated that miR-204-3p overexpression inhibited CRC cell proliferation, migration and invasion, while exacerbated CRC cell apoptosis. In addition, bioinformatics analysis and dual luciferase reporter assay proved that KRAS was a potential target gene of miR-204-3p. KRAS is an important oncogene and a key tumor-maintenance gene in many carcinomas [33]. Then, we showed that KRAS was highly expressed in CRC tissues and cell lines, and overexpression of miR-204-3p eliminated such effect. These results reminded us that overexpression miR-204-3p and down-regulation KRAS can be considered as new approaches to the treatment of CRC.

In summary, these findings demonstrated that BCYRN1 participated in the occurrence and development of CRC. In terms of functional regulation, BCYRN1 promoted CRC progression at least in part by regulating miR-204-3p/KRAS axis. Our study broadens the current understanding of BCYRN1 function in CRC and provides a novel therapeutic target for CRC.

BCYRN1 is highly expressed in the tissues and cell lines of CRC.

Down-regulation of BCYRN1 decreases、migration and invasion of CRC cells. Knockdown of BCYRN1 promotes apoptosis of CRC cells.

MiR-204-3p is a target gene of BCYRN1 and affects CRC cell proliferation, migration, invasion and apoptosis.

KRAS is a target gene of miR-204-3p, BCYRN1/miR-204-3p/KRAS axis affects the proliferation, migration, invasion and apoptosis of CRC cells.

Knockdown of BCYRN1 inhibits the tumor growth.

Ethics approval and consent to participat

This study was carried out based on the Ethics Committee of The Affiliated Cancer Hospital of

Nanjing Medical University. The clinical analysis was performed according to the principles of Helsinki Declaration.

Consent for publication

All authors agree to publish.

Availability of data and material

Yes.

Competing interests

None.

Funding

This study was funded by the National Natural Science Foundation of China (81602145 to L.Y.), Jiangsu Provincial Natural Science Foundation (BK20171509 to L.Y.), Jiangsu Provincial Medical Youth Talent, The Project of Invigorating Health Care through Science, Technology Education (QNRC2016649 to L.Y.), the China Postdoctoral Science Foundation (2018M632265 to L.Y.), and The Talents Program of Jiangsu Cancer Hospital (YC201812 to L.Y.).

Authors' contributions

Liu Yang conceived and designed the study. Liu Yang , Yinan Zhang , Jun Bao, Ji-Feng Feng performed the literature search and data extraction. Liu Yang analyzed the data and the manuscript.

Acknowledgements

None.

Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394–424.
Arnold M, Sierra MS, Laversanne M, et al. Global patterns and trends in colorectal cancer incidence and mortality. Gut. 2017;66(4):683–91.
Brenner H, Kloor M, Pox CP. Colorectal cancer. Lancet. 2014;383(9927):1490–502.
Dekker E, Rex DK. Advances in CRC Prevention: Screening and Surveillance. Gastroenterology. 2018;154(7):1970–84.
Schreuders EH, Ruco A, Rabeneck L, et al. Colorectal cancer screening: a global overview of existing programmes. Gut. 2015;64(10):1637–49.
Neureiter D, Jäger T, Ocker M, et al. Epigenetics and pancreatic cancer: pathophysiology and novel treatment aspects. World J Gastroenterol. 2014;20:7830–48.
Michalak EM, Burr ML, Bannister AJ, et al. The roles of DNA, RNA and histone methylation in ageing and cancer. Nat Rev Mol Cell Biol. 2019;20(10):573–89.
Cech TR, Steitz JA. The noncoding RNA revolution-trashing old rules to forge new ones. Cell. 2014;157:77–94.
Tay Y, Rinn J, Pandolfi PP. The multilayered complexity of ceRNA crosstalk and competition. Nature. 2014;505:344–52.
Marchese FP, Huarte M. Long non-coding RNAs and chromatin modifiers: their place in the epigenetic code. Epigenetics. 2014;9(1):21–6.
Thomson DW, Dinger ME. Endogenous microRNA sponges: evidence and controversy. Nat Rev Genet. 2016;17(5):272–83.
Wang P, Xue Y, Han Y, et al. The STAT3-binding long noncoding RNA lnc-DC controls human dendritic cell differentiation. Science. 2014;344(6181):310–3.
Prensner JR, Iyer MK, Sahu A, et al. The long noncoding RNA SChLAP1 promotes aggressive prostate cancer and antagonizes the SWI/SNF complex. Nat Genet. 2013;45:1392–8.
Hung CL, Wang LY, Yu YL, et al. A long noncoding RNA connects c-Myc to tumor metabolism. Proc. Natl. Acad. Sci. USA. 2014; 111(52):18697–18702.
Hu T, Lu Y. BCYRN1, a c-MYC-activated long non-coding RNA, regulates cell metastasis of non-small-cell lung cancer. Cancer Cell Int. 2015;15:36.
Booy EP, McRae EK, Koul A, et al. The long non-coding RNA BC200 (BCYRN1) is critical for cancer cell survival and proliferation. Mol Cancer. 2017;16(1):109.
Ding S, Jin Y, Hao Q, et al. LncRNA BCYRN1/miR-490-3p/POU3F2, served as a ceRNA network, is connected with worse survival rate of hepatocellular carcinoma patients and promotes tumor cell growth and metastasis. Cancer Cell Int. 2020;20:6.
Zhai H, Li Y. BCYRN1 is correlated with progression and prognosis in gastric cancer. Biosci Rep. 2019;39(11):BSR20190505.
Wang YC, Chuang YH, Shao Q, et al. Brain cytoplasmic RNA 1 suppresses smooth muscle differentiation and vascular development in mice. J Biol Chem. 2018;293(15):5668–78.
Zhang XY, Tang XY, Ma LJ, et al. Schisandrin B down-regulated lncRNA BCYRN1 expression of airway smooth muscle cells by improving miR-150 expression to inhibit the proliferation and migration of ASMC in asthmatic rats. Cell Prolif. 2017;50(6):e12382.
Ghildiyal M, Zamore PD. Small silencing RNAs: an expanding universe. Nat Genet. 2009;10:94–108.
Ambros V. The functions of animal microRNAs. Nature. 2004;431:350–5.
Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116:281–97.
Lim LP, Lau NC, Garrett-Engele P, et al. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005;433:769–73.
Ren XS, Tong Y, Qiu Y, et al. MiR155-5p in adventitial fibroblasts-derived extracellular vesicles inhibits vascular smooth muscle cell proliferation via suppressing angiotensin-converting enzyme expression. JExtracellVesicles. 2019;9(1):1698795.
Necsulea A, Soumillon M, Warnefors M, et al. The evolution of lncRNA repertoires and expression patterns in tetrapods. Nature. 2014;505(7485):635–40.
Qu L, Ding J, Chen C, et al. Exosome-Transmitted lncARSR Promotes Sunitinib Resiistance in Renal Cancer by Acting as a Competing Endogenous RNA. Cancer Cell. 2016;29(5):653–68.
Gates EDH, Lin JS, Weinberg JS, et al. Guiding the first biopsy in glioma patients using estimated Ki-67 maps derived from MRI: conventional versus advanced imaging. Neuro-Oncology. 2019;21(4):527–36.
Nagaraju GP, EI-Rayes BF. Cyclooxygenase-2 in gastrointestinal malignancies. Cancer. 2019;125(8):1221–7.
La Rocca G, Pucci-Minafra I, Marrazzo A, et al. Zymographic detection and clinical correlations of MMP-2 and MMP-9 in breast cancer sera. Br J Cancer. 2004;90(7):1414–21.
Hu L, Chen M, Chen X, et al. Chemotherapy-induced pyroptosis is mediated by BAK/BAX-caspase-3-GSDME pathway and inhibited by 2-bromopalmitate. Cell Death Dis. 2020; 11.Doi:10.1038/s41419-020-2476-2.
Walensky LD. Targeting BAX to drug death directly. Nat Chem Biol. 2019;15:657–65.
Terhune PG, Phifer DM, Tosteson TD, et al. K-ras mutations in focal proliferation lesions of human pancreas. Cancer Epidemiol. Biomarkers Prev. 1998; 7(6).
Siegel RL, Miller KD, Jemal A, et al. Cancer statistics. CA Cancer J Clin. 2017;67:7–30.
Punt CJA, Koopman M, Vermeulen L, et al. From tumour heterogeneity to advances in precision treatment of colorectal cancer. Nat Rev Clin Oncol. 2017;14:235–46.
Kuipers EJ, Grady WM, Lieberman D, et al. Colorectal cancer. Nat Rev Dis Primers. 2015;1:15065.
Yang L, Lin C, Jin C, et al. lncRNA-dependent mechanisms of androgen-receptor-regulated gene activation programs. Nature. 2013;500:598–602.
Lorenzen J, Thum T. Long noncoding RNAs in kidney and cardiovascular diseases. Nat Rev Nephrol. 2016;12:360–73.
Yu W, Xiang D, Jia H, et al. The lncRNA BCYRN1 Functions as an Oncogene in Human Glioma by Downregulating miR-125a-5p in vitro. Cancer Manag Res. 2020;12:1151–61.
Lang N, Wang C, Zhao J, et al. Long noncoding RNA BCYRN1 promotes glycolysis and tumor progression by regulating the miR149/PKM2 axis in nonsmallcell lung cancer. Mol Med Rep. 2020;21(3):1509–16.
Suzuki HI, Miyazono K. Emerging complexity of microRNA generation cascades. J Biochem. 2011;149:15–25.
Newman MA, Hammond SM. Emerging paradigms of regulated microRNA processing. Genes Dev. 2010;24:1086–92.
Cui ZH, Shen SQ, Chen ZB, et al. Growth inhibition of hepatocellular carcinoma tumor endothelial cells by miR-204-3p and underlying mechanism. World J Gastroenterol. 2014;20(18):5493–504.
Yuan D, Qian H, Guo T, et al. LncRNA-ATB Promotes the Tumorigenesis of Ovarian Cancer via Targeting miR-204-3p. Onco Targets Ther. 2020;13:573–83.
Yang S, Liu T, Sun Y, et al. The long noncoding RNA LINC00483 promotes lung adenocarcinoma progression by sponging miR-204-3p. Cell Mol Biol Lett. 2019;24:70.
Guo J, Zhao P, Liu Z, et al. MiR-2014-3p Inhibited the Proliferation of Bladder Cancer Cells via Modulating Lactate Dehydrogenase-Mediated Glycolysis. Front Oncol. 2019. doi:10.3389/fonc.2019.01242.

Download PDF

Journal Publication

published 14 Sep, 2020

Read the published version in Cancer Cell International →

Review #1 received at journal
06 Jul, 2020
Editorial decision: Major revision
06 Jul, 2020
Review #2 received at journal
05 Jul, 2020
Review #3 received at journal
03 Jul, 2020
Reviewer #3 agreed at journal
26 Jun, 2020
Reviewers invited by journal
22 Jun, 2020
Reviewer #1 agreed at journal
22 Jun, 2020
Reviewer #2 agreed at journal
22 Jun, 2020
Editor assigned by journal
15 Jun, 2020
Editor invited by journal
14 Jun, 2020
Submission checks completed at journal
05 Jun, 2020
First submitted to journal
04 Jun, 2020

You are reading this older preprint version

Read the latest preprint version →

Long Non-Coding RNA BCYRN1 Exerts an Oncogenic Rrole in Colorectal Cancer through Regulating miR-204-3p/KRAS Axis

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Materials And Methods

Experimental human tissues and animals

Cell culture

Cell transfection

RNA extraction and qRT-PCR

Evaluation of cell proliferation

Evaluation of cell migration and invasion

Flow cytometric analysis

Dual luciferase reporter assay

In vivo experiments

Immunohistochemistry

HE staining and TUNEL fluorescence staining

Western blot analysis

Statistical analysis

Results

BCYRN1 is highly expressed in the tissues and cell lines of CRC

Knockdown of BCYRN1 inhibits proliferation and promotes apoptosis of CRC cells

Down-regulation of BCYRN1 decreases migration and invasion of CRC cells

MiR-204-3p is a target gene of BCYRN1

Effects of miR-204-3p on CRC cells proliferation, migration, invasion and apoptosis

KRAS is a target gene of miR-204-3p

Effects of BCYRN1/miR-204-3p/KRAS axis on CRC cell proliferation, migration, invasion and apoptosis

Knockdown of BCYRN1 inhibits the tumor growth

Discussion

Conclusion

Declarations

References

Status:

Journal Publication

Version 1