Effect of Lupinus albus conglutin gamma protein on experimentally induced diabetes in rats

doi:10.21203/rs.3.rs-3314633/v1

Download PDF

Research Article

Effect of Lupinus albus conglutin gamma protein on experimentally induced diabetes in rats

https://doi.org/10.21203/rs.3.rs-3314633/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 22 Sep, 2023

Read the published version in Open Access Macedonian Journal of Medical Sciences →

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Early insulin resistance and a progressive loss of pancreatic β cell function combine to cause type 2 diabetes (T2D), which leads to insufficient insulin production followed by hyperglycemia. Purified from Lupinus albus seed, conglutin gamma (Cγ) is a protein that lowers blood sugar. The primary function of adipocytokines, hormones released by adipose tissue, is to alert important organs to maintain metabolic balance. This study aimed to identify and compare the role of Cγ and glimepiride in controlling hyperglycemia, insulin secretion, insulin resistance and hyperlipidemia in high-fat diet and low- dose streptozotocin (STZ) induced T2D experimental rats through affecting the expression of various adipocytokines Male Spargue Dawely rat groups were divided into normal, Cγ control, T2D control, and four T2D groups that received Cγ (30, 60, and 120 mg/Kg) and Glimepiride (0.1 mg/kg) treatments. Administration of Cγ successfully eliminated hyperglycemia and increased insulin secretion and sensitivity. Additionally, when compared to (STZ + HFD) control rats, treatment with Cγ improved the expression of leptin, adiponectin, and their blood concentration, as well as the activity of the enzyme chitotriosidase. It also significantly decreased the expression of apelin, NAMPT and RBP4. The present data suggests that Cγ has an effective role on controlling hyperglycemia induced by diabetes through amelioration of leptin, adiponectin, liver enzyme levels, lipid profile and metabolic syndrome.

Adipocytokines

Conglutin Gamma

Insulin resistance

Diabetes

Early insulin resistance and increasing loss of pancreatic β cell function are both factors in type 2 diabetes, which leads to insufficient insulin production and resultant hyperglycemia.(1)

An anti-diabetic drug controls blood sugar levels by (a) boosting peripheral insulin sensitivity, (b) reducing liver glucose synthesis, (c) raising insulin secretion from beta cells, or (d) altering the enzymatic activity of enzymes involved in glucose metabolism. [(2), (3), (4)]

The ability of several Lupinus genus proteins to reduce blood pressure, glycemia, and cholesterolemia, among other consequences, has recently given these proteins increased prominence. [(5), (6), (7)]. The proteins in the seeds of the extensively cultivated, domesticated species Lupinus albus that have hypoglycemic effects both in vivo and in vitro have attracted the attention of scientists. The globulin fraction of L. albus seeds contains a protein called gamma conglutin (Cγ), which was discovered to have these effects. [(7), (8), (9)]. The homo-tetramer Cγ is a component of the 7S glycoprotein, which accounts for 4–5% of all plant protein. Each Cγ monomer is made up of two subunits of 17 and 29 kDa that are connected by disulfide links and has a relative mass of roughly 50 kDa. (10). At pH greater than 4, Cγ is resistant to proteolytic enzymes. (11). A high-fat diet/streptozotocin treatment (HFD/STZ) rat model of diabetes is an illustration of an experimentally created animal model of the disease. In this paradigm, a meal heavy in fat and, occasionally, sugar is combined with therapy with the b-cell toxin STZ to induce hyperinsulinemia, insulin resistance, and/or glucose intolerance(10), (11). This causes a significant decrease in the mass of functioning β cells. These two stresses work together to simulate the pathophysiology of type 2 diabetes, albeit on a shorter time period than that experienced by humans.

Adipokine profiles are altered in patients with type 2 diabetes and obesity, which increases metabolic risk and affects insulin sensitivity. [(12), (6)].

The chitinolytic enzyme chitotriosidase (CHIT1) was discovered to have significantly increased activity in type 2 diabetes patients and to be favourably correlated with blood pressure and glycemic control parameters (levels of glucose and glycated haemoglobin). (13) Although Cγ has been assessed in a number of metabolic scenarios, no research has looked into how it may affect the expression of adipocytokines or the levels of the chititriosidase enzyme in the blood in a chronic experimental T2D model.

AIM; The current study aimed to determine and compare the function of Cγ and glimepiride in regulating hyperglycemia, insulin secretion, insulin resistance, and hyperlipidemia in high-fat diet and low-dose streptozotocin (STZ) induced type 2 diabetes (T2D) experimental rats. This was done by influencing the expression of various adipocytokines and serum chitotriosidase enzyme activity.

Isolation of Cγ and Characterization by PAGE

Dehulled lupin seeds were made into flour, then the fat was removed using hexane. With some adjustments, the proteins were isolated as previously described by (14). In two processes, the defatted flour was added to double-distilled water (ddH2O) and stirred for two hours at 4 °C to remove the albumin fraction. After filtering the solution, the albumin fraction in the supernatant was discarded. Step 1 was repeated after the pellet was resuspended in ddH2O in step 2. The whole globulin fraction was then resuspended in 10% NaCl (pH 7) and stirred for 12 hours at 4 °C. The filtrate was then recovered after the solution had been filtered at 4 °C. The filtrate's globulins were precipitated out with ammonium sulphate until they reached 85% saturation. The pellet was filtered, then dissolved in phosphate buffer (0.1 M, pH 6.8), and dialyzed for 18 hours against 0.2 M acetate buffer (pH 4.8). After filtering the solution, the alpha conglutin (Cα) was found in the pellet, while the beta and gamma conglutins (Cβ and Cγ, respectively) were found in the supernatant. The supernatant was dialyzed against distilled water at 4 °C for 48 hours to separate Cβ and Cγ. Following filtering, the Cγ-containing supernatant was lyophilized (Laboratory freeze dryer Alpha 1-2 LSCbasic) for 48 hours at -55 °C, 0.021 mbar. SDS-polyacrylamide gel electrophoresis (SDS-PAGE) at 12 percent under reducing and non-reducing conditions was used with a small Protean®Tetra cell (BioRad, Milan, Italy) apparatus to confirm the presence of Cγ in the isolate fraction (2 mg per sample) (15). Gels were stained with Coomassie brilliant blue G-250 following electrophoresis (BioRad, Milan, Italy). By contrasting native and denatured Cγ with a protein ladder (BenchMarkTM Prestained protein ladder, Invitrogen), the relative molecular weight of each was measured.

Animals

The study was carried out in National Nutrition Institute (NNI) Cairo, Egypt on one hundred and five adult male Sprague Dawley (SD) albino rats weighing (160± 10g), bought from EGY VAC- The Egyptian Company for production of vaccines and drugs (Vaccsera), in Helwan- October 2020, kept individually in cages. The rats were divided into 7 groups each consisted of 15 rats. Feed and water were provided ad libitum. Rats were maintained on normal light-dark schedule and temperature 25±3 °C throughout the experiment and left 1 week for acclimatization. All experimental protocols were approved by the Institutional Animal Care and Use Committee at the Faculty of Pharmacy, Suez Canal University (Ismailia, Egypt).

Experimental induction of Type2 diabetes by high fat diet and low-dose STZ

The rats were divided into two dietary plans: the normal pellet diet (NPD), which contains 12 percent of calories as fat (30 rats), and the high fat diet (HFD), which contains 58 percent fat, 25 percent protein, and 17 percent carbohydrate (75 rats) (16). The typical diet was made in accordance with (17). The makeup of it was as follows (g/100g). Casein 14 (Difco, Becton Dickinson, France), Cellulose 5 (Oxford Lab, Mumbai, India) ,corn Oil 10 (Egyptian market), vitamin and mineral mix 5 (ADWIC Co., Cairo, Egypt), Corn starch 66 (Egyptian market), DL-methionine, 0.3 (Sigma–Aldrich, MO, USA; ADWIC Co., Cairo, Egypt), cholin chloride 0.2 (Oxford Lab, Mumbai, India).(18) described the following components (g/kg) as the composition and preparation of HFD: powdered NPD, 365 (prepared); DL-methionine, 3.0 (Sigma-Aldrich, MO, USA; ADWIC Co., Cairo, Egypt); lard, 310 (Egyptian market); casein, 250 (Difco, Becton Dickinson, France); cholesterol, 10 (Oxford Lab, Mumbai, India); vitamin and mineral mix, 60 (ADWIC Co., Cairo, Egypt); yeast powder, 1.0 (Egyptian market); sodium chloride (Egyptian market). After two weeks of dietary manipulation, 75 rats on HFD were given an intraperitoneal (i.p.) injection of STZ 35 mg/kg that had just been freshly dissolved in di-sodium citrate buffer (19). (pH 4.5). The glucose level in blood samples taken from the tail tip ten days after STZ injection was assessed using the glucometer method (Perfecta- Granzia- Italy). The study only included rats with fasting blood glucose levels greater than 250 mg/dl (20)

Experimental design

Diabetic rats were received Glimepiride or the different concentrations of extract under study orally and once daily dissolved in the carrier solution for 4 weeks starting from day 11 after induction of diabetes. Rats were randomly allocated into seven groups of fifteen animals each.

Groups of male Spargue Dawely rats were assigned to normal group, Cγ control group, T2D control group and four T2D groups treated with Cγ (30, 60, and 120 mg/Kg) and Glimepiride (0.1 mg/kg) once daily oral gavage for 4 weeks.

Group I: non-diabetic rats, fed NPD, received only single i.p. injection of citrate buffer (1 ml/kg) and served as normal control group.

Group 2: non-diabetic rats, fed NPD, received only single i.p. injection of citrate buffer (1 ml/kg) and daily oral dose of Cγ (120 mg/Kg) served as negative control for "non diabetic Cγ group.

Group 3: Type 2 Diabetes; diabetic rats received only vehicle and served as Type 2 Diabetes control group.

Group 4: Type 2 Diabetes rats received "Cγ at doses of 30mg/kg (9)

Group 5 Type 2 Diabetes rats received "Cγ at doses of 60mg/kg

Group 6 Type 2 Diabetes rats received "Cγ at doses of 120mg/kg (21)

Group 7 Type 2 Diabetes rats received " Glimipiride at doses of 0.1 mg/kg (22)

Blood sampling and biochemical analysis

Rats were starved overnight and given 50 mg/kg of thiopental sodium to put them to sleep (23). The hepatic portal vein was used to collect blood, which was put into centrifuge tubes. Whole blood was used to measure blood glucose levels using the haemoglobin and Perfecta- Granzia, Italy, glucometer technique. The remaining blood was centrifuged at 2000 rpm for 15 min after 30 min of collection and stored at -80 °C until assayed., triglycerides (TGs), total cholesterol (TC), alanine Transaminase (ALT) (GPT), aspartate aminotransferase (AST) (GOT), alkaline phosphatase (ALP), lactate dehydrogenase (LDH), gamma-glutamyl transferase (GGT), Urea, Creatinine and uric acid (U.A), were measured by Automatic biochemistry analyzer BT 1500 Biotecnica Instrument. According to the manufacturer's instructions, HDL-C was measured colorimetrically using assay kits from (Stanbio, Texas, USA).

Enzyme-linked immunosorbent assay

Serum insulin- Catalog No: E-EL-R3034, C – peptide- Catalog No: E-EL-R3004, Visfatin- Catalog No: E-EL-R1067, Adiponectin- Catalog No: E-EL-R3012 and Leptin-Catalog No: E-EL-R0582, was determined using the rat ultrasensitive ELISA kit (elabscience, USA) by ELISA reader. CHIT1(chitotriosidase enzyme activity) was determined using the rat insulin ultrasensitive ELISA kit (eiabscience, Catalog No: E13980m, USA) by ELISA reader.

Calculation of insulin resistance.

Insulin resistance was determined using the homeostasis model assessment index for insulin resistance (HOMA-IR) using the following formula:HOMA-IR index¼[fasting glucose (mg/dl) fasting insulin (mU/ml)]/ 405) (24). To assess insulin sensitivity, the revised quantitative insulin sensitivity check index (R-QUICKI)¼ 1/[log fasting insulin (mU/ml)þlog fasting glucose (mg/dl)] was used (25).

Expression of NAMPT, Leptin, Adiponectin, RBP4 and Apelin genes in adipose tissue:

A mortar and pestle was used to smash 30 mg of frozen adipose tissue into liquid nitrogen. A rotor-stator homogenizer was used to blend the lysate. We pipette-mixed 450 µL of 96–100% ethanol into the mixture, centrifuged the mixture for 5 minutes at > 12000 x g, and then transferred the supernatant into a fresh microcentrifuge tube devoid of RNase. The GeneJET RNA Purification Column received 700 L of Wash Buffer 1, and we centrifuged it at 12000 x g for 1 minute. The purification column was then infused with 250 µL of wash buffer 2 before being centrifuged at 10,000 x g for two minutes. We put the lysate into the column after centrifuging and discarded the flow-through solution. Denaturing agarose gel electrophoresis followed by ethidium bromide staining was used to evaluate the integrity of the RNA before cDNA synthesis. Total eukaryotic RNA, which includes both 18S and 28S rRNA, was considered to be intact. We prepared a reaction master mix by adding the components according to the manufacturer’s instructions. (Except template DNA) for each 20 μl reaction to a tube at room temperature. Mixed the reaction gently and put it into the PCR machine 42ᵒ C for 60 min and 70ᵒ C for 5 min. Programmed the thermal cycler according to the recommendations below.

Step	Temperature, °C	Time	Number of cycles
Initial denaturation	95	10 min	1
Denaturation	95	15 s	40
Annealing/Extension	60	60 s	40

Table 1: Primers sequence used for qRT-PCR

Reverse sequence	Forward sequence	Name
AGG CAA GCT GGT GAG GAT CTG	CCT GTG GCT TTG GTC CTA TCT G	Leptin
CCACAGACACAGGCACTGATGA	AGCGGCAGAGCACAGTACCATA	(Nampt)
AAAGGAGGCTACACCCCAGT	GACAAGGCTCGTTTCTCTGG	RBP4
CCGCTGTCTGCGAAATTTC	GGCTAGAAGAAGGCAACATGC	Apelin
CATCTCCTGGGTCACCCTTA	AATCCTGCCCAGTCATGAAG	Adiponectin
GGACTCATCGTACTCCTGCT	GTAAAGACCTCTATGCCAACA	Actein

Statistical Analysis

All data were expressed as mean± SD and analyzed using the Statistical Package of Social Sciences (SPSS) program version 17, (Chicago, IL, USA). For all parameters, comparisons among groups were carried out using one-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparisons test (26). All P values reported are two-tailed and P< 0.05 was considered significant.

Characterization of Cγ by SDS-PAGE

The SDS-PAGE profiles of the Cγ used in the STZ-Cγ treatment group are shown in Fig. 1. Cγ appears as a single band of around 50 kDa under non-reducing circumstances (Fig. 1 lanes 2). According to expectations, under reducing circumstances, two prominent bands of approximately 17 and 29 kDa formed; these bands were the two Cγ sub-units (Fig. 1, lanes 3).

Protein isolated from -conglutin was examined using SDS-PAGE. Proteins were isolated in non-reducing (Fig. 1 lane 2) and reducing (lanes 3) conditions. Coomassie brilliant blue was used to dye the gels. M molecular weight ladder. The SDS-PAGE profiles of the Cγ used in the Cγ treatment groups are displayed in Fig. 1. When there are no reducing conditions, only one band of roughly 50 kDa is visible for Cγ. (lane 2). As anticipated, under reducing circumstances, two prominent bands of approximately 17 and 29 kDa formed; these bands were the two Cγ sub-units (Fig. 1 lane 3) (27)

Effect of Conglutin Gamma on serum lipid profile

The serum concentrations of cholesterol and TG in diabetic rats significantly increased (P < 0.05, Table 1). On the other hand, when compared to the values of normal control rat, HDL-C was significantly decreased. When compared to diabetic control rats, oral treatment of Cγ significantly reduced the blood levels of TG and TC while significantly increasing the level of HDL-C. When compared to diabetic control rats, Conglutin Gamma and Glimipiride treatment effectively reduced the abnormalities in the lipid profile (P < 0.05, Table 1). Notably, when compared to diabetic controls, the medium dose of conglutin gamma (60 mg/kg) did not significantly improve HDL-C levels.

Table 1

**Effect of Conglutin Gamma on serum lipid profile in diabetic rats**
Parameters Groups	Total Cholesterol	Triglyceride	HDL-Cγ
Normal	72.973 ± 8.9	56.373 ± 14.7	69.67 ± 6.7
negative control for "non diabetic CG group"	60.033 ± 6.19	49.900 ± 12.26	72.13 ± 7.43
Type 2 Diabetes	256.267 ± 24.4 Ac	359.273 ± 191.3 Ac	35.47 ± 3.9 Ac
Type 2 Diabetes + "Cγ 30mg/kg"	111.087 ± 39.4 Abc	77.773 ± 7.24 B	62.87 ± 5.6 Ab
Type 2 Diabetes + "Cγ 60mg/kg"	137.540 ± 33.8 Abc	75.227 ± 8.9b	52.87 ± 7.4 Abc
Type 2 Diabetes + "Cγ 120mg/kg"	76.627 ± 9.5 B	63.380 ± 11.9 B	71.60 ± 6.9 b
Type 2 Diabetes + Glimipiride	78.180 ± 9.7 B	98.260 ± 35.1 B	61.93 ± 8.4 Abc

TG, triglycerides; TC, total cholesterol; HDL-Cγ, high density lipoprotein cholesterol;. Rats were treated for 4 weeks. Results were expressed as mean ± SD and analyzed using one-way ANOVA followed by Bonferroni’s post hoc test (n = 15)

*a is significant vs. negative control for CG / b is significant vs positive control/ c is significant vs. negative non diabetic

Effect of Conglutin gamma on fasting blood glucose,, serum insulin, calculated HOMA-IR index and serum C – peptide in diabetic rats.

Injection of STZ after two weeks of HFD significantly (P < 0.05) raised blood glucose levels in contrast to the normal control group, as indicated in Table 2. When compared to normal controls, diabetic rats' serum insulin significantly dropped, and the computed HOMA-IR significantly rose (P < 0.05, Table 2). In compared to the diabetic control group, oral administration of conglutin gamma and glimipiride demonstrated a significant decrease in serum glucose, as well as insulin resistance and a significant increase in serum insulin. (P < 0.05; Table 2). Notably, when compared to diabetic controls, the lowest and middle doses of conglutin gamma (30 mg/kg and 60 mg/kg) did not significantly alter HOMA-IR. Regarding insulin resistance during the course of the 4-week treatment, there is no significant difference between the two doses. Compared to diabetic control group, serum C-peptide levels significantly increased after oral administration of conglutin gamma and glimipiride. Serum C-peptide levels significantly reduced in diabetic rats.

Table 2

**Effect of** **Conglutin gamma** **on fasting blood glucose,, serum insulin, calculated HOMA-IR index and serum Cγ – peptide in diabetic rats.** 2
Parameters Groups	fasting blood sugar	C - peptide	Insulin pg/ml	Homa IR
Normal	103.20 ± 4.7	1053.1 ± 149.3	251.77 ± 17.3	1.83 ± 0.10
negative control for "non diabetic CG group	106.13 ± 4.22	1107 ± 146.4	359.273 ± 191.3	1.88 ± 0.14
Type 2 Diabetes	365.67 ± 46.5 ac	296.1 ± 100.9 ac	95.5 ± 44.0 ac	2.48 ± 1.19 ac
Type 2 Diabetes + "Cγ 30mg/kg"	161.60 ± 19.4 abc	716.8 ± 87.4 abc	243.8 ± 16.9 B	2.79 ± 0.4 ac
Type 2 Diabetes + "Cγ 60mg/kg"	168.60 ± 13.76 abc	825.3 ± 15.9 abc	259.4 ± 19.4 B	3.1 ± 3.8 abc
Type 2 Diabetes + "Cγ 120mg/kg"	110.47 ± 3.06 b	1104.1 ± 130.6 b	237.5 ± 30.5 B	1.85 ± 0.23 b
Type 2 Diabetes + Glimipiride	112.87 ± 4.12 b	890.9 ± 132.9 abc	235.2 ± 35.3 B	1.88 ± 0.29 b

HMOA-IR index, homeostasis model assessment index for insulin resistance index; Rats were treated for 4 weeks. Results were expressed as mean ± SD and analyzed using one-way ANOVA followed by Bonferroni’s post hoc test (n = 15).

*a is significant vs. negative control for CG / b is significant vs positive control/ c is significant vs. negative non diabetic

Effect of Conglutin gamma on liver enzyme activity, kidney function tests and LDH on diabetic rats

At the conclusion of the trial, serum levels of AST, urea, and creatinine were not significantly different between normal control rats and those fed the HFD for two weeks before receiving a low dosage of STZ. Conglutin gamma oral treatment resulted in a non-significant change in these serum levels. The serum levels of ALT, ALP, LDH, GGT, and U.A. in diabetic rats, however, significantly increased.

In comparison to the diabetic group, blood levels of ALT, ALP, LDH, GGT, and U.A. exhibited a significant decline after oral administration of Conglutin gamma at the end of the study period. The serum levels of ALP and AST following oral administration of Conglutin gamma (30 mg/kg and 60 mg/kg, respectively) and glimepiride (120 mg/kg and AST) did not differ significantly from those of diabetic rats (Table 3).

Table 3

**Effect of** **Conglutin gamma** **on liver enzyme activity, kidney function tests and LDH in diabetic rats.** 3
Parameters Groups	ALT (GPT)	AST (GOT)	ALP	LDH	GGT	Urea(mg/dl)	Creat (mg/dl)	U.A
Normal	48.9 ± 3.7	115.09 ± 11.82	412.7 ± 66.6	421 ± 62.3	1.08 ± 0.49	49.2 ± 16.1	0.53 ± 0.07	1.75 ± 0.63
negative control for "non diabetic CG group"	56.1 ± 7.6	353.2 ± 39.56	500.5 ± 155.9	306.3 ± 67.22	0.98 ± 0.47	34.8 ± 3.9	0.51 ± 0.56	3.06 ± 0.78
Type 2 Diabetes	148.4 ± 17.9 ac	252.83 ± 28.98 ac	2099.2 ± 205.3 ac	1988.5 ± 278.6 ac	5.08 ± 1.8 ac	59.3 ± 12.3	0.56 ± 0.06	4.8 ± 0.6 Ac
Type 2 Diabetes + "Cγ 30mg/kg"	57.4 ± 5.1 b	174.2 ± 26.73 abc	1645.8 ± 180.5 abc	410.1 ± 21.8 b	1.31 ± 0.77 b	69.4 ± 14.3 ac	0.45 ± 0.07 bc	2.3 ± 0.47 Ab
Type 2 Diabetes + "Cγ 60mg/kg"	90.5 ± 14.9 abc	153.55 ± 15.45 ab	1770.7 ± 181.6 abc	376.6 ± 21.8 b	2.16 ± 0.7 ac	104.4 ± 22.5 abc	0.57 ± 0.06	2.5 ± 0.34 Bc
Type 2 Diabetes + "Cγ 120mg/kg"	61.9 ± 4.9 bc	262.15 ± 72.14 ac	631.7 ± 266.9 bc	392.4 ± 42.2 b	1.54 ± 0.56 b	41.8 ± 13.4 b	0.6 ± 0.06 a	2.1 ± 0.75 Ab
Type 2 Diabetes + Glimipiride	62.7 ± 10.4 bc	232.87 ± 27.13 ac	113.0 ± 58.2 abc	974.3 ± 83.2 abc	1.40 ± 0.53 b	63.5 ± 8.7 a	0.58 ± 0.83	2.16 ± 0.42 Ab
*a is significant vs. negative control for CG / b is significant vs positive control/ c is significant vs. negative non diabetic

ALT, alanine aminotransferase; AST, aspartate aminotransferase; ALP, alkaline phosphatase.; LDH: Lactate dehydrogenase ;GGT, Gamma-glutamyltransferase; U.A.: uric acid. Rats were treated for 4 weeks. Results were expressed as mean ± SD and analyzed using one-way ANOVA followed by Bonferroni’s post hoc test.( n = 15).

Effect of Conglutin gamma on serum Visfatin, Adiponectin and Leptin of diabetic rats

Injection of STZ after two weeks of HFD increased blood levels of leptin and visfatin significantly (P < 0.05) compared to the normal control group, while diabetic rats' serum levels of adiponectin significantly (P < 0.05) dropped when compared to controls.

In compared to the diabetic control group, oral administration of conglutin gamma and glimipiride resulted in a significant decrease in blood leptin, visfatin, and a rise in serum adiponectin. (P < 0.05; Table 4). Notably, when compared to diabetic controls, the highest dose of conglutin gamma (120 mg/kg) showed the greatest drop in serum leptin and visfatin levels. When compared to diabetic controls, the highest dose of conglutin gamma (120 mg/kg) caused the greatest increase in blood adiponectin levels (P < 0.05, Table 4).

Parameters Groups	Visfatin	Adiponectin	Leptin
Normal	1.86 ± 0.2	10.0 ± 2.5	7.8 ± 2.6
negative control for "non diabetic CG group"	1.973 ± 46	11.96 ± 2.7	8.38 ± 1.7
Type 2 Diabetes	3.66 ± 0.34 ac	2.06 ± 0.5 ac	49.5 ± 3.6 ac
Type 2 Diabetes + "Cγ 30mg/kg"	2.82 ± 0.44 abc	6.02 ± 1.3 abc	18.77 ± 3.9 Abc
Type 2 Diabetes + "Cγ 60mg/kg"	2.63 ± 0.35 abc	7.2 ± 1.3 abc	19.0 ± 3.4 Abc
Type 2 Diabetes + "Cγ 120mg/kg"	2.44 ± 0.4 abc	10.4 ± 1.8 b	12.5 ± 3.6 Bc
Type 2 Diabetes + Glimipiride	2.58 ± 0.5 abc	8.89 ± 1.7 ab	14.74 ± 6.1 Abc
*a is significant vs. negative control for CG / b is significant vs positive control/ c is significant vs. negative non diabetic

Effect of Conglutin gamma on serum Chititriosidase enzyme activity of diabetic rats

Injection of STZ after two weeks of HFD elevated blood chitotriosidase enyme levels significantly (P < 0.05), as demonstrated in Table 5, compared to the normal control (P < 0.05, Table 5). Conglutin gamma and glimipiride were administered orally, and the results demonstrated a significant decrease in serum chitotriosidase enyme levels compared to the diabetic control group. (P < 0.05). Notably, compared to diabetic controls, the highest dose of conglutin gamma (120 mg/kg) showed the largest decrease in serum chitotriosidase enyme levels, and the three doses of conglutin gamma caused a greater decrease than the glimepiride group (P < 0.05, Table 5).

Parameter Group	CHIT1(chitotriosidase enzyme activity)
Normal	475.0 ± 201.5
negative control for "non diabetic CG groups"	567.75 ± 146.6
Type 2 Diabetes	1594.1 ± 418.8 ac
Type 2 Diabetes + "Cγ 30mg/kg"	679.94 ± 128.3 B
Type 2 Diabetes + "Cγ 60mg/kg"	671.69 ± 192.1 B
Type 2 Diabetes + "Cγ 120mg/kg"	655.82 ± 151.7 Bc
Type 2 Diabetes + Glimipiride	834.7 ± 132.6 Abc
*a is significant vs. negative control for CG / b is significant vs positive control/ c is significant vs. negative non diabetic

Effect of Conglutin gamma on the expression of NAMPT, Leptin, Adiponectin, RBP4 and Apelin genes in adipose tissue of diabetic rats

The values of the fold change of the relevant adipokine genes in the test condition compared to the control condition are shown in Table 6 and have all been normalised to the housekeeping gene.

The effects of oral administration of conglutin gamma and glimipiride on expression of adipokines was measured in adipose tissue following 4 weeks treatments (Table 6). There was a reduction in the expression of adiponectin and an increase in the expression of leptin, NAMPT, RBP4 and apelin genes in the adipose tissue for rats of positive diabetic control in comparison with normal control. Oral administration of conglutin gamma and glimipiride for 4 weeks resulted in an up regulation of adiponectin expression in adipose tissue of rats of treated groups compared to positive diabetic control, while the expression of leptin, NAMPT, RBP4 and apelin genes in the adipose tissue for rats of treatment groups after oral administration of conglutin gamma and glimepiride was down regulated compared to positive diabetic control.

Parameters Groups	NAMPT expression	Leptin expression	Adiponectin expression	RBP4 expression	Apelin expression
Normal	1.09 ± 0.05	1 ± 0.02	1 ± 0.01	1 ± 0.021	1 ± 0.11
negative control for "non diabetic CG group"	1.07 ± 0.01	1.5 ± 0.05	0.73 ± 0.02	1.6 ± 0.25	1.17 ± 0.9
Type 2 Diabetes	2.2 ± 1.04 ac	5.23 ± 1.1 ac	0.27 ± 0.13 Ac	4.48 ± 0.3 ac	6.59 ± 0.14 ac
Type 2 Diabetes + "Cγ 30mg/kg"	1.87 ± 0.9 a	4.3 ± 0.9 Abc	0.29 ± 0.002 Abc	2.21 ± 0.01 Ab	3.34 ± 1.04 bc
Type 2 Diabetes + "Cγ 60mg/kg"	1.5 ± 0.01 abc	3.8 ± 0.5 Abc	0.31 ± 0.01 Abc	2.1 ± 0.017 Ab	3.1 ± 0.20 bc
Type 2 Diabetes + "Cγ 120mg/kg"	1.29 ± 1.03 ab	2.52 ± 0.06 Ab	0.53 ± 0.2 Bc	1.88 ± 0.04 B	1.6 ± 0.03 b
Type 2 Diabetes + Glimipiride	1.1 ± 0.6 abc	2.75 ± 0.1 B	0.57 Cγ	1.81 ± 0.25	1.51 ± 0.014
*a is significant vs. negative control for CG / b is significant vs positive control/ c is significant vs. negative non diabetic

NAMPT, Nicotinamide Phosphoribosyltransferase ; RBP4, Retinol Binding Protein 4)

The goal of the current study was to assess and compare the potential effects of Conglutin Gamma (Cγ) and Glimipiride as hypoglycemic medications, as well as their effects on the expression of different adipocytokines, serum chitotriosidase enzyme activity, and serum adipocytokines in type 2 diabetic rats fed a high-fat diet and treated with low doses of STZ.

First off, when compared to normal control rats, the current data revealed no statistically significant variations in the serum levels of AST, urea, and creatinine. As it is crucial to confirm the lack of kidney and liver toxicity after delivering any treatment, oral administration of Conglutin gamma demonstrated a substantial decrease in blood levels of ALT, ALP, LDH, GGT, and U.A. as compared with the diabetic group at the end of the study period. In this instance, the group receiving Cγ from L. albus did not experience any appreciable alterations in their serum urea and creatinine levels.

Comparing this group to normal levels revealed no change in the serum ALT and AST levels. As a result, it appears that there is no liver or kidney damage caused by the injection of Cγ from L. albus at the dose and duration examined in this investigation. This is consistent with prior results obtained for the Cγ of the species L. albus comparing this group to normal levels revealed no change in the serum ALT and AST levels. As a result, it appears that there is no liver or kidney damage caused by the injection of Cγ from L. albus at the dose and duration examined in this investigation. This is in line with earlier findings for the species L. albus Cγ (28)

By combining HFD with a low dose of STZ, as described in the literature, our data showed that blood glucose levels and insulin resistance increased significantly(29) The glucose-fatty acid cycle is the primary mechanism that can explain insulin resistance. In a nutshell, having high levels of triglycerides from eating too much fat can cause increased fatty acid bioavailability and oxidation, which blunts the insulin-mediated decrease in hepatic glucose output and decreases glucose uptake or utilisation in skeletal muscle, resulting in insulin resistance. (30).

Along with abnormalities in glucose metabolism, the diabetic rats in the current study also exhibited abnormalities in lipid metabolism, as shown by significantly elevated TG and TC levels coupled with decreased HDL-C, similar to type 2 diabetic patients, which may be a factor in a number of cardiovascular complications. Increased dietary cholesterol absorption following the use of HFD in a diabetic situation may be the cause of hypercholesterolemia. (31), (32).

Conglutin Gamma (Cγ) has an impact on the serum lipid profile in diabetic rats when compared to normal control rats. This finding is consistent with earlier research that identified dyslipidemia as a common complication of diabetes. These findings support the notion that Cγ has the capacity to improve the dyslipidemic profile linked to diabetes. (33)

According to (34), insulin resistance is directly correlated with hyperlipidemia because high blood lipid concentrations release humoral factors like resistin and adiponectin that affect insulin sensitivity and result in insulin resistance. Therefore, the hypolipedemic effect of Conglutin Gamma (Cγ) in the current study may help reduce insulin resistance.

Comparing the oral administration of Conglutin Gamma to the diabetic control group, a significant rise in serum insulin levels was observed. These results are consistent with earlier research by (35), which showed that rats given -conglutin gamma had higher insulin levels and lower blood glucose levels than the control group. Additionally, Glimipiride significantly boosted insulin secretion in diabetic rats, which is consistent with a study by (36).

Our research also offers novel understandings of how Conglutin Gamma affects serum adipocytokines. In particular, we found that Conglutin Gamma treatment was linked to elevated serum levels of adiponectin and decreased serum levels of leptin and visfatin. This is in line with other studies that found adiponectin and insulin sensitivity to be related (37), as well as visfatin and leptin's roles in insulin resistance and the diabetic metabolic syndrome (38)

One of the unique characteristics of this study is how it investigates the effects of Conglutin Gamma and Glimipiride on blood indicators linked to chitotriosidase enzyme activity. The substantial increases in this parameter that have been seen are important proof of the favourable effects of these therapies on various aspects of metabolic dysfunction.

The thorough examination of adipokine gene expression in response to therapy is one of this study's additional novel features. The potential of Conglutin Gamma and Glimipiride in modulating the expression of important adipokines involved in metabolic regulation is highlighted by the observed upregulation of adiponectin gene expression and downregulation of leptin, NAMPT, RBP4, and apelin gene expression in the adipose tissue of treated rats.

The use of animal models and the lack of long-term follow-up are two drawbacks of our work. The underlying processes by which Conglutin Gamma impacts adipocytokines and glucose metabolism were also not examined. Future research could look at the cellular and molecular mechanisms underlying these effects.

Cγ administration effectively abrogated hyperglycemia and enhanced insulin secretion and sensitivity. Moreover, administration Cγ ameliorated Chitotriosidase enzyme activity, the expression of leptin, Adiponectin and thier serum concentration, NAMPT and RBP4 expression compared to (STZ + HFD) control rats and effectively downregulated apelin expression. The present data suggests that Cγ has an effective role on liver damage induced by diabetes through amelioration of leptin, adiponectin, liver enzyme levels, lipid profile and metabolic syndrome.

Ethical Approval

This study approved by the Ethics Committee of the Faculty of Pharmacy, Suez Canal University, Ismailia, Egypt.

Authors' contributions

Marwa bhieldeen & Afaf Tawfik: prepared the protein extract.

Marwa bhieldeen: Marwa bhieldeen: Did the biological experiments and collected blood samples and adipose tissue samples

Marwa bhieldeen: did the ELISA and PCR assays for the samples.

Marwa bhieldeen & Fatema El-shaarawy: Analysed the results and prepared data

Marwa bhieldeen: prepared the manuscript.

Fatema El-shaarawy: helped in editing the manuscript.

All authors reviewed the manuscript.

Funding

Funding information is not applicable.

Availability of data and materials

Source of raw data available on the following link

https://pharmsuezedu-my.sharepoint.com/:f:/g/personal/pgs_192309_pharm_suez_edu_eg/EtDRvZVMoTFCvlJSpKMk7qIBOXdC9TPWS3mXwpRt_Q5bQQ?e=CI1DS8

Declaration of interest

According to the authors, there are no conflicts of interest that might be thought to compromise the objectivity of the research presented.

Gerich JE (2003) Contributions of Insulin-Resistance and Insulin-Secretory Defects to the Pathogenesis of Type 2 Diabetes Mellitus. Mayo Clinic Proceedings. ;78(4):447 – 56
Lebovitz HE (1997) alpha-Glucosidase inhibitors. Endocrinol Metab Clin North Am 26(3):539–551
Bolen S, Feldman L, Vassy J, Wilson L, Yeh HC, Marinopoulos S et al (2007) Systematic review: comparative effectiveness and safety of oral medications for type 2 diabetes mellitus. Ann Intern Med 147(6):386–399
Drucker DJ, Nauck MA (2006) The incretin system: glucagon-like peptide-1 receptor agonists and dipeptidyl peptidase-4 inhibitors in type 2 diabetes. Lancet 368(9548):1696–1705
Sirtori CR, Lovati MR, Manzoni C, Castiglioni S, Duranti M, Magni C et al (2004) Proteins of white lupin seed, a naturally isoflavone-poor legume, reduce cholesterolemia in rats and increase LDL receptor activity in HepG2 cells. J Nutr 134(1):18–23
Lee MW, Lee M, Oh KJ (2019) Adipose Tissue-Derived Signatures for Obesity and Type 2 Diabetes: Adipokines, Batokines and MicroRNAs. J Clin Med. ;8(6)
Magni C, Sessa F, Accardo E, Vanoni M, Morazzoni P, Scarafoni A et al (2004) Conglutin gamma, a lupin seed protein, binds insulin in vitro and reduces plasma glucose levels of hyperglycemic rats. J Nutr Biochem 15(11):646–650
Bertoglio JC, Calvo MA, Hancke JL, Burgos RA, Riva A, Morazzoni P et al (2011) Hypoglycemic effect of lupin seed γ-conglutin in experimental animals and healthy human subjects. Fitoterapia 82(7):933–938
Lovati MR, Manzoni C, Castiglioni S, Parolari A, Magni C, Duranti M (2012) Lupin seed γ-conglutin lowers blood glucose in hyperglycaemic rats and increases glucose consumption of HepG2 cells. Br J Nutr 107(1):67–73
Duranti M, Consonni A, Magni C, Sessa F, Scarafoni A (2008) The major proteins of lupin seed: Characterisation and molecular properties for use as functional and nutraceutical ingredients. Trends Food Sci Technol 19(12):624–633
Capraro J, Magni C, Scarafoni A, Duranti M (2009) Susceptibility of lupin gamma-conglutin, the plasma glucose-lowering protein of lupin seeds, to proteolytic enzymes. J Agric Food Chem 57(18):8612–8616
Oh KJ, Lee DS, Kim WK, Han BS, Lee SC, Bae KH (2016) Metabolic Adaptation in Obesity and Type II Diabetes: Myokines, Adipokines and Hepatokines. Int J Mol Sci ;18(1)
Żurawska-Płaksej E, Knapik-Kordecka M, Rorbach-Dolata A, Piwowar A (2016) Increased chitotriosidase activity in plasma of patients with type 2 diabetes. Arch Med Sci 12(5):977–984
Martínez-Ayala AL, López-Laredo AR, González-Hernández AN, Moreno AA, Dávila-Ortíz G, Santen E et al (eds) (2000) The molecular characteristics of the conglutin γ in Lupinus campestris
Schägger H, von Jagow G (1991) Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal Biochem 199(2):223–231
Reed MJ, Meszaros K, Entes LJ, Claypool MD, Pinkett JG, Gadbois TM et al (2000) A new rat model of type 2 diabetes: the fat-fed, streptozotocin-treated rat. Metabolism 49(11):1390–1394
Reeves PG, Nielsen FH, Fahey GC Jr (1993) AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. J Nutr 123(11):1939–1951
Srinivasan K, Patole PS, Kaul CL, Ramarao P (2004) Reversal of glucose intolerance by by pioglitazone in high fat diet-fed rats. Methods Find Exp Clin Pharmacol 26(5):327–333
Srinivasan K, Viswanad B, Asrat L, Kaul CL, Ramarao P (2005) Combination of high-fat diet-fed and low-dose streptozotocin-treated rat: a model for type 2 diabetes and pharmacological screening. Pharmacol Res 52(4):313–320
Algandaby MM, Alghamdi HA, Ashour OM, Abdel-Naim AB, Ghareib SA, Abdel-Sattar EA et al (2010) Mechanisms of the antihyperglycemic activity of Retama raetam in streptozotocin-induced diabetic rats. Food Chem Toxicol 48(8–9):2448–2453
Roberto deJ, Sandoval-Muñíz BV-G, Tereso J, Guzmán, Guzmán SafTJ PMG-L, Alma L, Martínez-Ayala JA, Domínguez-Rosales CM (2018) Gurrola-Díaz. Lupin gamma conglutin protein: effect on Slc2a2, Gck and Pdx-1 gene expression and GLUT2 levels in diabetic rats. Revista Brasileira de Farmacognosia 28:716–723
Saad MI, Kamel MA, Hanafi MY (2015) Modulation of Adipocytokines Production and Serum NEFA Level by Metformin, Glimepiride, and Sitagliptin in HFD/STZ Diabetic Rats. Biochem Res Int 2015:138134
Vogler GA (2006) Anesthesia and analgesia. The laboratory rat: Elsevier; p. 627 – 64
Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC (1985) Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 28(7):412–419
Katz A, Nambi SS, Mather K, Baron AD, Follmann DA, Sullivan G et al (2000) Quantitative insulin sensitivity check index: a simple, accurate method for assessing insulin sensitivity in humans. J Clin Endocrinol Metab 85(7):2402–2410
Katz MH (ed) Study Design and Statistical Analysis: A Practical Guide for Clinicians2006
Zepeda-Pena AC, Gurrola-Diaz CM, Dominguez-Rosales JA, Garcia-Lopez PM, Pizano-Andrade JC, Hernandez-Nazara ZH et al (2021) Effect of Lupinus rotundiflorus gamma conglutin treatment on JNK1 gene expression and protein activation in a rat model of type 2 diabetes. Pharm Biol 59(1):374–380
González-Santiago AE, Vargas-Guerrero B, García-López PM, Martínez-Ayala AL, Domínguez-Rosales JA, Gurrola-Díaz CM (2017) Lupinus albus Conglutin Gamma Modifies the Gene Expressions of Enzymes Involved in Glucose Hepatic Production In Vivo. Plant Foods Hum Nutr 72(2):134–140
Hininger-Favier I, Benaraba R, Coves S, Anderson RA, Roussel A-M (2009) Green Tea Extract Decreases Oxidative Stress and Improves Insulin Sensitivity in an Animal Model of Insulin Resistance, the Fructose-Fed Rat. J Am Coll Nutr 28(4):355–361
Tanaka S, Hayashi T, Toyoda T, Hamada T, Shimizu Y, Hirata M et al (2007) High-fat diet impairs the effects of a single bout of endurance exercise on glucose transport and insulin sensitivity in rat skeletal muscle. Metabolism 56(12):1719–1728
Singla S, Kaur K, Kaur G, Kaur H, Kaur J, Jaswal S (2009) Lipoprotein (a) in type 2 diabetes mellitus: Relation to LDL:HDL ratio and glycemic control. Int J diabetes developing Ctries 29(2):80–84
Wu L, Parhofer KG (2014) Diabetic dyslipidemia. Metabolism 63(12):1469–1479
Bouchoucha R, Kacem Ben M, Bouchoucha M, Akrout M, Feki M, Kaabachi N et al (2016) Anti-hyperglycemic and Anti-hyperlipidemic Effects of Lupinus albus in Type 2 Diabetic Patients: A Randomized Double-blind, Placebo-controlled Clinical Trial. Int J Pharmacol 12(8):830–837
Trujillo ME, Scherer PE (2006) Adipose tissue-derived factors: impact on health and disease. Endocr Rev 27(7):762–778
Vargas-Guerrero B, Garcia-Lopez PM, Martinez-Ayala AL, Dominguez-Rosales JA, Gurrola-Diaz CM (2014) Administration of Lupinus albus gamma conglutin (Cgamma) to n5 STZ rats augmented Ins-1 gene expression and pancreatic insulin content. Plant Foods Hum Nutr 69(3):241–247
Kabadi MU, Kabadi UM (2004) Effects of glimepiride on insulin secretion and sensitivity in patients with recently diagnosed type 2 diabetes mellitus. Clin Ther 26(1):63–69
Nguyen TMD, Adiponectin (2020) Role in Physiology and Pathophysiology. Int J Prev Med 11:136
Nourbakhsh M, Nourbakhsh M, Gholinejad Z, Razzaghy-Azar M (2015) Visfatin in obese children and adolescents and its association with insulin resistance and metabolic syndrome. Scand J Clin Lab Investig 75(2):183–188

No competing interests reported.

Download PDF

Journal Publication

published 22 Sep, 2023

Read the published version in Open Access Macedonian Journal of Medical Sciences →

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Effect of Lupinus albus conglutin gamma protein on experimentally induced diabetes in rats

Status:

Journal Publication

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

Results

DISCUSSION

CONCLUSION

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1