-
Trichomonas vaginalis and treatments
T. vaginalis (ATCC_30236) was used in this study. An iron-deficient (ID) group of T. vaginalis was established by the addition of 180 M dipyridyl (DIP, Sigma Aldrich, Merck, Germany) to yeast extract, iron-serum (YI-S) medium at a density of ~ 1 × 106/ml, and an iron-rich (IR) cell group was established using YI-S medium containing ferrous ammonium citrate (FAC) [16]. To create a nitrate treatment for the ID cells, sodium nitrate (25 mM, Sigma Aldrich, Merck) was added at the same time DIP was added. The viability of trichomonad cells in the different treatments was assessed by trypan blue exclusion assay using a hemocytometer (Reichert Technologies, USA).
2. Sequence analysis and expression profiles of TvLDHs
The protein sequences of putative LDH and MDH orthologs were collected from TrichDB [23]. The TvLDH-specific leucine 91 was used as an indicator for annotating TvLDHs [24]. TvLDHs and TvMDHs were aligned by T-coffee, and the identity among the proteins were estimated by using the NCBI Blast tool [25]. The expression patterns of TvLDH short reads derived from next-generation sequencing were extracted from previous mapping results [16].
3. RNA extraction and quantitative reverse transcription polymerase chain reaction
The total RNA of T. vaginalis cultured under iron-rich and -deficient conditions was extracted for determining the expression levels of TvLDHs [16]. Briefly, the cell pellets were resuspended in TRI Reagent Solution (Invitrogen, Thermo Fisher Scientific, USA) and incubated at RT for 5 min. After adding chloroform, the mixture was incubated at RT for 15 min. The RNA fraction was generated high-speed centrifugation at 4 °C for 15 min and collected. Diethylpyrocarbonate (DEPC)-treated 70% alcohol was added to wash the RNA pellets, and the air-dried pellets were reconstituted in DEPC-treated water.
cDNA corresponding to each condition was generated from mRNA via reverse transcription. The mRNA was supplemented with oligo-dT primer and dNTPs (Invitrogen, Thermo Fisher Scientific) and incubated at 65 °C for 5 min. A cDNA synthesis mix containing ThermoScript™ III reverse transcriptase (Invitrogen, Thermo Fisher Scientific), RNaseOUT (Promega, USA), and dithiothreitol (Sigma-Aldrich, Merck) was added to the mixture. cDNA conversion was performed via a series of incubations (25, 50, and 85 °C for 5, 60, and 15 min, respectively). RNA was removed from the RNA-cDNA hybrids via RNase H treatment at 37 °C for 20 min.
The cDNA was then subjected to real-time polymerase chain reaction (real-time PCR). Ribosomal protein L8 (TVAG_104490) was used as the internal control for data normalization (forward: TTGCGGTATCAAGATGAACCCAG, reverse: GAACCAAAGCTTTATGCAAGGTGA) [16]. The reaction mixture contained cDNA, TOOLS 2 × SYBR qPCR mix (Biotools, Taiwan), and specific primer sets (Additional file 1), and the reaction was performed using a QuantStudio 3 instrument (Applied Biosystems, Thermo Fisher Scientific, USA).
4. Lactate and pyruvate measurements
Lactate and pyruvate levels in trichomonad cells were determined according to the manufacturer's instructions (BioVision, USA). Briefly, ~ 1 × 106 cells per sample were collected and washed twice with cold-PBS. The cell pellets were resuspended in Assay Buffer and incubated on ice for 10 min. The cell debris was precipitated by high-speed centrifugation, and the supernatant was collected for analysis. The standard and reaction mixes for these assays were prepared as recommended by the manufacturer. Each sample and standard (50 𝜇l) was loaded onto a 96-well ELISA plate, to which 50 𝜇l of reaction mix was added. After incubation for 30 min at RT, the absorbance at 450 and 570 nm was recorded by an ELISA reader (SpectraMax M2e, Molecular Devices, USA) for the lactate and pyruvate assay, respectively.
5. Biotin switch assay and SNO protein purification
The S-nitrosylated proteins were visualized by biotin-switch assay following the manufacturer’s guidelines (Cayman Chemical, USA) [19]. Cells were washed twice with Wash Buffer. The pellets were resuspended in “Buffer A containing Blocking Reagent” and incubated for 30 min at 4 °C with shaking. The incubated samples were centrifuged at 130,000 rpm for 10 min at 4 °C, and the supernatant was transferred to 15-ml centrifuge tubes. Two milliliters of ice-cold acetone was added to each sample, and the mixture was incubated at − 20 °C for at least 1 h. The protein of each sample was pelleted by centrifugation for 10 min at 4 °C. The “Buffer B containing Reducing and Labeling Reagents” was added to resuspend the proteins, with incubation for 1 h at room temperature. The biotinylated protein was precipitated by acetone as described above and rehydrated with the appropriate amount of Wash Buffer.
The biotin-labeled proteins were next captured by streptavidin-conjugated beads. Following the manufacturer's instructions, streptavidin-coupled magnetic beads (GE Healthcare, Merck, Germany) were equilibrated with binding buffer (Tris-buffered saline, TBS) before adding the biotinylated proteins. The protein-beads mixture was incubated for 30 min at 4 °C with gentle shaking. The unbound proteins were removed by washing with 2 M urea-containing TBS. The biotinylated proteins were then transferred to a new tube for trypsin digestion.
6. Western blotting
The tyrosine-nitrated and biotinylated proteins were assessed by the streptavidin-horseradish peroxidase (HRP) approach. Briefly, proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a nitrocellulose membrane. The membrane was blocked with 3% bovine serum albumin (BSA) in Tris-buffered saline Tween-20 (TTBS) overnight. For the detection of biotinylated proteins, S-Nitrosylation Detection Reagent was used at 1:5000 dilution and incubated for 1 h at room temperature. Anti-nitrotyrosine antibody (1:500, Merck) was added to the blocking buffer, and the membrane was incubated overnight with gentle shaking. Secondary antibody coupled with HRP (BioTools) was added to the membrane, which was incubated at RT for 40 min. After washing steps, the membrane was developed with enhanced chemiluminescence (ECL) substrate and visualized by Gel Doc imaging system (Bio-Rad, USA).
7. In-solution digestion
The biotin-labeled products were eluted, vacuum dried and reconstituted in 50 mM ammonium bicarbonate (ABC) and then reduced with 10 mM dithiothreitol (DTT, Sigma Aldrich, Merck) at 56 °C for 45 min. Next, cysteine blocking was performed with 40 mM iodoacetamide (IAM, Sigma Aldrich, Merck) at 25 °C for 30 min. The samples were digested with sequencing-grade modified porcine trypsin (Promega) at 37 °C for 16 h. The peptides were then desalted, dried by vacuum centrifugation, and stored at − 80 °C until use.
8. LC-MS analysis and protein identification
The dried peptide mixtures were reconstituted in HPLC buffer A (0.1% formic acid, Sigma Aldrich, Merck) and loaded onto a reverse-phase column (Zorbax 300SB-C18, 0.3 × 5 mm; Agilent Technologies, USA). The desalted peptides were then separated on a homemade column (HydroRP 2.5 µm, 75 µm I.D. × 20 cm with a 15 µm tip) using a multistep gradient of HPLC buffer B (99.9% acetonitrile/0.1% formic acid) for 70 min with a flow rate of 0.25 µl/min. The LC apparatus was coupled to a 2D linear ion trap mass spectrometer (Orbitrap Elite ETD; Thermo Fisher Scientific) operated using Xcalibur 2.2 software (Thermo Fisher Scientific). Full-scan MS was performed in the Orbitrap over a range of 400 to 2,000 Da and a resolution of 120,000 at m/z 400. Internal calibration was performed using the ion signal of [Si(CH3)2O]6H + at m/z 536.165365 as lock mass. The 20 data-dependent MS/MS scan events were followed by one MS scan for the 20 most abundant precursor ions in the preview MS scan. The m/z values selected for MS/MS were dynamically excluded for 40 s with a relative mass window of 15 ppm. The electrospray voltage was set to 2.0 kV, and the temperature of the capillary was set to 200 °C. MS and MS/ MS automatic gain control were set to 1,000 ms (full scan) and 200 ms (MS/MS), or 3 × 106 ions (full scan) and 3 × 103 ions (MS/MS) for maximum accumulated time or ions, respectively.
The data analysis was carried out using Proteome Discoverer software (version 1.4, Thermo Fisher Scientific). The MS/MS spectra were searched against the UniProt database (extracted for T. vaginalis, 50,827 sequences) using the Mascot search engine (Matrix Science, London, UK; version 2.5). For peptide identification, 10 ppm mass tolerance was permitted for intact peptide masses, and 0.5 Da was permitted for CID fragment ions with allowance for two missed cleavage sites from the trypsin digestion. oxidized methionine and acetyl (protein N-terminal) were set as variable modifications, and carbamidomethyl (cysteine) was set as a fixed modification. Peptide-spectrum matches (PSMs) were then filtered based on high confidence and a Mascot search engine rank of 1 for peptide identification to ensure an overall false discovery rate below 0.01. Proteins with only a single peptide hit were removed.
9. GAPDH activity assays
The activity of TvGAPDH was measured as described by the manufacturer (BioVision). The cells (~ 106) of each condition were collected, washed with cold-PBS, and lysed by Assay Buffer. After high-speed centrifugation, the supernatant was collected and loaded into the testing wells. The reaction mix (GAPDH Developer and Substrate) was added to the samples, which were incubated at 37 °C for 1 h. The absorbance of each sample at 450 nm was measured every 10 min, and the NADH concentration was determined according to a standard curve. The activity of GAPDH in each sample was calculated and expressed as nmol/min/µl.
10. LDH activity assay
The activity of TvLDH after sodium nitrate treatment was determined according to the manufacturer’s instructions (Sigma Aldrich, Merck). Cells (~ 106) of iron-deficient and sodium nitrate-treated groups were collected, washed with cold-PBS, and lysed with Assay Buffer. The supernatant was collected following high-speed centrifugation and added to wells for analysis. The Substrate Mix solution was added to the samples, which were then incubated for 30 min. The absorbance of each sample at 450 nm was detected every 5 min, and the NADH concentration was determined according to a standard curve. The activity of LDH in samples was calculated and expressed as mU/ml.
11. NAD+/NADH assay
Total NAD and the NAD+ to NADH ratio were examined following the manual provided by the manufacturer (BioVision). The cells (4 × 106) were collected and washed with cold-PBS. The cell pellets were resuspended by the addition of Extraction Buffer and lysed by freeze/thaw cycles. The deproteinized supernatant was separated into two parts for measurements: total NAD+ with NADH and NADH only (NAD+ decomposition was performed via 60 °C incubation for 30 min). The reaction mix (NAD Cycling Buffer and Enzyme Mix) was added to the wells along with the samples, and the samples were incubated at RT for 5 min. NADH developer was then added to the wells, and the samples were again incubated at RT for 2 h. The absorbance of each well at 450 nm was measured, and the concentration was calculated according to a standard curve. The NAD+ amount was determined by subtracting the amount of NADH from the total amount of NAD+ and NADH.
12. Statistical analysis
Student’s t-tests were used to analyze the data derived from biological repeats using GraphPad Prism 5 software. Asterisks denote test significance according to P-value: * P < 0.05, **P < 0.01, and *** P < 0.001.