Cyclic-di-AMP confers an invasive phenotype on Escherichia coli through elongation of flagellin filaments

doi:10.21203/rs.3.rs-3323664/v1

Download PDF

Article

Cyclic-di-AMP confers an invasive phenotype on Escherichia coli through elongation of flagellin filaments

https://doi.org/10.21203/rs.3.rs-3323664/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Adherent-invasive Escherichia coli (AIEC) is isolated from patients with Crohn’s disease (CD). AIEC can invade the intestinal epithelium, suggesting that it is involved in the development and pathogenesis of CD. However, themechanism by which AIEC acquired the invasive phenotype remains unknown. This study was designed to examine the mechanisms of AIEC invasiveness. We found that the flagellin (fliC) expression in AIEC was two-fold higher than that in non-AIEC strains, and this overexpression induced the formation of long-filament flagellin. Deletion of fliC in the AIEC LF82 strain resulted in the disappearance of flagellar filamentsand attenuated the motility and invasive ability of the bacterium, suggesting that the formation of long filament flagellin induced by increased fliC expression is required by AIEC to invade the intestinal epithelium. In AIEC and non-AIEC K12 strains cultured in the presence of cyclic-di-AMP (c-di-AMP), the expression of fliC was enhanced, and flagellar filaments were elongated. Stimulation with c-di-AMP enhanced the bacterial motility and ability to invade epithelial cells, even in the non-AIEC K12 strain. Our findings show that c-di-AMP confers an AIEC-like phenotype on non-AIEC strains by enhancing the expression of fliC. The results should be useful for understanding the pathogenesis of CD.

Biological sciences/Microbiology/Bacteriology

Biological sciences/Microbiology/Bacteria/Bacterial pathogenesis

Crohn’s disease (CD) is an inflammatory bowel disease (IBD), with courses of ulceration, inflammation, and fibrosis in the intestine and digestive tract. It is an intractable disease of unknown etiology that is more common among young people. The incidence of IBD is increasing worldwide, particularly in the developed countries (1, 2). Several studies have shown alterations in the gut microbiota of patients with CD compared to healthy subjects, suggesting that dysbiosis of the gut microbiota is associated with the development and pathogenesis of CD (3, 4).

Commensal gut bacteria communicate with each other to coordinate their behavior and function. Bacterial communication is achieved by modifying gene expression using second messengers. Cyclic di-AMP (c-di-AMP), a cyclic nucleotide produced by bacteria, is a second messenger that regulates bacterial gene expression by binding to its target effectors (5). In bacterial cells, c-di-AMP is synthesized by the condensation of two ATP molecules by diadenylyl cyclase (DAC) enzymes, such as DacA, DisA, and DacB (5).

Adherent-invasive Escherichia coli (AIEC) was isolated from the distal end of the ileum, a common stricture site in patients with CD (6). Unlike non-AIECs, AIEC adhere and invade the intestinal epithelium. The adhesion of AIEC is mediated by interactions between bacterial type-1 pili and carcinoembryogenic antigen-related adhesion molecule 6 (CECAM6) on the surface of host epithelium (7). The bacterial invasion is promoted by the binding of bacterial outer membrane proteins (OmpA) to the ER-stress response chaperone, Gp96, which is strongly expressed on the apical surface of ileal epithelial cells (8, 9). The specific adhesion and invasiveness of AIEC is belived to strongly contribute to the development and pathogenesis of CD, especially the postoperative recurrence (10).

The flagellum of E. coli is a complex structure consisting of three main structural regions: the basal body, hook, and filament. The flagellin filament extends outward from the basal body and is a polymer of the flagellin subunits encoded by fliC. Flagellin filaments are responsible for the ability of AIEC strains to cross the mucus layer in vitro and in vivo, penetrate the mucus layer, and reach the epithelial surface (11).

We recently showed that AIEC-specific IgA antibodies are produced in the gastrointestinal tract of AIEC-infected mice (12). The IgA antibody specific to AIEC could inhibit its ability to adhere to and invade the intestinal epithelial Caco-2 cells (12). However, it remains unclear how AIEC acquired the ability to adhere to and invade the intestinal epithelium. The present study was aimed at elucidating the acquisition mechanisms of adhesion and invasiveness of AIEC. The results implicate the role of flagellin elongation in E. coli mediated through c-di-AMP in the invasive ability of AIEC. The results of this study should help better understand the pathogenesis of CD and aid in devising better therapeutic strategies against this intractable disease.

Flagellar filaments of AIEC are elongated as a result of increased fliC expression.

Bacterial flagella mediate not only motility but also bacterial adhesion and invasion (13, 14). We compared the flagellar structure in the AIEC LF82 strain isolated from patients with CD with those in of E. coli K12 strain used as a non-AIEC reference strain. The flagellar length of the AIEC LF82 strain was significantly greater than that of the non-AIEC K12 strain (Fig. 1a, b). The flagellar structure in E. coli contains three distinct components: a basal body, hook, and extracellular filament. The flagellin (FliC) subunit is the main component of the flagellar structure (15). To clarify the involvement of FliC in flagellar elongation in the AIEC LF82 strain, fliC deletion mutants (ΔfliC strains) were constructed using homologous recombination (Fig. S1a). We confirmed the deletion of gene (1489 bp) using PCR (Fig. S1b). The flagellar filaments of both the AIEC LF82 and non-AIEC K12 strains completely disappeared after fliC deletion (Fig. 1a). We then compared the expression levels fliC mRNA in AIEC LF82 with those in the non-AIEC K12 strain. fliC expression levels in the AIEC LF82 strain were significantly higher than those in the non-AIEC K-12 strains (Fig. 1c). Additionally, the levels of fliC mRNA expression were enhanced in several AIEC strains compared with those in several non-AIEC strains, which indicates that increased fliC expression inducing flagellar elongation is a characteristic of the AIEC strain (Fig. 1d).

Enhanced bacterial migration and invasive abilities of AIEC are provided by increased fliC expression.

To examine whether the migration ability of the AIEC LF82 strain was enhanced, the swimming motility of the bacterium was measured using LB medium containing 0.3% agar (10). The swimming diameters of the AIEC LF82 strain were significantly greater than those of the non-AIEC K12 strains (Fig. 2a, b). The enhanced swimming ability of the AIEC LF82 strain was significantly attenuated to the same level as that of the non-AIEC K12 strains by deletion of fliC (Fig. 2b). Next, we constructed in vitro bacterial infection models using Caco-2 cells grown on a Transwell inserts to evaluate the bacterial invasion ability (Fig. 2c). Caco-2 cells grown on a Transwell inserts were infected with each bacterium (1 × 10⁵ bacteria) for 3 h and then incubated with DMEM containing kanamycin for 3 h to kill extracellular bacteria. The number of bacteria within Caco-2 cells infected with the AIEC LF82 strain was significantly higher than that in cells infected with the non-AIEC K12 strains (Fig. 2d). The fliC deletion significantly decreased the number of invading bacteria in both non-AIEC K12 and AIEC LF82 strains and attenuated the enhanced invasive ability of the AIEC LF82 strain compared with that of the non-AIEC K12 strains (Fig. 2d). Additionally, in AIEC LF82-infected mice, the number of invasive bacteria in the cecal epithelium was decreased by deletion of fliC (Fig. 2e). Together, our results show that the bacterial migration and invasion abilities of the AIEC LF82 strain were enhanced by the increased fliC expression.

C-di-AMP elongates flagella in both non-AIEC K12 and AIEC LF82 strains by enhancing fliC expression.

C-di-AMP is a bacterial second messenger that regulates the expression of several genes involved in DNA damage, biofilm formation, acid stress resistance, and other functions (3, 16–19). We hypothesized that the expression of fliC in E. coli is enhanced by c-di-AMP signaling. To test this hypothesis, we examined changes in fliC expression and flagellar elongation in the presence of c-di-AMP. The expression of fliC in both non-AIEC K12 and AIEC LF82 strains increased 2- and 4-fold, respectively, in the presence of 5.0 µM c-di-AMP (Fig. 3a). Next, we examined the flagellar length in each bacterium cultured in the presence of c-di-AMP using scanning electron microscopy (SEM) and transmission electron microscopy (TEM). In the presence of c-di-AMP, the flagellar length was increased in both non-AIEC K12 and AIEC LF82 strains (Fig. 3b, c). In fliC-deletion mutant strains, elongated flagellar structures were not observed even in the presence of c-di-AMP (Fig. 3b).

C-di-AMP confers an AIEC-like phenotype to non-AIEC strains by enhancing fliC expression.

We examined whether the flagellar elongation induced by c-di-AMP affected bacterial migration and invasion. The swimming diameters of both the non-AIEC K12 and AIEC LF82 strains were significantly extended in the presence of c-di-AMP, but not in the fliC-deletion mutant strain (Fig. 4a, b). Additionally, the number of intracellular bacteria within Caco-2 cells infected with the non-AIEC K12 and AIEC LF82 strains were significantly increased in the presence of c-di-AMP (Fig. 4c). In contrast, in fliC-deletion mutant strain-infected Caco-2 cells, c-di-AMP stimulation did not increase the number of intracellular bacteria (Fig. 4c). These findings suggest that c-di-AMP enhances bacterial motility and invasiveness through the elongation of flagella by increasing the expression of fliC (Fig. 4c).

C-di-AMP is synthesized and secreted by several bacteria, mainly the gram-positive ones (3, 20). We hypothesized that intracellular c-di-AMP synthesis is specifically enhanced in the AIEC strain compared with that in the non-AIEC strain. To prove this, we measured the concentration c-di-AMP within bacterial cells by Liquid chromatography-tandem mass spectrometry. However, intracellular c-di-AMP was not detected in either the AIEC or non-AIEC strains, suggesting that c-di-AMP is not synthesized even in AIEC strain (Fig. S2a). This may be because E. coli, which belongs to the phylum Delta-Proteobacteria does not encode the diadenylate cyclase (DAC) domain, which converts two ATP or ADP molecules into one c-di-AMP molecule (3). From these observations, we can assume that E. coli accepts extracellular c-di-AMP produced by other gut microbial communities.

AIEC strains are capable of adhering to and invading the intestinal epithelium, unlike the intestinal commensal E. coli (21). Although AIEC strains are thought to contribute to the development of CD, the origin and/or route of infection is not well known. Several reports have shown alterations in the composition of the gut microbiota in patients with CD compared with that in healthy donors (22). Imbalances in the gut microbiota affect the overall structure of the microbiota community and specific bacterial expansion by altering bacterial cell–cell communication (23). Here, we examined whether c-di-AMP, a bacterial cell–cell communication messenger, effects the E. coli phenotype associated with the invasion of the host epithelium. The results showed that c-di-AMP enhanced bacterial motility and invasion ability of epithelial cells, even in the non-AIEC strain, by elongating the bacterial flagellum. Our findings suggest that c-di-AMP confers an AIEC-like phenotype on non-AIEC strains in the gut lumen.

Genes involved in the flagellar assembly are classified into three groups: classes I–III (24). Class III contains genes involved in fiber formation, the final step in flagellar development (including flagellar fiber-forming flagellin), and genes involved in the functioning of the completed flagellum (24). The fliC genes belonging to class III encode flagellin, which forms flagellar fibers. Genes belonging to class III are downstream of class II genes; therefore, the expression of class III genes is regulated by class II promoters. Flagella are involved in the ability of AIEC to cross the mucus layer; therefore, enhancement of bacterial motility by the flagellar function is believed to confer a selective advantage to E. coli in penetrating the mucus layer and reaching the epithelial surface (21). In AIEC infection models in vivo, the deletion of fliC decreased bacterial adhesion to the intestinal epithelium (Fig. 2e). Additionally, the deletion of fliC significantly decreased bacterial motility in both the AIEC and non-AIEC strains (Fig. 2a, b). These findings suggest that the acquisition of enhanced bacterial motility by increasing the expression of fliC hastens the approach to the epithelial surface, leading to enhanced adherence and invasiveness. The results showed that the fliC expression levels regulate the length of flagellar filaments, contributing to bacterial invasiveness.

As evident from Figure S2, neither the AIEC nor the K12 strain synthesizes c-di-AMP, and thus it is thought to sense extracellular c-di-AMP released by other gut microbiota communities. The composition of the gut microbiota is known to be altered in patients with CD compared with that in healthy donors; therefore, we assumed that the gut microbial composition is enriched with microorganisms possessing high c-di-AMP production abilities in patients with CD. Interestingly, several gram-positive bacteria have been identified as high c-di-AMP producers and further a relatively high proportion of gram-positive bacteria has been reported in the gut microbiota of IBD patients (22, 25). Hence, the production of c-di-AMP in the gastrointestinal lumen of patients may be elevated. Although further studies are needed to identify the gut microbiota communities that enhance c-di-AMP levels in CD patients with CD, our findings reveal that extracellular stimulation of c-di-AMP in the gut lumen induces the expression of fliC and confers the invasiveness of E. coli.

Ethics for human studies

The study design was reviewed and approved by the Institutional Review Board of Tokai University School of Medicine (No. 20I-35) and was conducted according to principles of the Declaration of Helsinki. Written informed consent was obtained from all participants before their inclusion in the study. All studies were performed in compliance with the ARRIVE guidelines (https://arriveguidelines.org).

Ethics for animal studies

Animal experiments were approved by the Tokai University (Kanagawa, Japan) Animal Research Committee (No. 220244) and were conducted in accordance with the “Act on Welfare and Management of Animals of Japan,” “Standards relating to the Care and Keeping and Reducing Pain of Laboratory Animals,” “Standards relating to the Methods of Destruction of Animals,” “Guidelines for Proper Conduct of Animal Experiments,” and “Fundamental Guidelines for Proper Conduct of Animal Experiments.”

Bacterial strains and cell lines

Escherichia coli K12 ATCC10798, purchased from the American Type Culture Collection (ATCC), was used as the non-AIEC strain. E. coli LF82 strain was isolated from a chronic ileal lesion in a patient with CD and used as the AIEC strain (9). The following clinical isolates of E. coli were used in this study: E. coli HS, LF1, LF6, LF19, LF48, LF55, LF111, LF134, LF135, LF82, LF16, LF31, LF73, 6076, 6088, 6170, 6254, 6259, and 6283 (26, 27, 28). All bacteria were routinely cultured in Luria Bertani (LB) broth (Nacalai Tesque Inc.) overnight at 37°C with shaking at 160 rpm until their growth reached the mid-exponential phase (OD₅₇₀ = 1.0).

Human colon adenocarcinoma, Caco-2, cells were purchased from the European Collection of Cell Cultures (ECACC 86010202). Caco-2 cells were maintained in a 5% CO₂ atmosphere at 37°C in Dulbecco's modified Eagle medium (DMEM, Gibco), supplemented with 10% (v/v) fetal bovine serum (Gibco), 0.01% minimum essential medium non-essential amino acids solution (Invitrogen), 0.01% L-glutamine (Invitrogen), and 0.01% penicillin-streptomycin (Nacalai Tesque Inc.).

Construction of fliC deletion mutant

The target-region gene cassette (5′fliC–ampicillin resistance gene–3′fliC) for construction of a fliC-deletion mutant was cloned into a temperature sensitive pTSC30 plasmid (29). The cassette was inserted into the open reading frame of FliC. The target-region gene cassette was constructed using the PCR-based overlap extension method (29). The primer sequences used for the construction of the cassette were as follows: 5′flic region: forward 5′-CTCGAGCATGGCACAAGTCAT and reverse 5′-CGACACGGAAATGTTGAATACTCATAATTTCGTCCTGGATAGAAGACAG; ampicillin resistance gene region: forward 5′-CTGTCTTCTATCCAGGACGAAATTATGAGTATTCAACATTTCCGTGTCG and reverse 5′-CTACAGATGCGATAGCATCGTCCAGACCAATGCTTAATCAGTGAGGCAC; 3′flic region: forward 5′-GTGCCTCACTGATTAAGCATTGGTCTGGACGATGCTATCGCATCTGTAG and reverse 5′-GGATCCTTAACCCTGCAGCA. For overlap extension, the forward primer used was the 5′flic region forward primer and the reverse primer was the 3′flic region reverse primer. The target-region gene cassette was inserted into the pTSC30 plasmid using the XhoI and BamHI sites and NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs). The target pTSC30 plasmid was electroporated into E. coli K12 cells, which were cultured overnight and selected on LB agar containing 50 µg/mL ampicillin at 37°C. The AIEC LF82 fliC deletion mutant strain (AIEC LF82 ΔfliC) was a gift from Dr. Nobuhiko Kamada (Department of Pathology and Comprehensive Cancer Center, University of Michigan, USA) (28).

In vivo bacterial infection

All animal experiments were approved by the Tokai University (Kanagawa, Japan) Animal Research Committee (No. 220244). Seven- to eight-week-old C57BL/6J female mice were purchased from CLEA Japan Co., Ltd. The mice were provided drinking water containing 20 mg/L streptomycin and 1 g/L ampicillin for 1 week prior to bacterial infection. They were orally inoculated with 200 µL LB broth containing AIEC LF82 or LF82-ΔfliC (1 × 10⁹ bacteria) using a stainless-steel feeding needle fitted to a 1.0 mL syringe and sacrificed 5 days after infection. The colorectal tissue was harvested and homogenized using a Biomasher II (Nippi). Serial dilutions of the homogenates were plated on LB agar, and colony-forming units (CFUs) were counted after 24 h of incubation.

In vitro bacterial infection

Caco-2 cells (2 × 10⁵ cells/well) were seeded in each well of a 6-well Transwell insert culture plates (0.4 µm pore size) (Corning, Lowell) at 7 days. Bacteria were precultured overnight with or without 5.0 µM c-di-AMP (Sigma) in LB broth. Caco-2 cells were infected with each bacterial strain at a multiplicity of infection of 0.5 for 2 h. The cells were lysed with PBS containing 1% Triton X-100 and the lysates were plated on LB agar. The number of CFUs was counted after 24 h incubation at 37°C.

Extraction of total RNA and quantitative real-time RT-PCR

AIEC and non-AIEC strains were preincubated overnight with or without 5 µM c-di-AMP (Sigma). Total RNA was isolated from bacteria using the SV Total RNA Isolation Kit (Promega) according to the manufacturer’s guidelines. The extracted total RNA was reverse-transcribed into single-stranded cDNA using the PrimeScript™ RT reagent kit (Takara). PCR was performed using the StepOne™ Real-Time PCR system with PowerTrack™ SYBR Green Master Mix (Thermo Fisher Scientific). The sequences of primers were as follows: non-AIEC: F: 5′-ATTCCGTTCTTCCCTCGGTG-3′, R: 5′-TGGACACTTCGGTCGCATAG-3′ (amplicon size: 131 bp) and F: 5′-ATGGCACAAGTCATTAATACC-3′, R: 5′-AAGACAGACGCTCGATAGAAC-3′ (amplicon size: 100 bp); AIEC: F: 5′-TGGTGCTGCAACTGCTAACGC-3′, R: 5′-TTATCGGCATATTTTGCGCTAGC-3′ (amplicon size: 212 bp) and F: 5′-CGGCAAATACCGCCTGATACG-3′, R: 5′-GCTACAGCTAAACAAGGCACA-3′ (amplicon size: 100 bp). Relative gene expression levels were measured using the 2nd Derivative Maximum method. The 16s rRNA gene was used as a quantitative loading control and was amplified using the following primers: F: 5′-CATGCCGCGTGTATGAAGAA-3′ and R: 5′-CGGGTAACGTCAATGAGCAAA-3′.

Swimming motility assay

Bacterial swimming motility was evaluated in LB broth containing 0.3% agar (Becton Dickinson) and 0.3% glucose (Nacalai Tesque Inc.). Each bacterial strain was precultured with or without 5 µM c-di-AMP, and then 5 µL of the bacterial solution (OD₅₇₀ = 1.0) was dropped onto the center of the LB medium (10). After overnight culture, diameters of bacterial colonies were measured using the ImageJ software (National Institutes of Health).

Scanning electron microscopy

Bacteria were centrifuged (11000 × g, 3 min, 4°C) and fixed overnight in 1% glutaraldehyde prepared in 0.1 M phosphate buffer (pH 7.4) at 4°C or for 30 min at 25 ~ 28℃ and washed three times with 0.2 M cacodylate buffer for 10 min each. The cells were then fixed by incubation for 1 h in 1%OsO₄ -0.1M Phosphate Buffer(pH7.4)and subsequently dehydrated using a graded series of ethanol (50%, 70%, 90%, 95%, and 100%). The cells were then washed (15 min for each wash), and dried. After dehydration using a graded acetone series, E. coli cells were transferred to tert-butyl alcohol and frozen. Frozen E. coli cells were freeze-dried in a VFD-30 freeze-drying device (Vacuum Device Ltd., Ibaraki, Japan) and coated with osmium using a Neoc-Pro osmium coater (Meiwafosis Co., Ltd., Tokyo, Japan). The SEM images were obtained using a JSM-6510LV scanning electron microscope (JEOL, Tokyo, Japan) at 15 kV. The length of flagellin filaments was measured using the ImageJ software (National Institutes of Health).

Transmission electron microscopy

Bacteria were gently resuspended in TEM sample buffer with 1% glutaraldehyde in 0.1 M phosphate buffer (pH 7.4) overnight at 4°C. A 10 µL sample was pipetted onto Formvar-coated 200-mesh nickel grids (Ted Pella Inc., Redding, CA) and allowed to settle for 25 min. The grids were air-dried and observed under a JEM-1400 transmission electron microscope (JEOL) at 100 kV.

Liquid chromatography-tandem mass spectrometry analysis

After dispensing 200 µL of the extract in a 1.5 mL plastic tube, 50 µL of 10 µM ¹⁵N5-AMP (internal standard) aqueous solution and 1.0 mL of acetonitrile (ACN) were added. The mixture was centrifuged at 10,000 × g for 10 min at 4°C. The supernatant was transferred to a new tube and dried under vacuum. The residue was dissolved with 100 µL of the solvent A (ACN/10 mM ammonium acetate in H₂O = 1/9, v/v). Aliquots of the reconstituted solutions were mixed with H₂O or 100 µM c-di-AMP in H₂O (1/1, v/v) and filtered through a membrane filter (Millex-LG membrane, 0.45 µm, Millipore). The filtrate was used as a sample for LC-MS/MS. The samples were analyzed using a UPLC system (ACQUITY UPLC I-Class, Waters, Milford, MA, USA) and a triple quadrupole MS (Xevo TQ-S, Waters). A Scherzo SM-C18 MF column (3 µm, 150 mm × 2 mm i.d., Imtakt) was used for separation. The mobile phases A (ACN/10 mM ammonium acetate in H₂O, 1/9, v/v) and B (ACN/100 mM ammonium acetate in H₂O, 1/1, v/v) were used for gradient elution as follows: 0–40% B (0–8 min), 40–100% B (8–10 min), 100% B (10–11 min), 100–0% B (11–11.1 min), 0% B (11.1–15 min). The flow rate was set at 0.200 mL/min and the column temperature was maintained at 40°C. The samples were maintained at 10°C and 3 µL of each was injected into the column. The conditions for electrospray ionization and MS/MS were set as follows: ion mode, positive; capillary voltage, 3.0 kV; desolvation gas flow, 1000 L/h; cone gas flow, 150 L/h; nebulizer gas flow, 7.0 bar; source temperature, 150°C; desolvation temperature, 500°C; and data acquisition mode, MRM. The MRM transitions for c-di-AMP were set as follows: cone voltage, 60 V; precursor ion, m/z 658.7; collision energy, 50 eV; and product ion, m/z 136.1. MRM transitions for ¹⁵N5-AMP were set as follows: cone voltage, 30 V; precursor ion, m/z 353.1; collision energy, 20 eV; product ion, m/z 141.2. The data were analyzed using MassLynx V4.2. C-di-AMP sodium salt (SML-1231) and adenosine-¹⁵N5 5′-monophosphate (15N5-AMP) disodium salt (662658) were purchased from Merck KGaA (Darmstadt, Germany).

Statistical analysis

Data are presented as mean ± standard deviation (SD). The means of multiple groups were compared using analysis of variance (ANOVA), followed by Tukey’s tests using the JSTAT statistical software (version 8.2) and the unpaired Student’s t-test. All analyses were performed in a blinded manner without information about the experimental conditions. A value of P < 0.05 was considered significant. The animals were randomly assigned to various groups.

Data availability

All relevant data are within the manuscript and its supporting information.

Acknowledgments

We are grateful to the Support Center for Medical Research and Education at Tokai University School of Medicine for their technical assistance.

Author contributions

RT and HT contributed to the conception and design of the study. RT, ST, HT and ES performed the experiments. RT and HT organized the database and performed the statistical analysis. RT and HT wrote original draft of the manuscript. JI and HK reviewed and edited of the manuscript.

Competing interests

The authors declare no competing interests.

Funding

This study was supported by a 2021 Tokai University School of Medicine Research Aid grant (210049) (to H.T.), Tokai University Research Organization Grant (21NS331825) (to H.T.), and Tokai University Supporters Association Research and Study Grant (23J00600) (to H.T.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Bernstein CN, Shanahan F. Disorders of a modern lifestyle: reconciling the epidemiology of inflammatory bowel diseases. Gut 2008;57(9):1185–91, doi:10.1136/gut.2007.122143
Molodecky NA, Soon IS, Rabi DM, et al. Increasing incidence and prevalence of the inflammatory bowel diseases with time, based on systematic review. Gastroenterology 2012;142(1):46–54.e42; quiz e30, doi:10.1053/j.gastro.2011.10.001
Frank DN, St Amand AL, Feldman RA, et al. Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc Natl Acad Sci U S A 2007;104(34):13780–5, doi:10.1073/pnas.0706625104
Wiredu Ocansey DK, Hang S, Yuan X, et al. The diagnostic and prognostic potential of gut bacteria in inflammatory bowel disease. Gut Microbes 2023;15(1):2176118, doi:10.1080/19490976.2023.2176118
Corrigan RM, Gründling A. Cyclic di-AMP: another second messenger enters the fray. Nat Rev Microbiol 2013;11(8):513–24, doi:10.1038/nrmicro3069
Rolhion N, Darfeuille-Michaud A. Adherent-invasive Escherichia coli in inflammatory bowel disease. Inflamm Bowel Dis 2007;13(10):1277–83, doi:10.1002/ibd.20176
Barnich N, Carvalho FA, Glasser AL, et al. CEACAM6 acts as a receptor for adherent-invasive E. coli, supporting ileal mucosa colonization in Crohn disease. J Clin Invest 2007;117(6):1566–74, doi:10.1172/JCI30504
Rolhion N, Hofman P, Darfeuille-Michaud A. The endoplasmic reticulum stress response chaperone: Gp96, a host receptor for Crohn disease-associated adherent-invasive Escherichia coli. Gut Microbes 2011;2(2):115–9, doi:10.4161/gmic.2.2.15725
Rolhion N, Barnich N, Bringer MA, et al. Abnormally expressed ER stress response chaperone Gp96 in CD favours adherent-invasive Escherichia coli invasion. Gut 2010;59(10):1355–62, doi:10.1136/gut.2010.207456
Zheng L, Duan SL, Dai YC, et al. Role of adherent invasive. World J Clin Cases 2022;10(32):11671–11689, doi:10.12998/wjcc.v10.i32.11671
Fraser GM, Bennett JC, Hughes C. Substrate-specific binding of hook-associated proteins by FlgN and FliT, putative chaperones for flagellum assembly. Mol Microbiol 1999;32(3):569–80, doi:10.1046/j.1365-2958.1999.01372.x
Tanaka R, Imai J, Tsugawa H, et al. Adherent-invasive. Front Microbiol 2023;14(1031997, doi:10.3389/fmicb.2023.1031997
Miki T, Hoshino Y, Sudo N, et al. Deletion and Acetate Reduce Gut Colonization of Crohn's Disease-Associated Adherent-Invasive Escherichia coli by Decreasing Expression of Type 1 Fimbriae. Infect Immun 2022;90(3):e0066221, doi:10.1128/iai.00662-21
Barnich N, Boudeau J, Claret L, et al. Regulatory and functional co-operation of flagella and type 1 pili in adhesive and invasive abilities of AIEC strain LF82 isolated from a patient with Crohn's disease. Mol Microbiol 2003;48(3):781–94, doi:10.1046/j.1365-2958.2003.03468.x
Kakkanat A, Phan MD, Lo AW, et al. Novel genes associated with enhanced motility of Escherichia coli ST131. PLoS One 2017;12(5):e0176290, doi:10.1371/journal.pone.0176290
Yoon SH, Waters CM. The ever-expanding world of bacterial cyclic oligonucleotide second messengers. Curr Opin Microbiol 2021;60(96–103, doi:10.1016/j.mib.2021.01.017
He J, Yin W, Galperin MY, et al. Cyclic di-AMP, a second messenger of primary importance: tertiary structures and binding mechanisms. Nucleic Acids Res 2020;48(6):2807–2829, doi:10.1093/nar/gkaa112
Gundlach J, Krüger L, Herzberg C, et al. Sustained sensing in potassium homeostasis: Cyclic di-AMP controls potassium uptake by KimA at the levels of expression and activity. J Biol Chem 2019;294(24):9605–9614, doi:10.1074/jbc.RA119.008774
Commichau FM, Dickmanns A, Gundlach J, et al. A jack of all trades: the multiple roles of the unique essential second messenger cyclic di-AMP. Mol Microbiol 2015;97(2):189–204, doi:10.1111/mmi.13026
Mudgal S, Manikandan K, Mukherjee A, et al. Cyclic di-AMP: Small molecule with big roles in bacteria. Microb Pathog 2021;161(Pt A):105264, doi:10.1016/j.micpath.2021.105264
Sevrin G, Massier S, Chassaing B, et al. Adaptation of adherent-invasive. Gut Microbes 2020;11(3):364–380, doi:10.1080/19490976.2017.1421886
Macfarlane GT, Blackett KL, Nakayama T, et al. The gut microbiota in inflammatory bowel disease. Curr Pharm Des 2009;15(13):1528–36, doi:10.2174/138161209788168146
Bivar Xavier K. Bacterial interspecies quorum sensing in the mammalian gut microbiota. C R Biol 2018;341(5):297–299, doi:10.1016/j.crvi.2018.03.006
Schmitt CK, Ikeda JS, Darnell SC, et al. Absence of all components of the flagellar export and synthesis machinery differentially alters virulence of Salmonella enterica serovar Typhimurium in models of typhoid fever, survival in macrophages, tissue culture invasiveness, and calf enterocolitis. Infect Immun 2001;69(9):5619–25, doi:10.1128/IAI.69.9.5619-5625.2001
Manichanh C, Borruel N, Casellas F, et al. The gut microbiota in IBD. Nat Rev Gastroenterol Hepatol 2012;9(10):599–608, doi:10.1038/nrgastro.2012.152
Rasko DA, Rosovitz MJ, Myers GS, et al. The pangenome structure of Escherichia coli: comparative genomic analysis of E. coli commensal and pathogenic isolates. J Bacteriol 2008;190(20):6881–93, doi:10.1128/JB.00619-08
Darfeuille-Michaud A, Boudeau J, Bulois P, et al. High prevalence of adherent-invasive Escherichia coli associated with ileal mucosa in Crohn's disease. Gastroenterology 2004;127(2):412–21, doi:10.1053/j.gastro.2004.04.061
Imai J, Kitamoto S, Sugihara K, et al. Flagellin-mediated activation of IL-33-ST2 signaling by a pathobiont promotes intestinal fibrosis. Mucosal Immunol 2019;12(3):632–643, doi:10.1038/s41385-019-0138-4
Tsugawa H, Ogawa A, Takehara S, et al. Primary structure and function of a cytotoxic outer-membrane protein (ComP) of Plesiomonas shigelloides. FEMS Microbiol Lett 2008;281(1):10–6, doi:10.1111/j.1574-6968.2007.01041.x

No competing interests reported.

SciRepSupplementaryInformation.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Cyclic-di-AMP confers an invasive phenotype on Escherichia coli through elongation of flagellin filaments

Status:

Version 1

Abstract

Figures

Introduction

Results

Discussion

Experimental procedures

Ethics for human studies

Ethics for animal studies

Bacterial strains and cell lines

Construction of fliC deletion mutant

In vivo bacterial infection

In vitro bacterial infection

Extraction of total RNA and quantitative real-time RT-PCR

Swimming motility assay

Scanning electron microscopy

Transmission electron microscopy

Liquid chromatography-tandem mass spectrometry analysis

Statistical analysis

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1