Neurodevelopmental Effects of Prenatal Bisphenol A Exposure on the Role of MicroRNA Regulating NMDA Receptor Subunits in the Rat Hippocampus

doi:10.21203/rs.3.rs-3332532/v1

Download PDF

Article

Neurodevelopmental Effects of Prenatal Bisphenol A Exposure on the Role of MicroRNA Regulating NMDA Receptor Subunits in the Rat Hippocampus

https://doi.org/10.21203/rs.3.rs-3332532/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Maternal BPA exposure is known to cause learning and memory deficits in born offspring. However, little is known that the impairment is potentially caused by epigenetic modification. This study investigates the effect of prenatal BPA exposure on the microRNA expression: miR-19a and miR-539 encoding NMDA receptor subunits in the developing hippocampus with learning and memory functions when reaching adolescence. Pregnant Sprague Dawley rats were orally exposed at 5 mg/kg/day while the control was without BPA. The expression of miRNAs and NMDA receptor subunits in the hippocampus were examined at different stages of age by conducting the RT-PCR and Western Blot. The behavior of rats was then evaluated at adolescence age. Prenatal BPA exposure at 5 mg/kg/day was revealed to significantly reduce the expression of miR-19a and miR-539 concurrently with GRIN2A and GRIN2B expression at all stages of age. Consequently, the rats experience impairment in spatial and fear memory assessments compared to the control. Further, protein analysis revealed that GluN2A and GluN2B were also reduced before and after the assessment. The findings showed epigenetics modification on miR-19a and miR-539 during early development has been identified as one of the root causes of memory and learning impairment in rats when reaching adolescence.

Biological sciences/Developmental biology

Biological sciences/Neuroscience

Earth and environmental sciences/Environmental sciences

Health sciences/Health care

Health sciences/Neurology

Health sciences/Risk factors

Prenatal

Bisphenol A

MicroRNA expression

NMDA receptor subunits

BPA exposure during pregnancy has been recognized to have a long-term deleterious effect on fetal brain programming. The problem arises when mothers are exposed to BPA from various plastic and epoxy resins-based products such as food and drink packaging, household products, dental sealants, healthcare equipment, thermal paper, and many more ^1,2. In the last decade, this compound has been proven unsafe as it can leach into foodstuffs and the environment when exposed to hard use or high temperatures ³.

The prevalent use of BPA in daily life causes mothers to be defenseless against this compound from various routes such as oral, inhalation or transdermal ⁴. Studies found that there are about 9.13 to 257.67 ng/L of BPA migration into plastic water bottles, 0.06 to 32 ng/cm² from heated cans at 100°C into rations, 51.1 ng/kg/BW from thermal paper into dermal and 0.2 to 17.6 ug/g from house dust which close proximity to inhalation exposure ^3,5,6. However, oral ingestion has been identified to be the main route of BPA exposure ⁷. As a result, the BPA compound was revealed to be detectable in mothers' urine, plasma, placenta, amniotic fluid and cord blood, indicating a high possibility of the fetus being disclosed to BPA via intrauterine exposure ^8–12.

Amid the growing concerns, the United States Environmental Protection Agency (U.S EPA) in the year 2010 concluded that the appropriate no observed adverse effect level (NOAEL) is 5 mg/kg/BW/day while the lowest observed adverse effect level (LOAEL) is at 50 mg/kg/BW/day for rats ¹³. However, a wide range of animal studies on brain development consistently found prenatal BPA exposure at a lower or higher dosage than NOAEL can induce anxiety, depressive behaviour, and learning and memory impairment ^14–16. Notably, BPA is known as an endocrine-disrupting chemical (EDC) that can exert estrogenic and anti-androgenic effects on neurodevelopment as its lipophilic structure is similar enough to bind and inhibit the estrogen (ER) and androgen (AR) receptor changing the gene expression ⁴. Relatively, the placental transfer of BPA to the fetal compartment occurs through the transmission of BPA-GA from the maternal blood, then deconjugates into free BPA in the foetal tissue ¹⁷. Further, free BPA has been observed to disrupt the neurodevelopment process by invading the barrier system of the young brain, as an immature brain is more vulnerable to toxic substances like BPA than a well-developed brain. To pass through the blood-brain barrier, the estrogenic activity of BPA reportedly will interact and bind to the ER, cytoplasmic ER or G protein-coupled estrogen receptor (GPR30) receptor ^18,19.

Brain development during the prenatal period highly depends on environmental exposure and genetic control. The changing impact during this period might be deleterious to neurogenesis ^20,21. It has been suggested that epigenetic regulations are the most probable mechanism that will influence early life experience into permanent neurodevelopmental disorders in later life ²².

In this study, epigenetic regulation of miRNA expression will be an interesting target to investigate the potential cause of alterations in behavior specifically learning and memory tasks due to BPA exposure during intrauterine life. As summarize in Fig. 1. This cognitive function is thought to be regulated by the NMDA receptor at the postsynaptic terminal in the hippocampus. The activation of the NMDA receptor has been confirmed to act as a predominant molecular device to control synaptic plasticity and memory consolidation ²³. Two miRNAs, miR-19a and miR-539 are known to be parietal sequences to encode the NMDA receptor subunits which are GluN2A and GluN2B respectively. Along the development, these miRNAs will modulate the shift patterns of NMDA receptor subunits to control the threshold and the magnitude of long-term potentiation (LTP). GluN2B can be abundant in the young hippocampus while GluN2A increases progressively with development ²⁴. The “developmental switch” of miRNAs and NMDA receptor subunits along the development will ensure the efficiency of the activity-dependent synaptic changes in learning and memory ²⁵.

Although BPA exposure during early life has been approved to cause neurodevelopmental disorders, however, it remains unclear if the epigenetic dysregulation of the miR-19a and miR-539 will contribute to the changes in the formation of GluN2A and GluN2B proteins respectively. Intriguingly, there is still a lack of understanding on how the targeted miRNA along the development will act as a potential cofounder to cause persistent changes in the NMDA receptor subunit expression either during genetic or protein stages. At NOAEL doses, we will investigate the potential of epigenetics inheritance mainly through prenatal BPA exposure which is hypothesized to cause learning and memory impairment when reaching adolescence. Hence, understanding the control and action of the microRNA expression on the NMDA receptor subunits may provide clues to therapeutic strategies for treating the disorders at an earlier stage.

2.1 Prenatal BPA exposure downregulate miR-19a and miR-539 expression in the hippocampus

Table 1

The statistical analysis on the data for the expression of miR-19a and miR-539 in the male rat hippocampus at different stages of age.
Genes	Days	Groups	N	Median (Q1-Q3)	Z	P Value
miR-19a	GD21	Control	5	1 (1–1)	-2.83	< 0.001***
	GD21	5 mg/kg/day	5	0.54 (0.56–0.62)	-2.83	< 0.001***
	PND7	Control	5	1 (1–1)	-2.80	< 0.001***
	PND7	5 mg/kg/day	5	0.69 (0.40–0.72)	-2.80	< 0.001***
	PND14	Control	5	1 (1–1)	-2.79	< 0.001***
	PND14	5 mg/kg/day	5	0.57 (0.54–0.65)	-2.79	< 0.001***
	PND21	Control	5	1 (1–1)	-2.80	< 0.001***
	PND21	5 mg/kg/day	5	0.45 (0.44–0.48)	-2.80	< 0.001***
	AD35	Control	5	1 (1–1)	-2.80	< 0.001***
	AD35	5 mg/kg/day	5	0.42 (0.39–0.61)	-2.80	< 0.001***
miR-539 miR-539	GD21	Control	5	1 (1–1)	-2.80	0.005**
	GD21	5 mg/kg/day	5	0.33 (0.26–0.38)	-2.80	0.005**
	PND7	Control	5	1 (1–1)	-2.80	0.005**
	PND7	5 mg/kg/day	5	0.63 (0.59–0.68)	-2.80	0.005**
	PND14	Control	5	1 (1–1)	-2.80	0.005**
	PND14	5 mg/kg/day	5	0.65 (0.62–0.66)	-2.80	0.005**
	PND21	Control	5	1 (1–1)	-2.80	0.005**
	PND21	5 mg/kg/day	5	0.51 (0.46–0.66)	-2.80	0.005**
	AD35	Control	5	1 (1–1)	-2.80	0.005**
	AD35	5 mg/kg/day	5	0.55 (0.48–0.65)	-2.80	0.005**

To determine the role of miRNA in regulating NMDA receptor subunits, we first determine the effect on miR-19a and miR-539 in the male rat hippocampus to see the changes in the pattern of expression along the hippocampus development. Figure 2 illustrates that prenatal BPA exposure downregulates the expression of miR-19a and miR-539 along the development. As demonstrated in our result, the expression of miR19a is seen to be higher at the beginning of birth and decreases when reaching adolescence (Fig. 2a). On the contrary, the expression of miR-539 is shown to be low after birth and increases gradually when reaching adolescence (Fig. 2b).

Prenatal BPA exposure has shown an effect on miR-19a expression by an average 5-fold downregulation. The statistical analysis showed the expression of miR-19a was significantly lower than in control groups as early in the fetus stage; GD21 (Mdn = 0.54, p < 0.001), which is imprinted to postnatal age; PND7 (Mdn = 0.69, p < 0.001), PND14 (Mdn = 0.57, p < 0.001), PND21 (Mdn = 0.45, P < 0.001) until the adolescent age; AD35 (Mdn = 0.42) compared to control group (Mdn = 1).

Similarly, the expression of miR-539 is also revealed to be downregulated along the development by an average of 5-fold. At the fetus stage; GD21 (Mdn = 0.33, p < 0.01), postnatal age; PND7 (Mdn = 0.63, P < 0.01), PND14(Mdn = 0.65, P < 0.01), PND21 (Mdn = 0.51) until the adolescent age; AD35 (Mdn = 0.55, p < 0.01) compared to the control (Mdn = 1). Refer to Table 1. Hence, these novel findings were next used to predict the result of prenatal BPA exposure impacts on the related mRNA and protein expression of the NMDA receptor in the hippocampus.

2.2 Prenatal BPA exposure downregulate GRIN2A and GRIN2B expression in the hippocampus

Table 2

; The statistical analysis on the data for the expression of GRIN2A and GRIN2B in the male rat hippocampus at different stages of age.
Genes	Days	Groups	N	Mean (SD)	t (df)	Mean Difference	95% of CI	P Value
GRIN2A	GD21	Control	5	1.00 (0)	13.33 (8)	0.31	(0.26, 0.36)	< 0.001***
	GD21	5 mg/kg/day	5	0.69 (0.05)	13.33 (8)	0.31	(0.26, 0.36)	< 0.001***
	PND7	Control	5	1.00 (0)	7.25 (8)	0.35	(0.24, 0.46)	< 0.001***
	PND7	5 mg/kg/day	5	0.65 (0.11)	7.25 (8)	0.35	(0.24, 0.46)	< 0.001***
	PND14	Control	5	1.00 (0)	7.00 (8)	0.24	(0.16, 0.32)	< 0.001***
	PND14	5 mg/kg/day	5	0.76 (0.08)	7.00 (8)	0.24	(0.16, 0.32)	< 0.001***
	PND21	Control	5	1.00 (0)	5.81 (8)	0.21	(0.12, 0.29)	< 0.001***
	PND21	5 mg/kg/day	5	0.79 (0.08)	5.81 (8)	0.21	(0.12, 0.29)	< 0.001***
	AD35	Control	5	1.00 (0)	5.88 (8)	0.28	(0.17, 0.39)	< 0.001***
	AD35	5 mg/kg/day	5	0.72 (0.11)	5.88 (8)	0.28	(0.17, 0.39)	< 0.001***
GRIN2B	GD21	Control	5	1.00 (0)	13.99 (8)	0.29	(0.24, 0.34)	< 0.001***
	GD21	5 mg/kg/day	5	0.71 (0.05)	13.99 (8)	0.29	(0.24, 0.34)	< 0.001***
	PND7	Control	5	1.00 (0)	31.36 (8)	0.40	(0.37, 0.43)	< 0.001***
	PND7	5 mg/kg/day	5	0.60 (0.03)	31.36 (8)	0.40	(0.37, 0.43)	< 0.001***
	PND14	Control	5	1.00 (0)	13.73 (8)	0.37	(0.31, 0.43)	< 0.001***
	PND14	5 mg/kg/day	5	0.63 (0.06)	13.73 (8)	0.37	(0.31, 0.43)	< 0.001***
	PND21	Control	5	1.00 (0)	8.90 (8)	0.28	(0.21, 0.36)	< 0.001***
	PND21	5 mg/kg/day	5	0.72 (0.07)	8.90 (8)	0.28	(0.21, 0.36)	< 0.001***
	AD35	Control	5	1.00 (0)	11.53 (8)	0.34	(0.27, 0.41)	< 0.001***
	AD35	5 mg/kg/day	5	0.66 (0.07)	11.53 (8)	0.34	(0.27, 0.41)	< 0.001***

To predict the miRNAs and regulate NMDA, a study on the expression of GRIN2 genes was done to demonstrate their relationship. Our finding revealed that the expression of GRIN2A (Fig. 3a) and GRIN2B (Fig. 3b) in the hippocampus was significantly reduced by 5 to 7 folds in the BPA-treated groups compared to the control. However, both GRIN2 were shown to be higher in expression than miRNAs in all age stages, implying the gene silencing effect. Considering the pattern of expression along the development, GRIN2B was slightly higher than GRIN2A at the fetus stage and declined after birth. In comparison, GRIN2A was seen to be increased in expression when reaching adolescence than GRIN2B.

The expression of GRIN2A was notably downregulated in the BPA-treated group at GD 21 (0.69 (0.05), p < 0.001), PND7 (0.65 (0.11), P < 0.001), PND14 (0.76 (0.79), p < 0.001), PND21 (0.79 (0.08), p < 0.001) and AD35 (0.72 (0.11) p < 0.001) subsequently the similar effect on the expression of GRIN2B where the expression at GD21 (0.71 (0.05), p < 0.001), PND7 (0.60 (0.03), P < 0.001), PND14 (0.63 (0.06), p < 0.001), PND21(0.72 (0.07), p < 0.001) and AD35 (0.66 (0.07), p < 0.001) was significantly lower than the control group (1.00 (0)). Refer to Table 2. This data identified that the attenuation and fluctuations of GRIN2A and GRIN2B expression in the hippocampus from GD21 until AD35 appear to display the possibility of prenatal BPA exposure impact on the shifting expression at the post-transcriptional level.

2.3 Prenatal BPA exposure impacts on neurobehavior assessment at AD35

2.3.1 Open field test

Table 3

; The statistical analysis of the level of anxiety-related behavior in the rats during open field test
Parameter	Days	Groups	N	Mean (SD)	t (df)	Mean Difference	95% of CI	P Value
Total distance traveled	D1	Control	15	35.57 (10.21)	0.39 (28)	2.28	(-9.62, 14.17)	0.698
	D1	5 mg/kg/day	15	33.29 (20.04)	0.39 (28)	2.28	(-9.62, 14.17)	0.698
	D2	Control	15	25.83 (13.04)	-0.35 (28)	-1.94	(-13.24, 9.37)	0.728
	D2	5 mg/kg/day	15	27.76 (16.93)	-0.35 (28)	-1.94	(-13.24, 9.37)	0.728
	D3	Control	15	21.93 (12.54)	0.61 (28)	2.63	(-6.14, 11.41)	0.544
	D3	5 mg/kg/day	15	19.30 (10.86)	0.61 (28)	2.63	(-6.14, 11.41)	0.544
	D4	Control	15	16.45 (9.70)	-1.37 (28)	2.63	(-14.10, 2.78)	0.181
	D4	5 mg/kg/day	15	22.11 (12.68)	-1.37 (28)	2.63	(-14.10, 2.78)	0.181
	D5	Control	15	18.16 (9.65)	-0.05 (28)	-0.28	(-10.76, 10.20)	0.957
	D5	5 mg/kg/day	15	18.43 (17.31)	-0.05 (28)	-0.28	(-10.76, 10.20)	0.957
	D6	Control	15	16.18 (11.52)	-1.73 (28)	-9.79	(-21.36, 1.78)	0.094
	D6	5 mg/kg/day	15	25.97 (18.59)	-1.73 (28)	-9.79	(-21.36, 1.78)	0.094
Frequency of crossing center area	D1	Control	15	8.87 (5.44)	2.35 (28)	4.40	(0.57, 8.23)	0.026*
	D1	5 mg/kg/day	15	4.47 (4.78)	2.35 (28)	4.40	(0.57, 8.23)	0.026*
	D2	Control	15	7.20 (5.39)	2.15 (28)	3.67	(0.17, 7.16)	0.041*
	D2	5 mg/kg/day	15	3.53 (3.83)	2.15 (28)	3.67	(0.17, 7.16)	0.041*
	D3	Control	15	8.40 (5.41)	3.88 (28)	6.00	(2.84, 9.16)	< 0.001***
	D3	5 mg/kg/day	15	2.40 (2.56)	3.88 (28)	6.00	(2.84, 9.16)	< 0.001***
	D4	Control	15	7.20 (6.36)	2.82 (28)	4.93	(1.35, 8.52)	0.009**
	D4	5 mg/kg/day	15	2.27 (2.34)	2.82 (28)	4.93	(1.35, 8.52)	0.009**
	D5	Control	15	6.33 (3.90)	4.55 (28)	4.93	(2.71, 7.15)	< 0.001***
	D5	5 mg/kg/day	15	1.40 (1.55)	4.55 (28)	4.93	(2.71, 7.15)	< 0.001***
	D6	Control	15	6.67 (4.03)	1.96 (28)	2.80	(-0.12, 5.72)	0.060
	D6	5 mg/kg/day	15	3.87 (3.78)	1.96 (28)	2.80	(-0.12, 5.72)	0.060
Frequency of entering the peripheral area	D1	Control	15	18.20 (13.03)	0.41 (28)	1.87	(-7.37, 11.10)	0.682
	D1	5 mg/kg/day	15	16.33 (11.62)	0.41 (28)	1.87	(-7.37, 11.10)	0.682
	D2	Control	15	10.93 (8.72)	-0.79 (28)	-3.13	(-11.28, 5.01)	0.437
	D2	5 mg/kg/day	15	14.07 (12.69)	-0.79 (28)	-3.13	(-11.28, 5.01)	0.437
	D3	Control	15	7.73 (8.49)	-0.70 (28)	-1.80	(-7.10, 3.50)	0.492
	D3	5 mg/kg/day	15	9.53 (5.33)	-0.70 (28)	-1.80	(-7.10, 3.50)	0.492
	D4	Control	15	5.87 (7.19)	-1.31 (28)	-4.33	(-11.09, 2.42)	0.199
	D4	5 mg/kg/day	15	10.20 (10.55)	-1.31 (28)	-4.33	(-11.09, 2.42)	0.199
	D5	Control	15	6.47 (5.19)	-0.88 (28)	-3.13	(-10.43, 4.16)	0.387
	D5	5 mg/kg/day	15	9.60 (12.78)	-0.88 (28)	-3.13	(-10.43, 4.16)	0.387
	D6	Control	15	4.73 (3.83)	-2.55 (28)	-7.73	(-13.94, -1.52)	0.017*
	D6	5 mg/kg/day	15	12.47 (11.10)	-2.55 (28)	-7.73	(-13.94, -1.52)	0.017*
Frequency of grooming	D1	Control	15	3.20 (1.90)	-2.52 (28)	-1.87	(-3.38, -0.35)	0.018*
	D1	5 mg/kg/day	15	5.07 (2.15)	-2.52 (28)	-1.87	(-3.38, -0.35)	0.018*
	D2	Control	15	2.87 (1.85)	-2.25 (28)	-2.53	(-4.84, -0.22)	0.033*
	D2	5 mg/kg/day	15	5.40 (3.96)	-2.25 (28)	-2.53	(-4.84, -0.22)	0.033*
	D3	Control	15	3.33 (1.95)	-2.21 (28)	-2.53	(-4.89, -0.18)	0.036*
	D3	5 mg/kg/day	15	5.87 (4.00)	-2.21 (28)	-2.53	(-4.89, -0.18)	0.036*
	D4	Control	15	3.07 (1.98)	-3.37 (28)	-2.93	(-4.72, -1.15)	0.002**
	D4	5 mg/kg/day	15	6.00 (2.73)	-3.37 (28)	-2.93	(-4.72, -1.15)	0.002**
	D5	Control	15	2.73 (1.58)	-2.62 (28)	-1.93	(-3.44, -0.42)	0.014**
	D5	5 mg/kg/day	15	4.67 (2.38)	-2.62 (28)	-1.93	(-3.44, -0.42)	0.014**
	D6	Control	15	3.73 (2.31)	-1.96 (28)	-1.60	(-3.27, 0.07)	0.060*
	D6	5 mg/kg/day	15	5.33 (2.16)	-1.96 (28)	-1.60	(-3.27, 0.07)	0.060*
Frequency of rearing	D1	Control	15	25.73 (6.34)	0.87 (28)	3.47	(-4.72, 11.66)	0.393
	D1	5 mg/kg/day	15	22.27 (14.12)	0.87 (28)	3.47	(-4.72, 11.66)	0.393
	D2	Control	15	19.40 (7.32)	0.96 (28)	3.87	(-4.38,12.12)	0.345
	D2	5 mg/kg/day	15	15.53 (13.77)	0.96 (28)	3.87	(-4.38,12.12)	0.345
	D3	Control	15	14.20 (9.05)	0.93 (28)	2.80	(-3.35, 8.95)	0.359
	D3	5 mg/kg/day	15	11.40 (7.30)	0.93 (28)	2.80	(-3.35, 8.95)	0.359
	D4	Control	15	9.60 (6.33)	0.36 (28)	0.80	(-3.78, 5.38)	0.723
	D4	5 mg/kg/day	15	8.80 (5.89)	0.36 (28)	0.80	(-3.78, 5.38)	0.723
	D5	Control	15	11.53 (7.33)	0.29 (28)	0.73	(-4.38, 5.84)	0.771
	D5	5 mg/kg/day	15	10.80 (6.29)	0.29 (28)	0.73	(-4.38, 5.84)	0.771
	D6	Control	15	7.53 (5.40)	-2.45 (28)	-5.53	(-10.17, -0.90)	0.021*
	D6	5 mg/kg/day	15	13.07 (6.90)	-2.45 (28)	-5.53	(-10.17, -0.90)	0.021*
Frequency of fecal boli	D1	Control	15	1.07 (1.79)	-3.14 (28)	-2.67	(-4.41, -0.92)	0.004**
	D1	5 mg/kg/day	15	3.73 (2.76)	-3.14 (28)	-2.67	(-4.41, -0.92)	0.004**
	D2	Control	15	1.20 (1.82)	-1.42 (28)	-1.07	(-2.61, 0.48)	0.168
	D2	5 mg/kg/day	15	2.27 (2.28)	-1.42 (28)	-1.07	(-2.61, 0.48)	0.168
	D3	Control	15	0.60 (1.24)	-1.82 (28)	-0.93	(-1.98, 0.12)	0.080
	D3	5 mg/kg/day	15	1.53 (1.55)	-1.82 (28)	-0.93	(-1.98, 0.12)	0.080
	D4	Control	15	0.93 (1.39)	-1.86 (28)	-1.27	(-2.66, 0.13)	0.073
	D4	5 mg/kg/day	15	2.20 (2.24)	-1.86 (28)	-1.27	(-2.66, 0.13)	0.073
	D5	Control	15	0.40 (0.74)	-3.62 (28)	-1.67	(-2.61, -0.72)	0.001***
	D5	5 mg/kg/day	15	2.07 (1.62)	-3.62 (28)	-1.67	(-2.61, -0.72)	0.001***
	D6	Control	15	0.27 (0.46)	-3.83 (28)	-1.07	(-1.64, -0.50)	< 0.001***
	D6	5 mg/kg/day	15	1.33 (0.98)	-3.83 (28)	-1.07	(-1.64, -0.50)	< 0.001***

The emotionality of the rats was evaluated in the different parameters to provide a qualitative and quantitative measurement of the exploratory and locomotive activity in the open field arena. In our study, open-field data were first analyzed at AD35 (D1) until AD40 (D6). The analysis of significant value was done based on changes in the behavior of due to the prenatal BPA exposure (5 mg/kg/day versus control) on each test day. The evaluation of the total distance traveled showed that the locomotive activity of the control rats decreased gradually while BPA-treated rats increased towards the end of the days (average; control 21.42 m and BPA 21.59 m). However, there is no significant changes were observed (Fig. 4a). Other locomotive activities can be observed in the frequency of the crossing center (Fig. 4b) and peripheral area (Fig. 4c). BPA-treated rats showed more pronounced spending in the peripheral area (average; control 6.86 times and BPA 10.83 times) than center area (average; control 6.56 times and BPA 2.36 times) compared to control rats. A significant relationship was found between the groups in the attempt of the rats to cross the center area; D1 (control; 8.87 (5.44), BPA; 4.47 (4.78), p < 0.05), D2 (control; 7.20 (5.39), BPA; 3.53 (3.83), p < 0.05), D3 (control; 8.40 (5.41), BPA; 2.40 (2.56), p < 0.001), D4 (control; 7.20 (6.36), BPA; 2.27 (2.34), P < 0.01) and D5 (control; 6.33 (3.90), BPA; 1.40 (1.55), p < 0.001) while only at D6 (control; 4.73 (3.83), BPA; 12.47 (11.10), p < 0.05). In terms of measuring anxiety, rats that are traveling more and prefer staying close to the walls can be interpreted as a sign of anxiety-like behavior ²⁷. The locomotive activity of the rats was also presented in the track plot (Fig. 4g and 4h), recorded live during the test session.

To further support increased anxiety levels in BPA-treated rats, we examined the exploratory and emotional condition of the rats through the frequency of rearing, self-grooming, and fecal boli. The BPA-treated rats exhibit higher frequency in self-grooming (average; control 2.80 times and BPA 6.44 times) (Fig. 4e). Significant changes at were observed in the self-grooming activity on all days; D1 (control; 3.20 (1.90), BPA; 5.07 (2.15), p < 0.05), D2 (control; 2.87 (1.85), BPA; 5.40 (3.96), p < 0.05), D3 (control; 3.33 (1.95), BPA; 5.87 (4.00), p < 0.05), D4 (3.07 (1.98), BPA; 6.00 (2.73), p < 0.01) and D5 (control; 2.73 (1.58), BPA; 4.67 (2.38), p < 0.01). As shown in Fig. 4f, the BPA-treated rats also showed more frequent defecating than the control (average; control 1.14 times and BPA 2.33 times) at D1 (control; 1.07 (1.79), BPA; 3.73 (2.76), p < 0.01), D5 (control; 0.40 (0.74), BPA; 2.07 (1.62), p < 0.001) and D6 (control; 0.27 (0.46), BPA; 1.33 (0.98), p < 0.001). Other than that, the activity of rearing by BPA rats was shown to be decreased over days than to control groups (average; control 20.25 times and BPA 18 times) where at only at D6 (control; 7.53 (5.40), BPA; 13.07 (6.90), P < 0.05) showed the significance effect between the groups (Fig. 4d). Refer to Table 3.

2.3.2 Morris water maze test

Table 4

; The statistical analysis of the retention in spatial memory of the rats during Morris water maze test.
Test	Days	Groups	N	Mean (SD)	t (df)	Mean Difference	95% of CI	P Value
Morris Water Maze	D1	Control	15	52.93 (7.66)	-0.98 (28)	-2.51	(-7.75, 2.73)	0.335
	D1	5 mg/kg/day	15	55.44 (6.28)	-0.98 (28)	-2.51	(-7.75, 2.73)	0.335
	D2	Control	15	39.65 (11.64)	-1.03 (28)	-4.19	(-12.52, 4.15)	0.313
	D2	5 mg/kg/day	15	43.84 (10.63)	-1.03 (28)	-4.19	(-12.52, 4.15)	0.313
	D3	Control	15	27.19 (11.89)	-2.70 (28)	-11.95	(-20.96, -2.95)	0.011**
	D3	5 mg/kg/day	15	39.14 (12.19)	-2.70 (28)	-11.95	(-20.96, -2.95)	0.011**
	D4	Control	15	20.51 (9.75)	-2.23 (28)	-9.42	(-18.08, -0.76)	0.034*
	D4	5 mg/kg/day	15	29.93 (13.16)	-2.23 (28)	-9.42	(-18.08, -0.76)	0.034*
	D5	Control	15	16.88 (6.90)	-2.80 (28)	-9.56	(-16.57, -2.56)	0.009**
	D5	5 mg/kg/day	15	26.44 (11.31)	-2.80 (28)	-9.56	(-16.57, -2.56)	0.009**
	D6	Control	15	17.75 (5.15)	-3.22 (28)	-12.41	(-20.32, -4.51)	0.003**
	D6	5 mg/kg/day	15	30.16 (14.03)	-3.22 (28)	-12.41	(-20.32, -4.51)	0.003**

The memory retention ability can be observed in the 6 days of assessment. The impairment can be demonstrated in the rats that have longer latency to find the platform or to retrieve the spatial memory²⁸. What clearly can be seen in the findings is that control rats showed a steady decrement in latency to find the platform than BPA BPA-treated group during the assessment (average; control 26.98 s and BPA 41.07 s) (Fig. 5a). On the contrary, BPA-treated rats are found to be significantly slower to find the platform at D3 (control; 27.19 (11.89), BPA; 39.14 (12.19), p < 0.01) and slightly faster when during training D4 (control; 20.51 (9.75), BPA; 29.93 (13.16), p < 0.05) compared to control. From D5 (control; 16.88 (6.90), BPA; 26.44 (11.31), p < 0.01) to D6 (control; 17.75 (5.15), BPA; 30.16 (14.03), p < 0.01) a significant interaction was found where they took longer to reach the hidden platform at test D6 than control rats. Refer to Table 4. The track plot practically showed a comparable observation of the rat’s swimming direction in the pools to find the platform at the center area. BPA-treated rats (Fig. 5b) showed a progressive increment of average latency as they took a longer path to find the platform than control rats (Fig. 5c).

2.3.3 Step-Down Passive Avoidance Test

Table 5

; The statistical analysis of the retention in fear memory of the rats during step down passive avoidance test.
Test	Days	Groups	N	Mean (SD)	t (df)	Mean Difference	95% of CI	P Value
Step down passive avoidance test	D1	Control	15	31.60 (13.54)	3.40 (28)	16.93	(6.73, 27.14)	0.002**
	D1	5 mg/kg/day	15	14.67 (13.75)	3.40 (28)	16.93	(6.73, 27.14)	0.002**
	D2	Control	15	43.22 (13.11)	1.06 (28)	5.22	(-4.83, 5.26)	0.296
	D2	5 mg/kg/day	15	38.01 (13.74)	1.06 (28)	5.22	(-4.83, 5.26)	0.296
	D3	Control	15	54.95 (7.54)	1.76 (28)	5.96	(-0.99, 12.91)	0.090
	D3	5 mg/kg/day	15	48.99 (10.76)	1.76 (28)	5.96	(-0.99, 12.91)	0.090
	D4	Control	15	57.18 (6.42)	1.41 (28)	3.91	(-1.77, 9.58)	0.170
	D4	5 mg/kg/day	15	53.27 (8.59)	1.41 (28)	3.91	(-1.77, 9.58)	0.170
	D5	Control	15	55.13 (5.94)	1.42 (28)	6.07	(-2.68, 14.81)	0.166
	D5	5 mg/kg/day	15	49.06 (15.43)	1.42 (28)	6.07	(-2.68, 14.81)	0.166
	D6	Control	15	58.54 (2.70)	2.32 (28)	7.27	(0.86, 13.68)	0.028*
	D6	5 mg/kg/day	15	51.27 (11.81)	2.32 (28)	7.27	(0.86, 13.68)	0.028*

Following the spatial memory assessment, we conducted the fear-aggravated test to support the findings on retention ability after the learning events. In evaluating the passive avoidance memory, the impaired rats were expected to have a shorter time or latency to step down from the vibrating platform. Figure 6 displays BPA-treated rats' steady increment for the latency to step down from the platform from training until test days. The significant effect was only observed on the first day (control; 31.60 (13.54), BPA; 14.67 (13.75), p < 0.01) and last test day (control; 58.54 (2.70), BPA; 51.27 (11.81), p < 0.05). Refer to Table 5. as they have lower latency and error in retaining memory than control rats. The latency to step down from the platform was also higher in control rats during training days and remained steady when reaching test days (average; control 45.29 s and BPA 37.48 s). Together, although there is not much difference between the BPA-treated and control rats yet, they had shown a progressive effect in the ability to recall the fear memory.

2.4 Prenatal BPA exposure reduced the GluN2A and GluN2B protein levels in the hippocampus before and after neurobehavior assessment

Table 6

; The statistical analysis on the data for the level of GluN2A and GluN2B in the male rat hippocampus at different conditions.
NMDA Subunits	Days	Groups	N	Median (Q1-Q3)	U	Z	P Value
GluN2A	Before Neuro	Control	5	1 (1–1)	0	-2.46	0.014**
	Before Neuro	5 mg/kg/day	5	0.755 (0.68–0.82)	0	-2.46	0.014**
	After Neuro	Control	5	1 (1–1)	0	-2.46	0.014**
	After Neuro	5 mg/kg/day	5	0.573 (0.48–0.69)	0	-2.46	0.014**
GluN2B	Before Neuro	Control	5	1 (1–1)	0	-2.46	0.014**
	Before Neuro	5 mg/kg/day	5	0.957 (0.87 1.01)	0	-2.46	0.014**
	After Neuro	Control	5	1 (1–1)	4	-1.23	0.219
	After Neuro	5 mg/kg/day	5	0.821 (0.80–0.91)	4	-1.23	0.219

Considering the reduction of miRNA and mRNA expression and neurobehavior performance, we further examined the synaptic function of NMDA receptor subunit proteins by semi-quantitative western blot at the adolescent stage. The level of GluN2 was measured before (Figs. 7a and 7b) and after (Figs. 7c and 7d) neurobehavior test to see any possible changes of GluN2 expression in the cytoplasmic fraction, which may be affected by the prenatal BPA exposure. The result demonstrated that the level of GluN2A was significantly lower than the control before (Mdn = 0.76, p < 0.01) and after (Mdn = 0.573, p < 0.01) the neurobehavior test. The same outcome was also observed in the level of GluN2B where they were significantly lower before (Mdn = 0.96, p < 0.01) but not after the neurobehavior test. Refer to Table 6. Interestingly, a lower level of GluN2A (Figs. 7a and 7c) in BPA-treated rats was observed, which is lower in expression than the GluN2B level in both conditions.

In our study, we dived into the mutagenic potential of prenatal BPA exposure toward neurodevelopmental programming, specifically in learning and memory function. BPA is one of the best known as EDC, and its potency has been widely demonstrated to disrupt the metabolic system as early as genetic and epigenetic interactions ^29,30. Briefly, our experimental regime looks into the BPA actions towards modifying miRNA (miR-19a and miR-539) in the NMDA receptor subunits (GluN2A and GluN2B) in the hippocampus, which results in learning and memory impairment when reaching adolescent. This allowed us to investigate the toxicity effect of BPA on the non-coding element that regulates the attenuation of NMDA receptor subunits along the neurodevelopment.

The major findings of this study indicate that BPA exposure at 5 mg/kg/day can inhibit the expression of miR-19a and miR-539 in the male rat hippocampus. To the best of our knowledge, this is the first report on the impact of prenatal BPA exposure on miRNA-regulating NMDA receptor subunits in the male rat hippocampus. BPA exposure at 5 mg/kg/day was significantly found to inhibit both miR-19a and miR-539 expression at all age stages compared to the control. The experimental results showed that the expression of miR-19a was high at GD21-PND14 and declined when reaching PND21 and AD35. Concomitantly, the dynamic expression of miR-539 that was expected to be lowly expressed at the fetus stage and increased at AD35, interestingly, declined in expression when reaching PND21 to AD35. However, both miRNA’s expressions were shown to be significantly inhibited by the BPA prenatal exposure when compared to the control.

There is a relatively small body of literature concerned with the deterioration of targeted miRNAs in the hippocampal function due to BPA treatment, yet we compare the previous findings in other related impairments to associate with ours. Recent findings in the BPA-effect study indicate that several miRNAs, like miR-19a and miR-539, have been impaired in social interaction and learning and memory processes. They include dysregulation of miR-10b-3p, miR-10b-5p, miR-182-5p, miR-24-3p, miR-96-5p, miR-193a-3p, miR-183-5p, miR-125a-3p, miR-9 and miR-153 in the rodent’s hippocampus when exposed at 0.05, 0.5, 5 and 50 mg/kg/day of BPA ^31,32. To correlate prenatal BPA exposure with early life stress (ELS), Mazzelli et al. revealed that the ELS aberrantly caused miR-19 expression in the hippocampus and altered the pathway involved in neurodevelopment and immune response which can enhance the risk for mental disorders in later life ³³. Relatively, miR-19a is known as miR-19 family member ³⁴. Other related literature found that the disruption of miR-19 adult in the hippocampus can be seen to disrupt the neuronal cell migration in schizophrenia patients ³⁵. Besides, a recent study has shown that the dysregulation of miR-19a and miR-539 in Alzheimer’s disease patients has been associated with immediate impairment of verbal memory associated with Aβ accumulation ^36,37.

From here, we hypothesize that the outcome of miRNAs will negatively influence the shift expression of GRIN2A and GRIN2B along the development. In the present study, the transcription of GRIN2A was shown to be significantly disrupted in BPA treated group and GRIN2B compared to the control. At AD35, the transcription of GRIN2A and GRIN2B were revealed to be disrupted as their expression was supposed to be the highest and lowest, respectively. Their expression was seen to be downregulated after PND21. Indeed, these data have opened new speculation where prenatal BPA exposure was suspected of disrupting the regulation of miR-19a and miR-539 encoding GRIN2A and GRIN2B composition that can be especially seen in mature hippocampus.

Following the present result, data from several sources have identified that the decrement of GRIN2B and GRIN2A due to maternal BPA exposure was associated with cognitive impairment. Among the variants, intriguingly, GRIN2B is prone to be affected by prenatal BPA exposure, which is comparable with our earlier observation. Wu et al. and Alavian-Gavanini present that gestational BPA exposure (at 0.5, 50 µg/kg/day and 1, 10 µg/mL) downregulates the level of GRIN2B in the hippocampus, especially in male rats ^38,39. Likewise, Xu et al. also showed inhibition of GRIN2A and GRIN2B expression at exposure 0.05 to 200 mg/kg/day ⁴⁰. Overall, we defined our findings in heritable manners where prenatal BPA exposure was able to disrupt expression at miRNA and mRNA levels. The result further supports a notable association between miRNAs and the GRIN2 gene in the hippocampus, as the downregulation of miRNAs was shown to influence the transcription of GRIN2 genes in the male rat hippocampus along the development.

To prove that the modulation of miRNA and mRNA could affect brain function, we specifically analyzed the memory retention ability of the rats at the adolescent level (AD35). The present result was comparable with our previous finding, where prenatal BPA exposure at 5 mg/kg/day induced anxiety-related behavior and impaired learning and memory function ⁴¹. The open field test is considered to cause anxiety in animals due to social isolation and fear of the novel environment, and the outcome can be altered based on the lighting condition ^42,43. This supports the observation of the male rat’s behavior, which was dynamic across the early days of the test (D1-D4) in both groups. However, the rats were soon acclimatized to the environment and were noticed to reflect the effect of treatment steadily when reaching D5 to D6.

The evaluation of locomotor activity showed BPA exposed rats were seen to increase in total distances traveled and frequency of entry of the peripheral area but less frequent at the centre area. Concurrently, the exploratory activity of BPA-exposed rats exhibits a higher frequency in self-grooming and fecal boli but a low frequency of rearing compared to the control. Although open-field findings did not show a stronger relationship in anxiety-related behavior, still, BPA-treated rats demonstrated a difference in anxiety-related behavior compared to the control group. In the low light condition, it has been conclusively shown that anxiety rats from the prenatal BPA study enhanced in exploratory, which closed to the wall but avoided the center area ⁴¹. This behavior is thought to be its natural thigmotaxis to avoid predators ⁴⁴. Meanwhile, in the same condition the emotional or exploratory response of BPA-treated rats possessed an increment in the frequency of grooming and fecal boli but low in rearing activity ^16,41,45,46. Given all, the open field test is useful for studying this early life effect on anxiety, where it can be used as a part of behavioural profiling in different learning abilities ⁴².

In the learning phase, prenatal BPA exposure demonstrated impairment for the fear and spatial memory assessment. The step-down passive avoidance test showed lower latency to step down from the platform by the BPA-exposed rats. Nevertheless, along the training days until the test day, both groups were seen to be progressively increased in time to avoid the foot shock. However, BPA-exposed rats tend to have deficits in retaining memory and frequently receive foot shocks compared to the control. This indicates an impairment of fear-avoidance memory. In addition, our data from the Morris water maze showed BPA rats started to decrease in performance on training days 3 to 4 as they started to significantly have errors in retaining spatial memory from days 5 to 6. The failure of the BPA-exposed rat to find the hidden platform during the test day was suggested to have impairment in spatial memory.

A number of the studies reported that prenatal BPA exposure from low (0.004, 0.04, 0.4, 0.5 and 5 mg/kg/day) to high (50 mg/kg/day) dosages able to induce impairment in learning and memory function at the adult stage ^40,41,47. Reduced learning ability in step-down passive avoidance also can be shown in prenatal BPA exposure at 1,10, 5 and 50 mg/kg/day where the rats have difficulties staying on the platform ^40,41,48. While in a human study, BPA exposure during pregnancy period showed to cause aggressive behavior syndrome, attention problems, anxiety/depression, and poor language skills ^9,12,49.

The data support the idea that deficits of memory and learning exist in BPA-exposed groups in which BPA impaired the rate of acquisition in the fear-avoidance and spatial learning task in male offspring. Notably, the ability of targeted miRNAs to regulate mRNA to differentiate at appropriate rates is critical for normal hippocampal function ⁵⁰. Hence, we conclude that these findings suggest that BPA-mediated neurocognitive deficits through the downregulation of NMDA receptor genes in the hippocampus next contribute to the impairment in learning and memory function when reaching adolescence.

The ability to learn and retract memory has been proposed to involve activating GluN2A and GluN2B containing NMDA receptors ^51,52. The GluN2A and GluN2B translation along the neurodevelopment is encoded by GRIN2A and GRIN2B, respectively, with both having a distinct function in memory management ²⁴. Upon the findings, we observed that prenatal BPA exposure at 5 mg/kg/day induced impairment in the learning and memory of the rat. We speculate that the outcome is also related to regulating GluN2A and GluN2B in the hippocampus. In addition, our previous report has shown that the GluN2A and GluN2B protein levels in the postsynaptic membrane were decreased in the BPA-exposed AD35 rat’s hippocampus ⁴¹. Further, this study will observe the prenatal BPA effect on the activity of the GluN2A and GluN2B at a cytoplasmic level in AD35 rat hippocampus only. This was done to investigate any changes in the GluN2A and GluN2B activity before and after neurobehavior assessment.

The findings showed that both GluN2A and GluN2B levels are decreased in the BPA-exposed rat hippocampus at both conditions compared to the control. Interestingly, GluN2A showed significantly lower expression than GluN2B before and after neurobehavior activity. Contrary to the expectation, we first postulate the inconsistency with the mRNA-protein correlations in response to the environmental perturbation. According to Koussounadis et al., when the environment triggers a transcription difference, it is most likely that the same environment will trigger less regulation at the translational level (protein degradation) compares to the genes that are not disturbed by this condition ⁵³. Briefly, BPA has shown its ability as an environmental pollutant that significantly decreases the level of miRNA and regulates mRNA transcription in the hippocampus. This data speculates that BPA exposure during early life is capable of dysregulating the correlation of miRNA-mRNA-protein expression and thus impairing the rat’s cognitive function.

Secondly, despite their shifting expression at the young and mature synapses, however, both NMDA receptor subunits can also be found in the mature synapses. It is well established that the synaptic NMDA receptor is predominantly built with GluN1-GluN2A or tri-heteromeric of GluN1-GluN2A-GluN2B ⁵⁴. At a mature synapse, GluN2A is known to be richer at the synaptic membrane, while GluN2B is at the synaptic and extra synaptic membrane ⁵⁵. Their ratio in the hippocampus was reported to be higher after the plasticity induction or memory acquisition, which is known as activity-dependent modification ^18,56,57. Previous reports indicate that GluN2B is temporarily favored over GluN2A during memory management, and we assumed that the high level of GluN2B in the cytoplasmic hippocampal is due to the activity of NMDA trafficking where because of this, GluN2B will display a higher rate of endocytosis than GluN2A in mature neurons ^57,58. Hence, we proposed that due to the presence of GluN2B and GluN2A even at a low level, our BPA-exposed rats possibly can perform the neurobehavioral assessment but more slowly than control rats, which represents the impairment.

Other than that, we suggest that the BPA-treated rats have lower strength of NMDA receptor-mediated plasticity compared to the control, especially for GluN2A. GluN2A and GluN2B together engage distinct roles during the plasticity mechanism. GluN2A has a higher channel open probability, which is actively involved during LTP in plasticity signaling ⁵⁹. In contrast, GluN2B is more towards long-term depression (LTD) regulation to induce neuronal pattern formation, synaptic plasticity and memory consolidation ^60,61. Reduction of GluN2A demonstrated to be impaired in spatial learning, epilepsy, and sleep deprivation ^15,62,63. Relatively, the reduction of the C-terminal domains (CTD) at GluN2, such as the CaMKII/NMDA receptor complex, might contribute to such conditions as reported in the previous BPA studies ^64,65. Therefore, we suggest further study needs to be conducted on the neuroprotein of the CTD bind to the NMDA receptor subunits. This might support our understanding of the effect of prenatal BPA exposure at 5mg/kg/day in the cytoplasmic GluN2 protein during the learning and memory process.

Overall, the findings suggest that prenatal BPA exposure at 5 mg/kg/day induced learning and memory impairment by altering the expression of miR-19a and miR-539 regulating GRIN2A and GRIN2B. The subunit composition of the NMDA receptor also was observed to be dynamically altered following the plasticity impairment (Fig. 8). This will provide a new insight into understanding how the occurrence of the BPA influences epigenetic changes and next influences the NMDA receptors subunits composition, which ultimately leads to the impairment in learning and memory function. In a future view, with further experimental investigation, this finding can provide a therapeutic approach to diagnosing children with cognitive impairment at an earlier stage of age.

5.1 Animal Care and Dosing

The animal procedure was approved by the Universiti Teknologi MARA Committee on Animal Research and Ethics (UiTM CARE) with the ethical number; UITM CARE: 351/2021. All experiments on animals were done in accordance with approved proposal by UiTM CARE. Total 56 adult White Sprague Dawley rats at age 7 to 8 weeks and body weight between 200 to 250 g (28 females and 28 males) were purchased from A Sapphire Enterprise, Seri Kembangan, Selangor. Upon the arrival, basic health checkup was done on each animal and the rats were quarantine for one week in the quarantine room at laboratory animal care unit (LACU), UiTM. After 1 week, they were transferred into breeding room and maintained in a controlled environment (temperature 22 ̊C and 12:12 hour light/dark cycle) and supplied with free excess food and water. The study was carried out in compliance with the ARRIVE guidelines.

Before mating, the female rats were examined for the estrous cycling stages by using vaginal smear method. The male and female were mated overnight if the test demonstrate proestrus stage. They were caged together with free excess food and water. After overnight mating, a vaginal smear test was done on the female rats to spot the presence of sperm. The female with sperm-positive vaginal smear was accepted as pregnancy day 0, where they were individually housed in different dams. The mother was orally dosed with BPA at 5 mg/kg/day with Tween 80 as a vehicle in RO water. The controlled mother consumed the same except without BPA. The oral exposure was done to mimic the predominant source of BPA exposure. Besides that, the environmental exposure to BPA was minimized using a polypropylene cage and glass water bottle. The duration of exposure was done starting pregnancy day 1 (PD1) until gestation day 21 (GD21). The BPA dose was chosen based on the NOAEL to examine the safety of BPA exposure for foetal effects on the neurological system.

5.2 Sample Collection

The male fetuses/pups were divided into five different ages to observe the persistent impact of prenatal BPA exposure on the expression of microRNA affecting NMDA receptor subunits level at stages of development at a different timeline. This effect was hypothesized to influence learning and memory function when reaching adolescence. It is noted that all the offspring’s hippocampus tissue in each group was collected from different mothers.

a) Gestation Day 21 (GD21)

The cesarean section was done on the mother (N = 6 per group) during pregnancy day 21 or before birth. The incision cut was done through the abdomen and live fetuses were removed from the uterus and separated based on gender. The hippocampus of the male (n = 3; 3 hippocampi = 1) fetuses was harvested and pooled, and kept at -80°C until used.

b) Postnatal Day 7, 14 and 21 (PND7, 14 and 21)

The remaining mothers (N = 6 per group) were monitored daily until spontaneous delivery. The male pups were raised until they reached 7, 14 and 21 days. Then, the hippocampus of male pups was harvested and kept at – 80°C until used.

c) Adolescent Day 35 (AD35)

The males were divided into two groups which were with neurobehavior and without neurobehavior assessment. The grouping was created to investigate if there is any significant change in the expression of NMDA receptor subunits before and after the learning assessment. At 35 days, the male pups (N = 4 per group) without the neurobehavior group were sacrificed and the hippocampus was collected. The males with neurobehavior (N = 4 per group) were sacrificed after six days of neurobehavioral assessment. All the hippocampus was harvested and kept at -80°C until used.

5.3 RT-PCR: To determine the changes in miRNA and NMDA receptor subunits gene expression along the development.

2.3.1 The Expression of miR-19a and miR-539

The total miRNA from 5mg of hippocampal tissue was isolated by using miRNeasy Micro kits (Qiagen, Germany) by following its manufacturer’s instructions. The quality and quantity of the pure miRNA were determined by using a Quickdrop UV-Vis Spectrophotometer. Next, the miRNA sample was standardized to 5 ng/µl for cDNA synthesis. The miRCURY LNA RT kit (Qiagen, Netherlands) transcribes the cDNA following the manufacturer’s instructions. The primer design of the miRNA sequence was prepared and validated by GeneGlobe (Qiagen, Netherlands) for optimal performance (Table 7). Real-time PCR was performed using miRCURY LNA miRNA SYBR Green PCR kit from Qiagen, Netherlands. All the targeted miRNA (miR-19a and miR-539) and housekeeping genes (RNU5G and U6) were run in triplicate in 40 cycles. The relative miRNA expression was analyzed based on the 2-∆∆Ct method.

Table 7

; The list of targeted miRNA and its accession number for primer designed.
Gene Symbol	GeneGlobe/NCBI Accession Number	Annealing temperature (°C)
rno-miR-19a-5p	MIMAT0017098	56
rno-miR-539-3p	MIMAT0017212	56
RNU5G	NR_002852.3	56
U6 snRNA	NR_004394	56

5.3.2 The Expression of GRIN2A and GRIN2B

The level of GRIN2A and GRIN2B was done to investigate the function of miRNA in modulating its targeted mRNA expression. Total RNA from 30mg of the hippocampal tissue was extracted using a GeneJET RNA Purification kit (Thermo Scientific, USA) following its manufacturer’s instruction. The pure RNA's quality and quantity were determined using a Quickdrop UV-Vis Spectrophotometer. cDNA synthesis of RNA was performed by using a Maxima First Strand cDNA Synthesis kit (Thermo Scientific, USA). The design of the primer was prepared by Integrated DNA Technologies (USA) based on software tools; Primer Bank (NCBI) and NetPrimer (Premier Biosoft, USA). Refer to Table 8.The real-time PCR was performed using the Maxima SYBR Green qPCR Master Mix (2x) kit (Thermo Scientific, USA). All the targeted RNA (GRIN2A and GRIN2B) and housekeeping genes (Gapdh and B Actin) were run in triplicate in 40 cycles. The relative RNA expression was analyzed based on the 2-∆∆Ct method.

Table 8

; List of primers for the targeted RNA and its housekeeping genes.
Gene Symbol	Sequence	Annealing temperature (°C)
GRIN2A_F	GGGCTGCTCTTCTCCATCAGC	61.2
GRIN2A_R	CCCTTGTCTGAAACCATGTCCAC	61.2
GRIN2B-F	TGGCCCTCAGCCTCATCACC	60
GRIN2B_R	CATCACGGATTGGCGCTCCT	60
Gapdh_F	GGGCATCCTGGGCTACACTGA	58
Gapdh_R	CCTTGCTGGGCTGGGTGGT	58
Actb_F	CATTGCTGACAGGATGCAGAAGG	60
Actb_R	TGCTGGAAGGTGGACAGTGAGG	60

5.4 Western Blot: The Level of GluN2A and GluN2B protein

Total protein from 20 mg of hippocampal tissue was lysed by using an NE-PER Nuclear and Cytoplasmic Extraction kit (Thermo Scientific, USA). The Bradford protein assay kit (Thermo Scientific, USA) was used to quantify the total cytoplasmic protein yield from the extraction. Before gel electrophoresis, an equal amount of cytoplasmic protein (15 µg/ml) was denatured at 90°C for 5 minutes in 2x leammli buffer (Merck, Germany). The protein was electrophoresed on 7 to 10% SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was then blocked using 3% non-fat dry milk in 1X Tris-buffered saline and 0.1% Tween 20. The detection of targeted protein on the membrane was done by incubating overnight at 4°C with primary antibody (polyclonal) against GluN2A (Abcam; ab169873; 1:1000), GluN2B (Abcam; ab65783; 1:2000) and B Actin (monoclonal) (Abcam: AB115777; 1:5000). The membrane was then incubated with secondary IgG H&L (HRP) antibody to bind with its primary antigen (Abcam; AB97051; 1:5000). Prior to the detection, the membrane was incubated in high sensitive chemiluminescence substrate to (Abcam, UK) to amplify the signal. The image of the protein band was acquired and analyzed using MYImageAnalysis software 2.0 (Thermo Scientific, USA).

5.5 Neurobehaviour Tests

5.5.1 Open Field Test; Evaluation of Anxiety-Related Behaviour

At adolescent day 35 (AD35), the male rats were subjected to an open field test to evaluate exploratory and anxiety-related behavior in animals ⁶⁶. The open field apparatus was a square arena of 100 cm (L) x 70 cm (H) x 100 cm (W) with the installed camera above. The test was conducted for 10 minutes under dim light. Each male rat was tested on the open field once daily for six consecutive days. The behavior of the male rats was analyzed by total distance traveled, number of crossings of the center area, number of entries into the peripheral area, freezing episodes, number of grooming and number of fecal boli. All sessions were automatically recorded by ANY-Maze software (Stoelting Co.). The field was wiped with 75% ethanol before each test to prevent transmission of olfactory cues.

5.5.2 Step Down Passive Avoidance Test; Evaluation of Aversive Memory

A passive avoidance test evaluates the animals' learning and memory according to the conditioning stimulus, as the rats were trained to avoid the aversive stimulus in the test ⁶⁷. The memory retention test was conducted in a cage with an elevated platform (Ugo Basile) for six consecutive days. The training (D1 to D5) and test (D6) were conducted for 60 seconds with four trials. After the habituation period (1 minute), the male rats were placed individually on an elevated platform. The platform was set to vibrate at 60 Hz and the floor with steel bar was set with mild electric shock (0.4 mA). The response to foot shock was recorded by measuring the time the rat took to step down from the vibrating platform within 60 seconds.

5.5.3 Morris Water Maze Test; Evaluation of Spatial Memory

Morris water maze test is designed to study the animals' spatial memory, where they will be trained to locate the hidden platform based on their pre-training memory. The test was conducted in a circular tank filled with water with a 150 cm diameter and 60 cm height with a camera installed above. The rats were given 60 seconds to find the platform with 4 trials based on 4 quadrants. Each male rat was trained to find the platform at the center area of the pool in clear water for five days. After five days of training, the rats were individually tested to find the platform in opaque water (colored by non-toxic paint). The time taken for the rats to find the hidden platform within 60 seconds was automatically recorded by ANY-Maze software (Stoelting Co.).

5.6 Statistical Analysis

All data were represented as means ± S.E.M (standard error of mean). The data were tested Shapiro-Wilk test to assess the normality of the data. Based on the analysis, the data that passed the normality and the assumption was next analyzed in an independent T-test to compare the means between the two groups (RT PCR of GRIN2, neurobehavioral tests). The data that did not meet the assumption was analyzed in the Mann Whitney test to compare to the median between two groups (RT-PCR of miRNA and western blot). The two tailed p value at p < 0.05 was considered to be statistically significant. The statistical analysis was performed by using IBM SPSS Version 28 and the graphs was illustrate by using GraphPad Prism Version 8.

Availability of Data and Materials

The data that were analyzed or generated in this study are available from the corresponding author on reasonable request.

Acknowledgement

We are grateful and would like to thank Institute for Medical Molecular and Biotechnology (IMMB), Laboratory Animal Care Unit (LACU) and Centre for Neuroscience Research (NueRon) at Faculty of Medicine, UiTM for providing facilities to carry out this research work.

Funding

This paper is receiving fundings from Fundamental Research Grant Scheme (FRGS/1/2018/SKK08/UITM/02/9) by the Ministry of Higher Education, Malaysia and .Geran Insentif Penyeliaan (600-RMC/GPK 5/3 (191/2020)) by Universiti Teknologi MARA, Malaysia

Author’s Contribution

Norazirah Mat Nayan; Literature research, the conceptualisation of the paper, manuscript preparation and manuscript editing. Rosfaiizah Siran; Manuscript conceptualization, editing and review. Dr Siti Hamimah, Dr Andrean Husin and Dr Nur Faizah Ali; Manuscript editing and review.

Ethics Declaration

Ethics Approval:

Prior the study, all procedures of animal handling were approved by the Committee on Animal Research and Ethics (UiTM CARE) in Universiti Teknologi MARA, Malaysia under approval number: UiTM CARE: 351/2021 (3th September 2021).

Competing of Interest:

The authors declare that they have no competing of interest.

Manzan-Martins, C. & Paulesu, L. Impact of bisphenol A (BPA) on cells and tissues at the human materno-fetal interface. Tissue Cell 73, (2021).
Manzoor, M. F. et al. An insight into bisphenol A, food exposure and its adverse effects on health: A review. Frontiers in Nutrition vol. 9 Preprint at https://doi.org/10.3389/fnut.2022.1047827 (2022).
Takao, Y., Lee, H. C., Kohra, S. & Arizono, K. Release of Bisphenol A from Food Can Lining upon Heating. Journal of Health Science vol. 48 (2002).
Cimmino, I. et al. Potential mechanisms of bisphenol a (BPA) contributing to human disease. International Journal of Molecular Sciences vol. 21 1–22 Preprint at https://doi.org/10.3390/ijms21165761 (2020).
Bernier, M. R. & Vandenberg, L. N. Handling of thermal paper: Implications for dermal exposure to bisphenol A and its alternatives. PLoS One 12, (2017).
Yun, W. M., Ho, Y. Bin, Sin, E., Tan, S. & How, V. Release of Bisphenol A From Polycarbonate and Polyethylene Terephthalate Drinking Water Bottles Under Different Storage Conditions and Its Associated Health Risk. Malaysian Journal of Medicine and Health Sciences vol. 14 (2018).
Hengstler, J. G. et al. Critical evaluation of key evidence on the human health hazards of exposure to bisphenol A. Critical Reviews in Toxicology vol. 41 263–291 Preprint at https://doi.org/10.3109/10408444.2011.558487 (2011).
Zhou, Z. et al. Association between prenatal exposure to bisphenol a and birth outcomes: A systematic review with meta-analysis. Medicine 98, e17672 (2019).
Jensen, T. K. et al. Prenatal bisphenol A exposure is associated with language development but not with ADHD-related behavior in toddlers from the Odense Child Cohort. Environ Res 170, 398–405 (2019).
Lin, C. C. et al. Prenatal phenolic compounds exposure and neurobehavioral development at 2 and 7 years of age. Science of the Total Environment 605–606, 801–810 (2017).
Pan, R. et al. Prenatal Bisphenol A exposure and early childhood neurodevelopment in Shandong, China. Int J Hyg Environ Health 222, 896–902 (2019).
Perera, F. et al. Prenatal bisphenol a exposure and child behavior in an innerity cohort. Environ Health Perspect 120, 1190–1194 (2012).
Karmakar, P. C. et al. Paternal exposure to bisphenol-a transgenerationally impairs testis morphology, germ cell associations, and stemness properties of mouse spermatogonial stem cells. Int J Mol Sci 21, 1–16 (2020).
Wang, C. et al. Changes in memory and synaptic plasticity induced in male rats after maternal exposure to bisphenol A. Toxicology 322, 51–60 (2014).
Zhang, W. et al. Knockdown of astrocytic Grin2a exacerbated sleep deprivation-induced cognitive impairments and elevation of amyloid-beta. Sleep Med 100, 280–290 (2022).
Xu, X. et al. Sex-specific effects of long-term exposure to bisphenol-A on anxiety- and depression-like behaviors in adult mice. Chemosphere 120, 258–266 (2015).
Nishikawa, M. et al. Placental transfer of conjugated bisphenol A and subsequent reactivation in the rat fetus. Environ Health Perspect 118, 1196–1203 (2010).
Sun, Y. et al. The differences between GluN2A and GluN2B signaling in the brain. Journal of Neuroscience Research vol. 96 1430–1443 Preprint at https://doi.org/10.1002/jnr.24251 (2018).
Sonavane, M. & Gassman, N. R. Bisphenol A co-exposure effects: a key factor in understanding BPA’s complex mechanism and health outcomes. Critical Reviews in Toxicology vol. 49 371–386 Preprint at https://doi.org/10.1080/10408444.2019.1621263 (2019).
Ramírez, V. et al. Role of endocrine disrupting chemicals in children’s neurodevelopment. Environ Res 203, (2022).
Tierney, A. L. & Nelson III, C. A. Brain Development and the Role of Experience in the Early Years. (2009).
Tran, N. Q. V. & Miyake, K. Neurodevelopmental Disorders and Environmental Toxicants: Epigenetics as an Underlying Mechanism. International Journal of Genomics vol. 2017 Preprint at https://doi.org/10.1155/2017/7526592 (2017).
Franchini, L. et al. Linking NMDA Receptor Synaptic Retention to Synaptic Plasticity and Cognition. iScience 19, 927–939 (2019).
Corbel, C., Hernandez, I., Wu, B. & Kosik, K. S. Developmental attenuation of N-methyl-D-aspartate receptor subunit expression by microRNAs. Neural Dev 10, (2015).
Baez, M. V., Cercato, M. C. & Jerusalinsky, D. A. NMDA receptor subunits change after synaptic plasticity induction and learning and memory acquisition. Neural Plasticity vol. 2018 Preprint at https://doi.org/10.1155/2018/5093048 (2018).
Valvassori, S. S., Varela, R. B. & Quevedo, J. Chapter 38 - Animal Models of Mood Disorders: Focus on Bipolar Disorder and Depression. (2017) doi:10.1016/B978-0-12-809468-6/00038-3.
Kraeuter, A. K., Guest, P. C. & Sarnyai, Z. The Open Field Test for Measuring Locomotor Activity and Anxiety-Like Behavior. in Methods in Molecular Biology vol. 1916 99–103 (Humana Press Inc., 2019).
Vorhees, C. v. & Williams, M. T. Assessing spatial learning and memory in rodents. ILAR J 55, 310–332 (2014).
Welch, C. & Mulligan, K. Does Bisphenol A Confer Risk of Neurodevelopmental Disorders? What We Have Learned from Developmental Neurotoxicity Studies in Animal Models. International Journal of Molecular Sciences vol. 23 Preprint at https://doi.org/10.3390/ijms23052894 (2022).
Feroe, A., Broene, R., Albuquerque, D. & Ruiz, P. Endocrine Disrupting Chemicals, Transgenerational Epigenetics and Metabolic Diseases. (2017).
Luo, M. et al. Long-term potentiation and depression regulatory microRNAs were highlighted in Bisphenol A induced learning and memory impairment by microRNA sequencing and bioinformatics analysis. PLoS One 18, (2023).
Butler, M. C. et al. Endocrine disruption of gene expression and microRNA profiles in hippocampus and hypothalamus of California mice: Association of gene expression changes with behavioural outcomes. J Neuroendocrinol 32, (2020).
Mazzelli, M. et al. The Long-Term Effects of Early Life Stress on the Modulation of miR-19 Levels. Front Psychiatry 11, (2020).
Li, X. et al. miR-19 family: A promising biomarker and therapeutic target in heart, vessels and neurons. Life Sciences vol. 232 Preprint at https://doi.org/10.1016/j.lfs.2019.116651 (2019).
Han, J. & Gage, F. H. A role for miR-19 in the migration of adult-born neurons and schizophrenia. 3, (2016).
van der Auwera, S. et al. The interplay between micro RNAs and genetic liability to Alzheimer‘s Disease on memory trajectories in the general population. Psychiatry Res 115141 (2023) doi:10.1016/j.psychres.2023.115141.
Jiang, Y., Zhang, Y. & Su, L. MiR-539-5p Decreases amyloid β-protein production, hyperphosphorylation of Tau and Memory Impairment by Regulating PI3K/Akt/GSK-3β Pathways in APP/PS1 Double Transgenic Mice. Neurotox Res 38, 524–535 (2020).
Wu, D. et al. Impairment of learning and memory induced by perinatal exposure to BPA is associated with ERα-mediated alterations of synaptic plasticity and PKC/ERK/CREB signaling pathway in offspring rats. Brain Res Bull 161, 43–54 (2020).
Alavian-Ghavanini, A. et al. Prenatal Bisphenol A Exposure is Linked to Epigenetic Changes in Glutamate Receptor Subunit Gene Grin2b in Female Rats and Humans. Sci Rep 8, (2018).
Xu, X. hong, Zhang, J., Wang, Y. min, Ye, Y. ping & Luo, Q. qing. Perinatal exposure to bisphenol-A impairs learning-memory by concomitant down-regulation of N-methyl-d-aspartate receptors of hippocampus in male offspring mice. Horm Behav 58, 326–333 (2010).
Nayan, N. M. et al. Prenatal bisphenol A exposure impairs the aversive and spatial memory reduces the level of NMDA receptor subunits in the hippocampus of male Sprague Dawley rats. Brain Science Advances 8, 57–69 (2022).
Nordquist, R. E., Meijer, E., van der Staay, F. J. & Arndt, S. S. Chapter 39 - Pigs as Model Species to Investigate Effects of Early Life Events on Later Behavioral and Neurological Functions. Animal Models for the Study of Human Disease (2017) doi:10.1016/B978-0-12-809468-6/00039-5.
Kimberly R. Lezak, Missig Galen & Carlezon Jr, W. A. Behavioural Methods to Study Anxiety in Rodents. Dialogues in Clinical Neuroscience 19, 181–191 (2017).
Lamprea, M. R., Cardenas, F. P., Setem, J. & Morato, S. Thigmotactic responses in an open-field. Brazilian Journal of Medical and Biological Research vol. 41 www.bjournal.com.br (2008).
Seibenhener, M. L. & Wooten, M. C. Use of the open field maze to measure locomotor and anxiety-like behavior in mice. Journal of Visualized Experiments (2015) doi:10.3791/52434.
Xu, X. et al. Perinatal exposure to bisphenol-A inhibits synaptogenesis and affects the synaptic morphological development in offspring male mice. Chemosphere 91, 1073–1081 (2013).
Wang, C. et al. Maternal exposure to low doses of bisphenol A affects learning and memory in male rat offspring with abnormal N-methyl-d-aspartate receptors in the hippocampus. Toxicol Ind Health 37, 303–313 (2021).
Jang, Y. J. et al. High dose bisphenol A impairs hippocampal neurogenesis in female mice across generations. Toxicology 296, 73–82 (2012).
Hong, S. B. et al. Bisphenol A in relation to behavior and learning of school-age children. J Child Psychol Psychiatry 54, 890–899 (2013).
Tan, Z., Li, W., Cheng, X., Zhu, Q. & Zhang, X. Non-Coding RNAs in the Regulation of Hippocampal Neurogenesis and Potential Treatment Targets for Related Disorders. Biomolecules 13, 18 (2022).
Sanders, E. M. et al. Separate functional properties of NMDARs regulate distinct aspects of spatial cognition. Learning and Memory 25, 264–272 (2018).
Yashiro, K. & Philpot, B. D. Regulation of NMDA receptor subunit expression and its implications for LTD, LTP, and metaplasticity. Neuropharmacology vol. 55 1081–1094 Preprint at https://doi.org/10.1016/j.neuropharm.2008.07.046 (2008).
Koussounadis, A., Langdon, S. P., Um, I. H., Harrison, D. J. & Smith, V. A. Relationship between differentially expressed mRNA and mRNA-protein correlations in a xenograft model system. Sci Rep 5, (2015).
Carta, M., Srikumar, B. N., Gorlewicz, A., Rebola, N. & Mulle, C. Activity-dependent control of NMDA receptor subunit composition at hippocampal mossy fibre synapses. Journal of Physiology 596, 703–716 (2018).
Zhou, X., Ding, Q., Chen, Z., Yun, H. & Wang, H. Involvement of the GluN2A and GluN2B subunits in synaptic and extrasynaptic N-methyl-D-aspartate receptor function and neuronal excitotoxicity. Journal of Biological Chemistry 288, 24151–24159 (2013).
Carta, M., Srikumar, B. N., Gorlewicz, A., Rebola, N. & Mulle, C. Activity-dependent control of NMDA receptor subunit composition at hippocampal mossy fibre synapses. Journal of Physiology 596, 703–716 (2018).
Yashiro, K. & Philpot, B. D. Regulation of NMDA receptor subunit expression and its implications for LTD, LTP, and metaplasticity. Neuropharmacology vol. 55 1081–1094 Preprint at https://doi.org/10.1016/j.neuropharm.2008.07.046 (2008).
Vieira, M., Yong, X. L. H., Roche, K. W. & Anggono, V. Regulation of NMDA glutamate receptor functions by the GluN2 subunits. Journal of Neurochemistry vol. 154 121–143 Preprint at https://doi.org/10.1111/jnc.14970 (2020).
Franchini, L., Carrano, N., Di Luca, M. & Gardoni, F. Synaptic gluN2A-containing NMDA receptors: From physiology to pathological synaptic plasticity. Int J Mol Sci 21, (2020).
Ballesteros, J. J., Buschler, A., Köhr, G. & Manahan-Vaughan, D. Afferent Input Selects NMDA Receptor Subtype to Determine the Persistency of Hippocampal LTP in Freely Behaving Mice. Front Synaptic Neurosci 8, (2016).
Zhang, X. M. & Luo, J. H. GluN2A versus GluN2B: Twins, but quite different. Neurosci Bull 29, 761–772 (2013).
Elmasri, M. et al. Common synaptic phenotypes arising from diverse mutations in the human NMDA receptor subunit GluN2A. Commun Biol 5, (2022).
Mota Vieira, M. et al. An Epilepsy-Associated GRIN2A Rare Variant Disrupts CaMKIIα Phosphorylation of GluN2A and NMDA Receptor Trafficking. Cell Rep 32, (2020).
Bi, N. et al. Developmental exposure of bisphenol A induces spatial memory deficits by weakening the excitatory neural circuits of CA3-CA1 and EC-CA1 in mice. Toxicol Appl Pharmacol 426, (2021).
Viberg, H. & Lee, I. A single exposure to bisphenol A alters the levels of important neuroproteins in adult male and female mice. Neurotoxicology 33, 1390–1395 (2012).
Vuralli, D., Wattiez, A. S., Russo, A. F. & Bolay, H. Behavioral and cognitive animal models in headache research Cenk Ayata. Journal of Headache and Pain vol. 20 Preprint at https://doi.org/10.1186/s10194-019-0963-6 (2019).
Jamwal, S., Singh, S. & Bansal, P. K. Behavioral tests for rodent models. in Animal Models of Neurological Disorders: Principle and Working Procedure for Animal Models of Neurological Disorders 315–341 (Springer Singapore, 2018). doi:10.1007/978-981-10-5981-0_21.

No competing interests reported.

SupplementaryFigure7revised.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

Neurodevelopmental Effects of Prenatal Bisphenol A Exposure on the Role of MicroRNA Regulating NMDA Receptor Subunits in the Rat Hippocampus

Status:

Version 1

Abstract

Figures

1. Background of Study

2. Results

2.1 Prenatal BPA exposure downregulate miR-19a and miR-539 expression in the hippocampus

2.2 Prenatal BPA exposure downregulate GRIN2A and GRIN2B expression in the hippocampus

2.3 Prenatal BPA exposure impacts on neurobehavior assessment at AD35

2.3.1 Open field test

2.3.2 Morris water maze test

2.3.3 Step-Down Passive Avoidance Test

3. Discussion

4. Conclusion

5. Methodology

5.1 Animal Care and Dosing

5.2 Sample Collection

2.3.1 The Expression of miR-19a and miR-539

5.3.2 The Expression of GRIN2A and GRIN2B

5.4 Western Blot: The Level of GluN2A and GluN2B protein

5.5 Neurobehaviour Tests

5.5.1 Open Field Test; Evaluation of Anxiety-Related Behaviour

5.5.2 Step Down Passive Avoidance Test; Evaluation of Aversive Memory

5.5.3 Morris Water Maze Test; Evaluation of Spatial Memory

5.6 Statistical Analysis

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1