FOXE1 gene expression is linked to the size of papillary thyroid cancer tumors

doi:10.21203/rs.3.rs-3335433/v1

Download PDF

Research Article

FOXE1 gene expression is linked to the size of papillary thyroid cancer tumors

https://doi.org/10.21203/rs.3.rs-3335433/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 31 Jan, 2024

Read the published version in Biochemical Genetics →

You are reading this latest preprint version

Introduction: Papillary thyroid carcinoma (PTC), the most prevalent neoplasm of the thyroid, is more common in women than in men.

Objectives: To uncover the expression profile of FOXE1gene in PTC tumor etiology.

Subjects and methods: Microarray and RNA sequencing data on PTC in humans were analyzed. Eleven PTC tumor tissue samples and corresponding healthy tissue samples were collected. RT-qPCR was performed. Data normality, ROC construction, and logistic regression analysis were conducted. PTC tumors, healthy tissues surrounding tumors, patients of different sexes and ages, metastasizing tumors, and tumor variants were assessed for FOXE1 expression.

Results: FOXE1 gene expression was significantly increased in PTC tumors with dimensions less than 10 mm (relative expression= 14.437, p=0.050). A substantial increase in FOXE1gene expression was observed in the healthy tissue adjacent to the tumor, which was less than 10 mm in size, compared to the healthy tissue adjacent to the tumor, which was larger than 10 mm (relative expression= 41.760, p=0.0001). Females diagnosed with PTC showed a significant reduction in FOXE1mRNA levels compared to their male counterparts (relative expression=0.081, p=0.042). In contrast to healthy tissue, there was a significant reduction in FOXE1gene expression in FV-PTC (relative expression = 0.044 and p = 0.0001).

Conclusion: PTC tumors under 10mm have higher FOXE1gene expression than larger tumors; healthy tissue adjacent to smaller tumors also has higher FOXE1 expression. FOXE1 mRNA expression is lower in PTC females compared to males, as well as in FV-PTC compared to healthy tissue.

Papillary thyroid carcinoma

Microarray

RNAseq

RT-qPCR

1. The upregulation of the FOXE1 gene was observed in PTC tumors measuring less than 10mm in size, compared to those with a size of more than 10mm.

2. An increase in FOXE1 gene expression was observed in healthy tissue surrounding PTC tumors smaller than 10mm compared to those larger than 10mm.

3. A decrease in FOXE1 gene expression was observed in females with PTC compared to males.

4. The follicular variant of PTC presented a significant reduction in FOXE1 gene expression compared to healthy tissue.

Thyroid neoplasm, a form of malignancy that affects the endocrine system, is the most frequently diagnosed type of cancer in this particular anatomical region. Its incidence rate is notably higher in women than in men, with a ratio of two to three times greater [1–3]. In 2020, this type of malignancy ranked as the tenth most prevalent cancer type in both genders across the globe, a trend that has been consistently reported in Iran as well [4–6]. Moreover, thyroid neoplasm is recognized as the fifth most common cancer type in women worldwide and has a parallel incidence rate in Iranian women [4,5,7]. Recent research in Iran has identified that the highest prevalence of this disease is found in Isfahan and Yazd provinces [8]. The most commonly encountered thyroid neoplasm is papillary thyroid carcinoma (PTC), which originates from the thyroid follicular tissue and is classified as a differentiated tumor type [9, 10]. This variant of thyroid malignancy exhibits a high propensity for lymph node metastasis, which may result in the development of cystic structures in the vicinity of the thyroid gland [9, 11]. PTC primarily affects women between the ages of 30 and 40 and is also commonly observed in individuals who have been subjected to radiation exposure in the head and neck region [11].

PTC manifestation is subject to environmental factors and genetic background [2, 12, 13]. From a genetic standpoint, the correlation between mutations in BRAF, RAS, RET/PTC, and PAX8/PPARG genes and PTC incidence has been established [14]. However, the involvement of many other genes in this disease remains uncertain. Accordingly, it is plausible that genes implicated in the development of the thyroid gland could potentially serve as targets for elucidating the etiology of thyroid neoplasms [9]. One such gene of notable significance in thyroid gland development is Forkhead Box Protein E1, also known as FOXE1 gene (ENSG00000178919) [9]. The FOXE1 gene acts as a transcription factor that is not only effective in the differentiation and migration of thyroid gland cells, but also plays a triple role in regulating the production of thyroid hormones, thyroglobulin, and thyroid peroxidase [9, 15]. Despite the fact that the relationship between the FOXE1 gene and the occurrence of various cancers, particularly PTC, has been subject to conflicting observations, the precise role of this gene in PTC development remains unclear. For instance, the FOXE1 gene has been described as a tumor suppressor in both colorectal cancer and PTC [16, 17]. Nonetheless, the oncogenic role of the FOXE1 gene in PTC can not be disregarded because increased expression of this gene has been reported in 65% of PTC tumor tissue samples [18]. Consequently, both the oncogenic and tumor suppressive effects of the FOXE1 gene are considered simultaneously. As such, the functional significance of this gene in the development of PTC remains unclear.

The aim of the present study is to conduct a comparative analysis of the expression levels of the FOXE1 gene in PTC tissue and the adjacent healthy tissue surrounding the tumor, utilizing microarray, RNAseq, and RT-qPCR data analyses. The findings of this research demonstrate that the upregulation of the FOXE1 gene is evident in PTC tumors less than 10mm. Additionally, a correlation has been observed between the sex of the patients and FOXE1 expression level. Furthermore, it has been established that the follicular variant of PTC (FV-PTC) exhibits elevated FOXE1 expression, whereas classical-PTC does not. However, no statistically significant correlation was detected between the age of the patients or the existence of lymph node metastasis and the expression of the FOXE1 gene.

Microarray data analysis

Microarray data pertaining to PTC in humans (Homo sapiens) were extracted from the NCBI-GEO database. FOXE1 gene expression data from fifteen datasets, including GSE3467, GSE3678, GSE6004, GSE27155, GSE33630, GSE35570, GSE50901, GSE53157, GSE60542, GSE104006, GSE138198, GSE58545, GSE29265, GSE66783, and GSE129562 were analyzed separately. The normalization of gene expression data was performed on a base 2 logarithmic scale. The differential gene expression was assessed using the limma statistical package. Due to the large sample size, an adjusted significance level of less than 0.05 (adj-p-val < 0.05) was employed to reject the null hypothesis.

Sampling

All participants provided consent forms with the ethics code number IR.UI.REC.1398.060. Eleven PTC tumor tissue samples and corresponding healthy tissue samples were collected at Sina Hospital in Isfahan, Iran. A human study followed Helsinki-Tokyo Convention ethical principles. Participant information was recorded, including gender and age. Tissue was treated with RNAlater solution and kept at -70°C for RNA extraction.

Histopathology

Three slides were created from each tissue sample and fixed with 10% formaldehyde. Fixed tissues were then stained with Hematoxylin-eosin. Tumor progression was classified using the American Joint Committee on Cancer's system, which includes T for tumor, N for lymph node spread, and M for metastasis. The number following N indicates the extent of lymphatic metastasis. PTC-N0 represents tumor tissues without metastasis, while PTC-N1 represents those with metastasis.

RNA extraction

The tissue was treated with RNAlater solution and rinsed with normal saline before RNA extraction using Trizol solution (Biobasic, Canada, BS410A). RNA quality was evaluated through 1% agarose gel electrophoresis. The RNA was evaluated by measuring absorbance ratios at 260 to 280 nm and 260 to 230 nm using a spectrophotometer (Thermofisher, USA, NanoDrop™ OneC).

Construction of cDNA

Genomic DNA was digested using Dnase I enzyme (Thermofisher, USA, Cat number: EN0525) following the manufacturer's instructions. The One Step PrimeScript III RT-PCR Kit (Takara, Japan, RR601A) was used to produce cDNA following the manufacturer's instructions.

Exclusion criteria

Samples contaminated with blood and fat were excluded from the study after being washed with normal saline. Also excluded were samples with low RNA concentration and/or poor extracted RNA quality.

Primer designing

The process of designing primers for RT-qPCR experiments was carried out using Beacon Designer v8.1 software (Premier Biosoft, USA). To serve as a reference gene for this study, SYMPK was selected (22). Oligo7 software (Molecular Biology Insights, USA) was utilized to analyze the formation of secondary structures in the designed primers.

RT-qPCR reaction

The RT-qPCR procedure was executed employing a 2X-SYBR Green Real Time PCR kit (Parstous, Iran, C101021). Enzyme activation and initial synthesis were conducted for 10 minutes at 94°C. The target gene was amplified over 40 cycles, 1) 15 seconds at 95°C, 2) 30 seconds at the primer binding temperature, and 3) 30 seconds at 72°C.

Melt curve analysis

A gradual, 1-degree temperature increase was carried out from 55 to 95°C, and fluorescence emission was recorded for each degree of temperature increase. The melting curve shows how fluorescence changes with temperature, with temperature on the X axis and the derivative of fluorescence on the Y axis.

Statistics

Data normality, ROC construction, and logistic regression analysis were conducted using Graphpad Prism V. 9.0.0 software (Domatics, USA). REST 2009 software (Qiagen, Germany) was employed to investigate the differential expression of the FOXE1 gene. TCGAbiolinks package and the R programming environment (version 4-3-1, R core team 2022) were utilized to conduct the TCGA data analysis. A significance level of 0.05 was employed.

Characteristics of tissues

Table 2 provides a comprehensive summary of the characteristics of the tissue specimens. Out of 11 PTC tissues, 7 were from women and 4 from men. The healthy tissues surrounding the PTC tumors were from 6 female and 4 male individuals, with one tissue eliminated from consideration due to lack of confirmation. The average age of the PTC group was 46.9 ± 13.5 years, and for the healthy group adjacent to the tumor, it was 48.8 ± 13.9 years. PTC histological subtypes included FV-PTC, classical-PTC (C-PTC), adenocarcinoma, and conventional, with 4 tissues unidentified. All PTC tissues had a tumor stage rating of one, with an average size of 15.3 mm. Calcification was found in 5 PTC tissues, and metastasis was reported in 4 PTC tissues.

Table 1

Characteristics pertaining to the primers employed in this study.
Gene symbol (Ensembl accession)	Forward and Reverse primers	Primers attachment			Primer type	Product length (bp)	Annealing temperature (°C)
		Location (length, bp)	Paired nucleotides	Spanning Intron (length, bp)
FOXE1 (ENSG00000178919)	F:GGCGGCATCTACAAGTTCATCAC	Exon 1 (3492)	918–940	NA	NA	77	60
	R:CGGATGCTGTTCTGCCACTTTT	Exon 1 (3492)	994 − 973
SYMPK (ENSG00000125755)	F:ACGGTGCTGAGGGTCATTGA	Exon 18 (160)	135–154	Intron 18–19 (1295)	Intron spanning, Exon junction	146	60
	R:GAGGGTGGGACTTTGTCTGTGA	Exon 19 (109)	Exon 19 (98–109)	Intron 19–20 (294)
		Exon 20 (101)	Exon 20 (1–10)
The table provides the genes symbol and Ensembl accession number. The primer sequences for both forward (F) and reverse (R) are also presented. The primer binding information comprises of the binding position, exon binding site, intron length, primer type, PCR product length in base pairs, and primer binding temperature in degrees Celsius (°C).
bp = base pair; F = forward; R = reverse; FOXE1 = Forkhead Box E1; SYMPK = Symplekin Scaffold Protein; NA: Not applicable.

Table 2

Tissue characteristics
Tissue Pathology (number)	Sex	Mean age ± SD	Histological subtype	Tumor stage	Tumor size (mm)		matastasis
PTC (n = 11)	Females = 7 Males = 4	46.9 ± 13.5	Follicular-PTC = 2 Classical-PTC = 3 Adenocarcinoma = 1 Conventional = 1 unknown = 4	1	15.3	R = 5 NR = 1 U = 5	R = 4 NR = 7
Normal (n = 10)	Females = 6 Males = 4	48.8 ± 13.9	NA	NA	NA	NA	NA
The present report presents the histopathological results of the subjects under study. It provides relevant information such as the number of samples (n), gender, average age of each group, standard deviation, histological subgroup, tumor level, calcification, and metastasis.
NA: not applicable; R: reported; NR: not reported; U: unknown; SD: standard deviation

Quality and quantity of extracted RNAs

The RNA extraction was of high quality, as shown by the double intensity of the 28SrRNA band compared to 18SrRNA (Supplementary Figure S1). The absorbance ratios of 260 to 280 nm and 260 to 230 nm were within the numerical range of 1.8 to 2.2 for all samples. This indicates minimal contamination with protein and mineral salts/phenol, respectively.

Examining the melting curve and amplification specificity of primers

Examination of the melting curve revealed a single peak, signifying FOXE1 and SYMPK gene amplification (Supplementary Figure S2). The melting curve peaks for FOXE1 and SYMPK gene amplification were recorded at 82 (Supplementary Figure S2-a) and 85 (Supplementary Figure S2-b) degrees Celsius, respectively.

Checking the normality of the expression data and ROC curve statistics

The Shapiro test showed normal distribution in both PTC and healthy adjacent to the tumor groups (Supplementary Figure S3, p-value > 0.05). Furthermore, the scattering of data in the Q-Q diagram verified the normal distribution of the data (Supplementary Figure S3-a). FOXE1 gene expression data were modeled using a ROC curve. The AUC was 63%, but the correlation was not statistically significant (AUC = 0.63, P value = 0.29, Supplementary Figure S3-b).

Outcomes of microarray data analysis

The relationship between the FOXE1 gene expression level and the incidence of PTC, lymph node metastasis, tumor size, patient sex, age, and fetal stage is presented in Table 3. The analysis of GSE33630 dataset demonstrated a significant upregulation of FOXE1 gene in PTC tumor tissue, compared to adjacent healthy tissue (logFC = 0.6862 and adj-p-val = 4.76E-10). Compared to healthy tissue nearby, there was no significant change in FOXE1 expression in PTC tumor tissue with or without metastases (adj-p-val = 0.06558153 and 1.47E-01). No notable variation in FOXE1 gene expression was found in PTC-N1 versus PTC-N0 tumors (adj-p-val = 9.6).

Table 3

Comparing PTC and normal tissues for FOXE1 gene expression in microaaray
Compared groups	Microarray accession number	LogFC	adj.P.val
PTC (n = 49) vs adjacent normal (n = 45)	GSE33630	0.68615383	4.76E-10
PTC-N0 (n = 3) vs adjacent normal (n = 8)	GSE129562	-0.77558563	0.06558153
PTC-N1 (n = 5) vs adjacent normal (n = 8)	GSE129562	-0.551384	1.47E-01
PTC-N1 (n = 3) vs PTC-N0 (n = 3)	GSE129879	1.17	9.6
Tumor size < 10 mm (n = 16) vs Tumor > 10 mm (n = 36)	GSE50901	-0.0014	0.999
Females with PTC (n = 49) vs males with PTC (n = 16)	GSE50901	0.13195139	1
Females with PTC (n = 22) vs males with PTC (n = 12)	GSE104006	-0.43178192	0.78552836
PTC > 40 years old (n = 23)vs PTC < 40 years old (n = 11)	GSE104006	0.26	0.649
PTC > 40 years old (n = 33)vs PTC < 40 years old (n = 31)	GSE50901	-0.02500645	0.987
The findings of the analysis of microarray data in the compared groups are presented herein. The expression of the FOXE1 gene is compared between PTC tumor tissue and adjacent healthy tissue, among PTC tumors of varying sizes, and among PTC patients differing in age and gender. Notably, a significant increase in the expression of the FOXE1 gene was observed in PTC tumor tissue compared to normal tissue adjacent to the tumor in GSE33630 data set (logFC = 0.6862 and adj-p-val = 4.10-E76). The sample size for each group is provided in parentheses (n).
PTC: Papillary thyroid carcinoma; PTC-N0: PTC with no spread to lymph nodes; PTC-N1: PTC with spreading to nearby lymph nodes; LogFC: logarithm of fold change; adj.P.val: adjusted P value.

The investigation of tumor size in GSE50901 data found no notable differences in FOXE1 gene expression among tumors smaller or larger than 10mm. (adj-p-val = 0.999). The relationship between FOXE1 and patient sex was examined using GSE50901 and GSE104006 datasets, but no significant differences were observed in PTC-females and PTC-males (adj-p-val = 1.0 and 0.785, respectively). The examination of GSE104006 and GSE50901 datasets revealed no notable alteration in FOXE1 gene expression in PTC patients over 40 years old compared to those under 40 years old (adj-p-val = 0/649 and 0.987, respectively).

Outcomes of RNAseq data analysis

A presentation has been made that compares FOXE1 gene expression levels between PTC and healthy tissues in the TCGA database (Fig. 1). A noticeable reduction in FOXE1 gene expression was observed in PTC tissues as opposed to healthy tissues (Fig. 1-a, adj-p-val = 1.047E-06). Additionally, statistically significant decreases in FOXE1 gene expression were observed in PTC tissue with lymph node metastasis (PTC-N0 and PTC-N1) when compared to healthy tissue (Fig. 1-b, adj-p-val = 9.620E-04 and adj-p-val = 6.182E-09). The data collected also indicate a significant decrease in FOXE1 gene expression in PTC-N0 tissue relative to PTC-N1 tissue (Fig. 1-b, adj-p-val = 4.357E-05).

Both male and female groups with PTC demonstrated statistically significant decreases in FOXE1 gene expression compared to healthy tissue (Fig. 1-c, adj-p-val = 2.193E-04 and adj-p-val = 5.159E-07, respectively). There was no difference in the expression of FOXE1 gene between males and females with PTC (adj-p-val = 7.578E-01). Furthermore, all PTC patients of different ages were found to have a significant decrease in FOXE1 gene expression compared to healthy tissue (Fig. 1-d, adj-p-val < 0.05). Notably, a decrease in FOXE1 gene expression was also observed in the classical PTC histological subtype relative to healthy tissue, as well as in the C-PTC in comparison to FV-PTC (Fig. 1-e, adj-p-val = 4.477E-08 and 8.280E-05, respectively). However, there was no change in FOXE1 gene expression observed in the FV-PTC compared to healthy tissue (Fig. 1-e, adj-p-val = 3.097E-01). FOXE1 gene expression was significantly decreased in PTC tissues at different stages except stage 2 (Fig. 1-f, adj-p-val = 2.186E-01).

PTC occurrence, lymph node metastasis and tumor calcification are not correlated with FOXE1 gene expression

The association between the expression level of FOXE1 gene and the incidence of PTC and metastasis to lymph nodes was investigated (Table 4). Our findings indicate that there was no significant difference in FOXE1 gene expression between PTC tumor tissue and healthy tissue adjacent to the tumor (p = 0.9180). No notable difference in FOXE1 gene expression was found in PTC-N0 and PTC-N1 tumor tissues compared to adjacent healthy tissues (p = 0.5080 and p = 0.2990, respectively). Furthermore, no statistically significant difference was observed in FOXE1 gene expression between PTC-N1 and PTC-N0 tumor tissues (p = 0.9180). The alteration in the expression of FOXE1 gene was not detected in the tissue affected by PTC with calcification compared to the neighboring healthy tissue surrounding the tumor (p = 0.812). Similarly, no significant difference in FOXE1 gene expression was observed between PTC tissues with and without calcification (p-value = 0.836).

Table 4

Expression of FOXE1 gene and development of PTC, lymph node metastasis, and tumour calcification
Compared groups	Relative expression	p- value	Datasets with similar results
PTC vs adjacent normal	0.891	0.918	GSE33630
PTC-N0 vs adjacent normal	0.494	0.508	GSE129562
PTC-N1 vs adjacent normal	5.796	0.299	GSE129562
PTC-N1 vs PTC-N0	8.713	0.918	GSE129879
PTC with calcification vs Normal adj	1.449	0.812	NA
PTC with calcification vs PTC without calcification	1.318	0.836	NA
The level of expression of the FOXE1 gene in the tumor tissue of PTC and the healthy tissue adjacent to the tumor was analyzed using the RT-qPCR technique. The threshold limit for null hypothesis rejection was set at a significance level of 0.05. The corresponding dataset for each group is provided.
PTC: Papillary thyroid carcinoma; PTC-N0: PTC with no spread to lymph nodes; PTC-N1: PTC with spreading to nearby lymph nodes

The expression of FOXE1 gene exhibits a correlation with the size of the tumor and the sex of patients

A comprehensive investigation was carried out to examine the connection between the expression of FOXE1 gene and the size of tumors as well as the sex of patients (Table 5). It was noted that a significant elevation in FOXE1 gene expression was observed in tumors with dimensions less than 10 mm compared to those with larger dimensions. This alteration in expression was statistically significant (relative expression = 14.437, p = 0.050). Furthermore, an increase in FOXE1 gene expression was observed in the healthy tissue close to the tumor, which was less than 10 mm in size, in contrast to the healthy tissue adjacent to the tumor that was larger than 10 mm (relative expression = 41.760, p = 0.0001). A significant reduction in FOXE1 mRNA level was noted in females diagnosed with PTC when compared to their male counterparts (relative expression = 0.081, p = 0.042). However, no notable variation in FOXE1 gene expression was observed in tumors less than 10 mm when compared to healthy tissue (p = 0.258) or healthy tissue adjacent to the tumor (p = 0.655). Similarly, no significant changes were observed in tumors larger than 10mm in comparison to healthy tissue (p = 0.545) and in comparison to healthy tissue adjacent to the tumor (p = 0.553).

Table 5

FOXE1 gene expression associates with the size of tumors, as well as the gender of the patients
Compared groups	Relative expression	p- value	Datasets with similar results
Tumor size < 10 mm vs Tumor > 10 mm	14.437	0.050	GSE50901
Normal adj Tumor < 10 mm vs Normal adj Tumor > 10 mm	41.760	0.0001	NA
Tumor < 10 mm vs Normal tissues	7.920	0.258	NA
Tumor < 10 mm vs Normal adj	2.046	0.655	NA
Tumor > 10 mm vs Normal tissues	0.549	0.545	NA
Tumor > 10 mm vs Normal adj	1.708	0.553	NA
Females with PTC vs males with PTC	0.081	0.042	GSE50901/ GSE104006
The present study has demonstrated the differential expression of the FOXE1 gene in PTC tumors of varying sizes. In order to reject the null hypothesis, a significance level of 0.05 was adopted as the threshold limit. The microarray dataset corresponding to each group has been furnished. Our findings suggest that tumors smaller than 10 mm exhibited a statistically significant increase in FOXE1 gene expression as compared to those larger than 10 mm (relative expression = 14.437, p-val = 0.050). Additionally, the healthy tissue adjacent to tumors smaller than 10 mm exhibited a statistically significant increase in FOXE1 gene expression as compared to healthy tissue adjacent to tumors larger than 10 mm (relative expression = 41.760, p-val = 0.0001). Interestingly, a significant difference in FOXE1 mRNA expression was observed between women and men with PTC, with women showing a decrease in relative expression (0.081) and a p-value of 0.042.
NA: Not available

There exists an absence of correlation between the expression of FOXE1 gene and the age of patients

The study examined the correlation between FOXE1 gene expression and patient age (Table 6). Notably, the analysis revealed that there was no noticeable alteration in FOXE1 gene expression in PTC individuals over 40 years old in comparison to their healthy counterparts (p = 0.823). No significant alteration was detected in FOXE1 gene expression in individuals with PTC below 40 years of age compared to their healthy counterparts (p = 0.563). Furthermore, the study revealed that changes in FOXE1 gene expression in PTC subjects aged over 40 years compared to those under 40 were not observed (p = 0.245). Finally, individuals older than 40 with PTC did not show any significant changes in FOXE1 gene expression compared to those younger than 40 (p = 0.171).

Table 6

FOXE1 gene expression and age of patients
Compared groups	Relative expression	p- value	Dataset with same result
PTC > 40 years old vs PTC < 40 years old	4.333	0.245	GSE104006/ GSE50901
normal > 40 years old vs normal < 40 years old	9.861	0.171	NA
PTC > 40 years old vs normal > 40 years old	0.765	0.823	NA
PTC < 40 years old vs normal < 40 years old	1.740	0.563	NA
The present study provides an analysis of the FOXE1 gene expression levels in various age groups and pathological conditions. The significance level was set at 0.05, serving as the threshold for null hypothesis rejection. The corresponding microarray dataset was obtained for each group.
NA: Not available

The relationship between FOXE1 gene expression and histological subtype of PTC

The relationship between the alteration in FOXE1 gene expression and the histological subtype was analyzed (Table 7). Our findings revealed a significant decrease in FOXE1 gene expression in the FV-PTC compared to healthy tissue (relative expression = 0.044 and p = 0.0001). The alternative subtype of PTC, specifically the classical PTC, exhibited no significant dissimilarity in the expression of FOXE1 gene (p = 0.614). There were no significant differences observed in the expression level of FOXE1 gene between the classical and FV-PTC tissues (p-value = 0.207).

Table 7

FOXE1 gene expression associates with a histological subtype
Comparison	Relative expression	p- value
Follicular-PTC vs normal	0.044	0.0001
Classical- PTC vs normal	1.737	0.614
Classical- PTC vs Follicular- PTC	0.018	0.207
The present study presents data on the level of expression of the FOXE1 gene in various histological subtypes of PTC and their adjacent healthy tissues. The null hypothesis was rejected using a significance level of 0.05. Specifically, a statistically significant decrease in FOXE1 gene expression was observed in the follicular-PTC histology subgroup when compared to the corresponding healthy tissue (p-value = 0.0001).

It has been prognosticated that the incidence of thyroid neoplasm within Iran will increase by more than 53% in men and 40% in women by 2040 [19]. Understanding the behavior of this cancer can prove to be of the utmost importance in sustaining the overall health of the society. On the other hand, the FOXE1 gene has been identified as a fresh component in unravelling the enigma surrounding thyroid abnormalities since this gene holds a pivotal function in the growth, proliferation, and differentiation of thyroid cells [9, 20]. In the study conducted by Zheng Ding et al, an increase in FOXE1 gene expression was evidenced in tissues and cells afflicted by PTC, and the cessation of this gene's expression in vitro was correlated with the impediment to the growth, migration, and invasion of PTC cells [17]. The comparison of PTC tissue with healthy tissue neighboring the tumor by Youben Fan et al revealed that FOXE1 gene expression was considerably elevated in 65% of tumors. This elevation was associated with metastasis to lymph nodes and tumor progression [18]. They suggested that the gene, given its connection to clinical prognosis, could be regarded as a potential biomarker for PTC diagnosis and even as a potential therapeutic [18]. The investigation of PTC tumors revealed that PDGFA gene is the downstream target of FOXE1 gene, and the expression of these two genes is inversely associated with each other [17]. Since PDGFA is an oncogene, FOXE1 inhibits tumor growth [17]. Therefore, FOXE1 gene appears to play both an inducing and inhibitive role in tumor growth and its exact function is still unknown, making this mystery unsolved.

A previous investigation determined that mice lacking the FOXE1 gene were born viable; however, after 48 hours of life, they succumbed to severe cleft palate [9]. It was observed that reintroduction of the FOXE1 gene to thyroid progenitor cells resulted in proper gland placement. This indicates the gene's role in regulating cell migration [9]. Furthermore, subsequent to the analysis of RNA sequencing data, it has come to our attention that notwithstanding earlier indications of heightened FOXE1 gene expression in PTC tumors, a discernible reduction in its expression is evident in these neoplastic growths relative to non-pathological tissue. Our analysis also demonstrated an inverse association between FOXE1 gene expression and tumor progression and metastasis to lymph nodes. It appears that as PTC tumors progress, FOXE1 gene expression decreases further. This strengthens the notion that this gene plays a role in inhibiting tumor growth.

Moreover, given the reports concerning the transformation of differentiated PTC tumor into undifferentiated anaplastic thyroid carcinoma (ATC) tumor [21, 22], an investigation into the expression level of FOXE1 gene in ATC tumor was conducted using microarray GSE33630 dataset (Table 8). Upon comparing the ATC tissues with the healthy tissues adjacent to the tumors, a significant decrease in FOXE1 gene expression was observed (LogFC=-5.43463231), and this reduction was statistically substantial (adj-p-val = 1.39E-19). Similarly, comparison of ATC tumor tissues with healthy tissues in GSE65144 dataset showed a significant decrease in FOXE1 gene expression, which was also statistically meaningful (LogFC = -5.3822813 and adj-p-val = 3.08E-06). The comparison of undifferentiated ATC tissue with differentiated PTC tissue in the GSE76039 dataset revealed a significant decrease in the expression of FOXE1 gene (LogFC = -5.34 and adj-p-val = 8.56E-08). The evidence presented here supports the conclusion that FOXE1 gene expression is directly proportional to thyroid tumor differentiation, with lower levels of expression seen in undifferentiated ATC tumors. Furthermore, examining the critical molecular pathways involved in thyroid carcinogenesis revealed that four signaling pathways, namely EGF-MAPK, Wnt/Bcat, PAX8/PPARG, and P53, play a crucial role in thyroid cancer development. Given to the role of the above mentioned pathways in cell differentiation, an increase in FOXE1 gene expression could also result in thyroid tumor differentiation [9, 23–27].

Table 8

FOXE1 gene expression in ATC tissues by micriarray
Comparison	Microarray accession number	Fold change	adj.P.Val
ATC (n = 11) vs normal tissues (n = 45)	GSE33630	-5.43463231	1.39E-19
ATC (n = 12) vs normal tissues (n = 13)	GSE65144	-5.3822813	3.08E-06
ATC (n = 20) vs differentiated tumor tissues (n = 17)	GSE76039	-5.34	8.56E-08
The results of the comparison of FOXE1 gene expression between ATC samples and normal tissue are given in the microarray dataset. The number of samples (n) is expressed in front of each group. Accession number of microarray data, coefficient of variation and adjusted significance level are given. n = samples’number

The authors disclose a pioneering revelation concerning the association between tumor size and the expression level of FOXE1 genes. In light of the fact that FOXE1 plays a crucial role in thyroid cell differentiation and the fact that cancer cell differentiation decreases as nodules grow [28], it is reasonable to conclude that the expression of this gene is also increased with decreasing tumor size in PTC tumor samples. Additional support was provided by our observation that FOXE1 was upregulated both in small sized PTC tumors in comparison to larger tumors, as well as in adjacent healthy tissues of small tumors in comparison to larger tumors. As a result of this observation, it might also be possible that healthy tissues, through the expression of the FOXE1 gene, can communicate inhibitory signals to their tumor neighbors.

To summarize, this study shows that PTC tumor size augmentation leads to a decline in FOXE1 gene expression. This particular issue, in addition to elucidating the correlation between the expression level of FOXE1 gene and the differentiation of thyroid tumors, also highlights the function of the mentioned gene as a tumor suppressor. FOXE1 gene expression was not detected in neoplastic tissue exhibiting calcification. Nevertheless, given the augmented likelihood of malignancy in calcification cases, a conjecture has been postulated regarding the possible decrement of FOXE1 gene expression in the advent of PTC. This is as a means of impeding tumor calcification and subsequently forestalling metastasis.

In general, it can be inferred that a conspicuous increase in FOXE1 gene expression occurred in PTC tumors smaller than 10mm, compared to those larger than 10mm. Correspondingly, FOXE1 gene expression rose in healthy tissue adjacent to small PTC tumors compared to healthy tissue adjacent to larger tumors. In addition, FOXE1 mRNA expression was significantly reduced in females with PTC compared to males. Lastly, in FV-PTC, a significant reduction in FOXE1 gene expression was also observed in contrast to the corresponding healthy tissue.

Acknowledgements

Volunteers are thanked for their time and effort by the author. Funding for this study was provided by the Departments of Research, Technology, and Graduate Offices of the University of Isfahan, Iran. A sincere thank you is extended to Dr. Mohsen Kolahdouzan, thoracic surgeon, for his kindness, patience and responsibility in the acquisition of thyroid tissues. It is also appropriate to express gratitude to Dr. Keivan Shirneshan for approving the pathological results.

Funding

This study was conducted at Isfahan University of Iran and was supported financially by the Departments of Research, Technology and Graduate Offices (Grant number: A\98\5727).

Competing Interests

The authors declare no competing interests.

Author contributions

R.H: Design, data analysis, interpretation, manuscript drafting, and final approval of the manuscript.

S-M.J.: Conceptualization, design, data analysis, interpretation, financial support, manuscript drafting, critical revision for critical intellectual contents, and final approval of the manuscript.

M.K: S.-M.J.: Conceptualization, design, interpretation, manuscript drafting, and final approval of the manuscript.

Data availability statement

The entirety of the information provided in the manuscript can be accessed via the following URLs: https://www.ncbi.nlm.nih.gov/geo/ and https://ualcan.path.uab.edu/analysis.html.

Consent to participate and ethics approval

All patients recommended for thyroid surgery at Al-Zahra and Sina hospitals in Isfahan had to sign a consent form. Isfahan University’s institutional review board (IR.UI.REC.1398.060) approved the acquisition of human tissues. All the experiments and procedures performed in this study specially but not limited to human participants were in accordance with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Authors sincerely thank the volunteers for their participation.

Consent to publish

Not applicable.

Siegel RL, Miller KD, Jemal A (2016) Cancer statistics, 2016. CA Cancer J Clin 66:7–30
Safavi A, Azizi F, Jafari R, Chaibakhsh S, Safavi AA (2016) Thyroid cancer epidemiology in Iran: a time trend study. Asian Pac J Cancer Prev 17:407–412
Shah JP (2015) Thyroid carcinoma: epidemiology, histology, and diagnosis. Clin Adv Hematol Oncol H&O 13:3
Taghavi kojidi H, Farzadfar F, Peykari N, Larijani B, Rahimzadeh SR-DE et al (2016) Comprehensive study on national and sub national trend in thyroid cancer prevalence in the iranian population, 1990–2010. Iran J Diabetes Metab 15:91–100
Fernandez LP, Lopez-Marquez A, Santisteban P (2015) Thyroid transcription factors in development, differentiation and disease. Nat Rev Endocrinol 11:29
Nikiforov YE, Nikiforova MN (2011) Molecular genetics and diagnosis of thyroid cancer. Nat Rev Endocrinol 2011/09/01 7:569–580
Ranjbari N, Almasi S, Mohammadi-Asl J, Rahim F (2013) BRAF mutations in Iranian patients with papillary thyroid carcinoma. Asian Pac J Cancer Prev 14:2521–2523
Cokkinides V, Albano J, Samuels A, Ward ME, Thum JM (2005) American cancer society: Cancer facts and figures. Atlanta Am Cancer Soc.
Han MA, Kim JH (2018) Diagnostic X-ray exposure and thyroid cancer risk: systematic review and meta-analysis. Thyroid 28:220–228
Agrawal N, Akbani R, Aksoy BA, Ally A, Arachchi H, Asa SL et al (2014) Integr genomic Charact papillary thyroid carcinoma 159:676–690
Perrone L, di Magliano MP, Zannini M, Di Lauro R (2000) %J B, communications biophysical research. The thyroid transcription factor 2 (TTF-2) is a promoter-specific DNA-binding independent transcriptional repressor. 275:203–208
Dai W, Meng X, Mo S, Xiang W, Xu Y, Zhang L et al (2020) FOXE1 represses cell proliferation and Warburg effect by inhibiting HK2 in colorectal cancer. Cell Commun Signal 18:1–13
Ding Z, Ke R, Zhang Y, Fan Y, Fan J (2019) FOXE1 inhibits cell proliferation, migration and invasion of papillary thyroid cancer by regulating PDGFA. Mol Cell Endocrinol 493:110420
Fan Y, Ding Z, Yang Z, Deng X, Kang J, Wu B et al (2013) Expression and clinical significance of FOXE1 in papillary thyroid carcinoma. 8:123–127
Tomorrow C Prediction of Thyroid Cancer Epidemiology in 2040 [Internet]. 2020. Available from: https://gco.iarc.fr/tomorrow/en
Macchia PE, %J (2007) J of endocrinological investigation. FOXE1 polymorphisms: a new piece in the puzzle of thyroid dysgenesis. 30:1–2
Odate T, Oishi N, Kawai M, Tahara I, Mochizuki K, Akaishi J et al (2021) Progression of papillary thyroid carcinoma to anaplastic carcinoma in metastatic lymph nodes: solid/insular growth and hobnail cell change in lymph nodes are predictors of subsequent anaplastic transformation. Endocr Pathol 32:347–356
Hébrant A, Dom G, Dewaele M, Andry G, Trésallet C, Leteurtre E et al (2012) mRNA expression in papillary and anaplastic thyroid carcinoma: molecular anatomy of a killing switch. PLoS ONE 7:e37807–e37807
Laboratories،Jepan K KEGG [Internet]. Available from: https://www.genome.jp/network/nt06274
Li JMaZ, Shen Y, Lai J, Su Q, Zhao J, Xu J XH. FOXE1 supports the tumor promotion of Gli2 on papillary thyroid carcinoma by the Wnt/β-catenin pathway. Cell Physiol
Wang Y, He H, Li W, Phay J, Shen R, Yu L et al (2017) MYH9 binds to lncRNA gene PTCSC2 and regulates FOXE1 in the 9q22 thyroid cancer risk locus. 114:474–479
Jiang3 Xi Chen2, Ting (2019) Lin3, Xingsheng Chen3, Jiqi Yan2, Shan HL. MicroRNA-524‐5psuppressestheprogressionofpapillary thyroidcarcinomacellsviatargetingonFOXE1andITGA3in cellautophagy andcyclingpathways. wiley, Cell Physiol
Wang Q, Zou Y, Nowotschin S, Kim SY, Li QV, Soh C-L et al (2017) The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Cell Stem Cell [Internet]. ;20:70–86. Available from: https://linkinghub.elsevier.com/retrieve/pii/S1934590916303423
Jögi A, Vaapil M, Johansson M, Påhlman S (2012) Cancer cell differentiation heterogeneity and aggressive behavior in solid tumors. Ups J Med Sci 117:217–224
25. Wang Y, He H, Li W, Phay J, Shen R, Yu L, et al. MYH9 binds to lncRNA gene PTCSC2 and regulates FOXE1 in the 9q22 thyroid cancer risk locus. 2017;114:474–9.
26. Jiang3 Xi Chen2, Ting Lin3, Xingsheng Chen3, Jiqi Yan2, Shan HL. MicroRNA-524‐5psuppressestheprogressionofpapillary thyroidcarcinomacellsviatargetingonFOXE1andITGA3in cellautophagy andcyclingpathways. wiley, Cell Physiol. 2019;
27. Wang Q, Zou Y, Nowotschin S, Kim SY, Li Q V., Soh C-L, et al. The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Cell Stem Cell [Internet]. 2017;20:70–86. Available from: https://linkinghub.elsevier.com/retrieve/pii/S1934590916303423
28. Jögi A, Vaapil M, Johansson M, Påhlman S. Cancer cell differentiation heterogeneity and aggressive behavior in solid tumors. Ups J Med Sci. 2012;117:217–24.

No competing interests reported.

Download PDF

Journal Publication

published 31 Jan, 2024

Read the published version in Biochemical Genetics →

Editorial decision: Major revision
10 Oct, 2023
Reviews received at journal
10 Oct, 2023
Reviewers agreed at journal
30 Sep, 2023
Reviews received at journal
24 Sep, 2023
Reviewers agreed at journal
15 Sep, 2023
Reviewers invited by journal
12 Sep, 2023
Editor assigned by journal
09 Sep, 2023
Submission checks completed at journal
09 Sep, 2023
First submitted to journal
07 Sep, 2023

You are reading this latest preprint version

FOXE1 gene expression is linked to the size of papillary thyroid cancer tumors

Status:

Journal Publication

Version 1

Abstract

Figures

Highlights

Introduction

Subjects and methods

Microarray data analysis

Sampling

Histopathology

RNA extraction

Construction of cDNA

Exclusion criteria

Primer designing

RT-qPCR reaction

Melt curve analysis

Statistics

Results

Characteristics of tissues

Quality and quantity of extracted RNAs

Examining the melting curve and amplification specificity of primers

Checking the normality of the expression data and ROC curve statistics

Outcomes of microarray data analysis

Outcomes of RNAseq data analysis

Discussion

Conclusion

Declarations

Acknowledgements

Funding

Author contributions

Data availability statement

Consent to participate and ethics approval

Consent to publish

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1