Clinical and laboratory investigations of a sudden death syndrome in newborn Boer goats

doi:10.21203/rs.3.rs-3335670/v1

Download PDF

Research Article

Clinical and laboratory investigations of a sudden death syndrome in newborn Boer goats

https://doi.org/10.21203/rs.3.rs-3335670/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

The aim of the present study was to determine the cause of a sudden death syndrome in Boer goats on an organised farm in Dakahlia Governorate, Egypt, and to investigate the associated haematobiochemical changes. In December 2021, an outbreak of sudden death was detected on an organised farm with two hundred adult Boer goats and thirty kids. The complaint was that seventeen newborn kids died suddenly after showing a brief episode of apathy, while the adults remained healthy and showed no systemic disease. As FMD infections occurred simultaneously on large ruminant farms in the study region, buccal and nasal swabs were taken from the thirteen kids to diagnose FMD virus in one step RT-PCR. Further typing tests were carried out to determine the circulating FMDV. Blood samples were also taken from the goats to determine haematobiochemical changes. A post-mortem examination was carried out on eight carcasses, while swabs of internal organs and intestinal contents were taken for bacteriological examination. Tissue samples were also fixed in 10% neutral buffered formalin for histopathological examination.

Results

The results confirmed the FMDV type O strain, while C. perfringens was cultured and confirmed by DNA sequencing as C. perfringens strain B1. The alpha toxin gene (CPA) of C. perfringens was also detected. The affected kids showed the picture of intravascular haemolysis, which is indicative of the CPA toxin.

Conclusions

The study highlights the role of Clostridia infection as a complication of FMD in Boer kids. This is the first report in which C. perfringens has been detected in association with FMD infection in this valuable goat species. These results improve our understanding of the clinical presentation of complicated cases of FMD infection in Boer goats under natural conditions.

Boer goats

C. perfringens

CPA toxin

FMD

Molecular diagnosis

Pneumonia

Foot-and-mouth disease (FMD) is an economically important, highly contagious disease caused by Aphthovirus of the Picornaviridae family that mainly affects cloven-hoofed animals [1]. FMD is a transboundary animal disease that affects livestock productivity and hampers local and international trade in livestock and livestock products, resulting in severe economic losses worldwide [2, 3].

The disease circulates in about 77% of the world's livestock (mainly in Africa, the Middle East, Asia and a limited area in South America), while FMD-free countries face the constant threat of infection without vaccination [4].

Sheep and goats are important livestock species in several areas of the world, including Egypt, but are not usually included in prophylactic FMD vaccination programs [5]. Although the clinical diagnosis of FMD is confirmed in cattle and buffalo, the situation in adult sheep and goats is rather vague, as it may present in a mild or subclinical form [6]. While the disease is endemic in Egypt, there are few studies on the role of small ruminants in the epidemiology of FMD. Furthermore, information on the clinical presentation of FMD infection in sheep and goats under field conditions is still limited [7].

A few experimental studies have been conducted to clarify the susceptibility of small ruminants to FMD [8, 9]. The susceptibility of five naïve South African indigenous goats to FMDV Southern African Territories 1 (SAT1) was investigated after experimental challenge with a mixed SAT1 virus pool [8]. In the study conducted by Muthukrishnan and others, sheep and goats were experimentally infected with a serotype O FMD virus by different routes [9].

Foot-and-mouth disease virus (FMDV) causes transient immunosuppression, which provides an ideal opportunity for secondary bacterial invasion, leading to poor clinical outcome and sometimes death of affected animals [10]. It has been suggested that Pasteurella multocida is the most common secondary bacterial infection responsible for deaths in FMD outbreaks. In this context, an outbreak of FMD has occurred in Indian cattle (Indian gaurs), which has rapidly spread to herbivores in the Bannerghatta Biopark in India [11]. The authors added that in addition to the classic symptoms of FMD, the infected animals showed severe respiratory disease caused by Pasteurella multocida cultured from heart blood and spleen samples of the infected animals.

Clostridium perfringens, a gram-positive anaerobic rod, can be classified into five different toxin types (A, B, C, D, and E) based on the production of four major toxins: alpha (CPA), beta, epsilon, and iota [12]. Alpha-toxin is produced by all C. perfringens strains and is considered a classic example of a toxin that modifies cell membranes by enzymatic activity [13]. This toxin degrades phosphatidylcholine and sphingomyelin, which are components of the erythrocyte membrane, causing hemolysis[14].

CPA toxin can suppress the immune response by restraining leukocytes from entering the infected tissues [15], and cause a systemic inflammatory response through activating the arachidonic cascade and producing thromboxane, leukotrienes, and prostaglandins [12, 14]. The role of CPA toxin in intestinal diseases in sheep and goats is still controversial and poorly documented [16]. Furthermore, the detection of CPA toxin in goats with FMD infection has not yet been evaluated. The present study aimed to establish the causal of an outbreak of sudden death syndrome in Boer goats on an organised farm in Dakahlia Governorate, Egypt, and to provide a platform for the associated haematobiochemical alterations.

In December 2021, a disease outbreak occurred on an organised farm with 200 Boer goats and their kids (n = 30) in Aga district, Dakahlia governorate, Egypt. The main complaints were sudden deaths among the newborn kids, with no obvious clinical signs in the adults. Goats on the farm were regularly vaccinated against Peste des petits ruminants, bluetongue and Pasteurella and regularly dewormed, but they did not receive FMD vaccine.

Sampling and samples processing

Blood samples

Venous blood was drawn from all affected kids and placed in tubes containing EDTA or in other plain tubes to obtain whole blood or serum, respectively. The samples were stored in ice coolers and immediately taken to the laboratory where a series of haematological and biochemical analyses were performed. A complete blood count was performed using an electronic cell counter, while blood was allowed to clot in plain tubes and centrifuged at 1198 ×g to obtain clear, non-haemolysed sera. The collected sera were used to determine alanine aminotransferase (ALT) and aspartate aminotransferase (AST) (Human, Wiesbaden, Germany), lactate dehydrogenase (LDH) (Spinreact, Girona, Spain) and total protein and albumin (Stanbio Laboratory, TX, USA), which were measured spectrophotometrically (Spectrophotometer, BM, Germany, 5010) according to the manufacturer’s guidelines. The myocardial creatine kinase band (CK-MB) was also determined using ELISA kits from Kamiya Biomedical Company (Seattle, WA, USA).

Specimens

Buccal and nasal swabs were taken aseptically from all kids using sterile cotton swabs moistened with tryptone soy broth (TSB) and placed in tubes containing 10 ml TSB. All swabs were stored in ice coolers and immediately taken to the laboratory for microbiological examination. The examinations were carried out in the bacteriology and virology laboratories of the Faculty of Veterinary Medicine, Mansoura University.

The oral mucosal swabs collected were pooled and centrifuged at 2000 rpm for 10 minutes according to the OIE manual for FMD diagnosis [18]. The sample supernatant was used for viral RNA extraction with the QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA), which was used according to the manufacturer's instructions. The one-step RT-PCR was performed with the Topscript RT-PCR Master Mix (Cat. RT4105, Enzynomics, South Korea). Primers used according to the methods described previously [17] include 1F: 5`GCCTGGTCTTTCCAGGTCT3` and 1R: 5'CCAGTCCCCTTCAGATC3` that amplify a band of 328 bp from the viral 5`UTR.

Further typing trials were performed according to the protocol described previously [18].The primers used in this study are listed in Table 1. PCR amplification was performed in Biometra, Tpersonal Thermocycler, Göttingen, Germany under the following conditions: reverse transcription at 50◦C for 15 min, enzyme inactivation and denaturation 95◦C for 15 min, denaturation 95◦C for 15 sec, primer annealing (60◦C for detection and type O, 55◦C for type A, and 50◦C for type SAT2) for 30 sec, extension 72◦C for 45 sec for 35 cycles, and final extension at 72◦C for 10 min. PCR products were separated in an electric field through a 1.5% agarose gel in Tris-acetate-EDTA buffer and then stained with ethidium bromide and further documented in the gel.

Table 1

Primers used for typing Foot and Mouth Disease virus
Primer	Sequence (5ʹ – 3ʹ)	Genome direction	Gene	Product size
Serotype O
O–1C244F	GCAGCAAAACACATGTCAAACACCTT	+	VP3	1,165
O–1C283F	GCCCAGTACTACACACAGTACAG	+	VP3	1,124
Serotype A
A–1C562F	TACCAAATTACACACGGGAA	+	VP3	866
A–1C612F	TAGCGCCGGCAAAGACTTTGA	+	VP3	814
Serotypes O/A/C/Asia 1
EUR–2B52R	GACATGTCCTCCTGCATCTGGTTGAT	–	2B
Serotype SAT 2
SAT2–1C445F	TGGGACACMGGIYTGAACTC	+	VP3	1,145
SAT2–P1–1223F	TGAACTACCACTTCATGTACACAG	+	VP3	1,279
Serotypes SAT 1–3
SAT–2B208R	ACAGCGGCCATGCACGACAG	–	2B

For bacteriological examination, swabs from internal organs (lung, liver, brain, spleen and kidney) and intestinal contents were placed in thioglycolate broth (oxoid) and incubated under anaerobic conditions (anaerogen, Oxoid) at 36°C for 24 hours. The pre-enriched broth was then spread on the surface of 5% defibrinated sheep blood agar [19], and incubated for 24 hours under the same conditions. Suspect colonies (double zone of haemolysis on blood agar) were again streaked onto the surface of Perfringens Agar Base SFP supplemented with egg yolk emulsion (Oxoid). Colonies that produced lethithinase activity on the surface of the egg yolk-containing medium were harvested, Gram-stained, and subjected to biochemical assays [20].

Genomic DNA extraction

Three to five colonies were picked from the surface of the medium, suspended in 200µl of nuclease-free water, and boiled for 10 minutes. The previous suspension was then centrifuged at maximum speed for 5 minutes. The supernatant was transferred to sterile Eppendorf tubes to be used as DNA template.

Molecular characterization of C. perfringens

C. perfringens isolates were confirmed by PCR assay using a species-specific primer of 16SrRNA following the protocol proposed previously [21]. PCRs were performed in a total volume of 25 µl, consisting of 12.5 µl Emerald Amp Max PCR Master Mix (Takara, Japan), 1 µl primer (Metabion, Germany) at a concentration of 20 pmol, F: AAAGATGGCATCATTCAAC and R: TACCGTCATTATCTTCCCCAAA, and 5 µl DNA template. The reaction was terminated with nuclease-free water. The PCR program was set up and run using an Applied Biosystem 2720 96-well thermal plate under the following conditions: 94°C for 5 minutes, followed by 35 cycles of 94°C for 30 seconds, 53°C for 30 seconds, and 72°C for 30 seconds, with a final extension at 72°C for 7 minutes. PCR products were separated by electrophoresis on a 1.5% agarose gel (AppliChem, Germany, GmbH) in 1x TBE buffer.

Sequencing of DNA products

Isolates producing a 279-bp segment of the 16S rRNA gene were confirmed as C. perfringens, and a representative isolate was sent for sequencing. The QIAquick PCR Product Extraction Kit (Qiagen, Valencia) was used to purify DNA products for subsequent sequencing. The Bigdye Terminator V3.1 Cycle Sequencing Kit (Perkin-Elmer) was used for the sequencing reaction, which was subsequently purified using a Centrisep spin column. DNA sequences were obtained using an Applied Biosystems 3130 genetic analyzer (Hitachi, Japan). The resulting DNA sequences were first subjected to BLAST search (http://www.blast.ncbi.nlm.nih.gov) to determine sequence identity with GenBank accessions. The 16S rRNA gene sequence was deposited in GenBank under accession number OM616931.

Molecular detection of C. perfringens alpha toxin gene

The detection of CPA was performed using PCR assays [22]. The protocol used, primer sequences, and amplification were employed as previously described [23]. Primers were used in a 25-µl reaction volume containing 12.5µl Emerald Amp Max PCR Master Mix (Takara, Japan), 1 µl primer (Metabion, Germany) at a concentration of 20 pmol, F: GTTGATAGCGCAGGACATGTTAAG and R: CATGTAGTCATCTGTTCCAGCATC, and 6µl DNA template. The reaction terminated with nuclease-free water. The PCR program was prepared and run using an Applied Biosystem 2720 96-well thermal plate under the following conditions: initial denaturation at 94°C for 5 minutes and 35 cycles of denaturation at 94°C for 30 seconds, primer annealing at 55°C for 40 seconds, extension at 72°C for 45 seconds, followed by a final extension at 72°C for 10 minutes. PCR products were separated by electrophoresis on a 1.5% agarose gel (AppliChem, Germany, GmbH) in 1x TBE buffer. Amplified products were stained with ethidium bromide (Sigma-Aldrich, St. Louis, MO, U.S.A.) and visualized under UV transilluminator (Hybaid, UK). The expected size of the amplified product of the CPA toxin gene is 402 bp. Positive and negative samples previously confirmed in our laboratory were used as positive and negative controls, respectively.

Postmortem specimens

A total of eight kid carcasses were sent to the Department of Veterinary Pathology, Faculty of Veterinary Medicine, Mansoura University. Tissue samples of heart, trachea, lungs, liver, spleen, kidneys, intestines, and brain were collected and quickly fixed in 10% neutral buffered formalin. The samples were routinely processed until paraffin embedding, sectioned, stained with hematoxylin and eosin (H&E), and examined with light microscope.

Medical management

Thirteen kids received an initial treatment protocol consisting of ceftiofur crystalline free acid (Excede, Zoetis Inc., USA) at a dosage of 6.6 mgKg^− 1 and meloxicam (Metacam, Boehringer Ingelheim VetMedica GmbH, Germany) at a dosage of 0.5 mgKg^− 1. Both drugs were administered as SC injections and repeated after 72 hours. Acyclovir (Zovirax, Glaxo Operations UK Ltd.) was administered three times daily for 10 days at a dose of 20 mg/kg as SC injection. Oreganum oil 20% (Ropadiar, Ropapharm International BV, The Netherlands) was also administered daily as an oral infusion at a dose of 2 ml/head.

Statistical analysis

Data were statistically analysed using Graph Pad Prism software (Graph Pad Software Inc, San Diego). Data tested for normality using the Shapiro–Wilk test and P values were not significant. Therefore, means and standard deviations (SD) were estimated for haematological and biochemical variables. Data before and after treatment were statistically tested for significant differences (p < 0.05) using Student’s t-test.

An overview of the clinical and haematobiochemical changes in the affected kids as well as the results of the microbiological and histopathological examinations are presented in Tables 2–4 and Figs. 1–12. Of the thirty kids affected, eight survived (26.7%) and twenty-two perished (73.3%).

Table 2

Mean values ± SD of rectal temperature (°C), heart rate (beats/min) and respiratory rate (breaths/min) in newborn Boer goats with foot-and-mouth disease complicated by *Clostridium perfringens* strain B1
Variables	Groups
	Before treatment (n = 13)	After treatment (n = 8)	Reference range^*	P - value
Rectal temperature (°C)	40.5 ± 0.93	39.12 ± 0.70	38.8–40.2	0.001
Heart rate (beats/min)	125 ± 7.07	105 ± 6.02	100–120	0.0001
Respiratory rate (breaths/min)	36.8 ± 5.57	26 ± 4.27	20–40	0.0001
^* [36] Jackson, P., & Cockcroft, P. (2008). Clinical examination of farm animals. John Wiley & Sons. Blackwell Science Ltd pp 301

Clinical presentation

Affected kids showed sudden attacks of apathy followed by recumbency and died within a short time (minutes to several hours) (supplementary file 1). The kids showed tachycardia, tachypnoea and pyrexia compared to the reference interval values (Table 2). The heart rates, respiratory rates and rectal temperature decreased significantly (P < 0.05) in animals received medical therapy. On the other hand, adult goats showed minimal clinical signs, including lameness that lasted several days and did not require medical treatment. No deaths were recorded in the adult goats.

Haematology

Erythrocyte counts (10⁶/µl) was lower than reference values, but there was no statistically significant change (p = 0.193) after medical treatment. Haemoglobin (g/dl) and packed cell volume (%) were within the reference range after medical treatment with no significant difference (p = 0.154, 0.238). Total (10³/µl) and differential leukocyte counts were within the reference ranges but reached their upper limits. However, after medical treatment, total leukocytes and lymphocytes (10³/µL) increased significantly (p = 0.002 and p = 0.010, respectively) (Table 3).

Table 3

Mean values ± SD of haematological variables in newborn Boer goats with foot-and-mouth disease complicated by *Clostridium perfringens* strain B1
Variables	Groups
	Before treatment (n = 13)	After treatment (n = 8)	Reference range^**	Reference values^*	P - value
RBCs (10⁶/µL)	3.53 ± 01.03	2.72 ± 0.94	8.0–18.0	13.4 ± 3.3	0.193
Hb (g/dl)	10.90 ± 0.51	9.75 ± 1.92	8.0–12.0	8.4 ± 0.9	0.154
PCV (%)	32.43 ± 1.62	29.63 ± 5.69	22.0–38.0	25.1 ± 3.4	0.238
TLC (10³/µL)	10.48 ± 1.52	14.50 ± 1.94	4.0–13.0	9.24 ± 2.42	0.002
Neutrophil (10³/µL)	2.99 ± 0.78	4.12 ± 1.73	1.20–7.20	3.02 ± 0.2	0.232
Lymphocyte (10³/µL)	7.42 ± 1.57	10.38 ± 1.27	2.0–9.0	5.77 ± 0.22	0.010
Monocyte (10³/µL)	0.05 ± 0.09	0.00 ± 0.00	0.00–0.50	0.19 ± 0.01	0.173
^[33] Holman, H. H., & Dew, S. M. (1965). The Blood Picture of the Goat: III.—Changes in Haemoglobin Concentration and Physical Measurements Occurring with Age. Research in Veterinary Science*, 6(2), 245–255. 1 month
Old
^** [34] Radostits, O.M., Gay, C.C., Blood, D.C. and Hinchcliff, K.W. (2000) Veterinary Medicine, 9th edn, W.B. Saunders, London, pp. 1819–1822.

Biochemical analysis

Although serum ALT (U/L), AST (U/L), LDH (U/L), and CK-MB (U/L) were within reference intervals, there was a significant (p < 0.05) decrease in their activities after medical therapy. The concentrations of serum total protein (g/dL) and globulin (g/dL) were above the reference ranges, while concentrations of serum albumin (g/dL) and A/G ratio were different in a diverse manner. Concentrations of protein profile variables showed no significant changes (p > 0.05) after drug treatment (Table 4).

Table 4

Mean values ± SD of serum biochemical variables in newborn Boer goats with foot-and-mouth disease complicated by *Clostridium perfringens* strain B1
Variables		Groups
	Before Treatment (n = 13)	After treatment (n = 8)	Reference range^*	P - value
ALT (U/L)	52.67 ± 2.68	30.88 ± 12.37	-	0.036
AST (U/L)	59.52 ± 1.71	39.97 ± 7.69	0–300	0.003
LDH (U/L)	247.25 ± 19.27	216.50 ± 1.29	0-400	0.049
CK-MB (U/L)	26.00 ± 3.16	21.50 ± 1.29	0-100	0.039
Total protein (g/dl)	9.08 ± 0.43	8.88 ± 0.26	6.2–7.9	0.456
Albumin (g/dl)	2.76 ± 0.54	2.15 ± 0.48	2.9–4.3	0.143
Globulin (g/dl)	6.14 ± 0.46	6.72 ± 0.65	3.3–3.6	0.244
A/g ratio	0.46 ± 0.12	0.34 ± 0.09	0.87–1.19	0.166
^*[35] Matthews, J. (1999) Diseases of the Goat, Blackwell Science, Oxford, p. 332.

Molecular study

A distinct band, at the expected 328 bp, showed the presence of FMDV (Fig. 1). Further typing revealed a band at 1,165 bp using the primer pair O-1C244F/EUR-2B52R, confirming the type O strain (Fig. 2). Isolates of C. perfringens were recovered from lung, liver, brain, spleen, kidney, and intestine of all necropsied animal (Fig. 3). The isolates that had a distinct band at 279-bp using species-specific primers were confirmed as C. perfringens strain B1 by sequencing of the DNA products (supplementary file 2). The CPA toxin gene was detected in all isolates (Fig. 4).

Gross and microscopic examination

The carcasses were in fair condition up on gross examination. Foot and oral lesions were not seen. Pneumonic lesions involving both lung lobes were seen in all cases. Lung lobes were congested and revealed moderate consolidation with no froth in the airways (Fig. 5A). A slightly congested heart, liver, and swollen intestinal loops with yellowish discoloration were also noticed (Fig. 5B).

Microscopic examination revealed various pathological lesions in the lungs, liver, heart, spleen, intestine, kidneys, and brain (Figs. 6–11). Lung sections showed pneumonic areas characterized by alveoli plugged with eosinophilic fluid, neutrophils and macrophages (Fig. 6A-E). A microscopic examination of the trachea showed no pathognomonic lesions. Liver sections showed dilated and congested sinusoids, vacuolar degeneration of hepatocytes with many of apoptotic hepatocytes (Fig. 7A&B).

Heart sections showed congested blood vessels, oedema, infiltration of lymphocytes, macrophages and polymorphs around blood vessels and in the interstitial tissue in auricles and ventricles (Fig. 8A-D). Spleen sections showing congested red pulp, few small and ill-defined lymphoid follicles (Fig. 9A&B). Intestinal sections showing congested blood vessels in jejunum, loss of ileal villi, oedema in submucosa, and leukocytic cells infiltrating ileal serosa (Fig. 10A-D).

Kidney sections showed congested blood vessels, slightly edematous Bowman's capsule, and mildly degenerated tubular epithelium (Fig. 11A&B). Brain sections also revealed marked perineural edema, congested blood vessels with perivascular edema in cerebral cortex, and congested blood vessels in cerebellum (Fig. 12A-C).

Medical Management

Of all kids who received medical treatments (n = 13), only eight survived (61.5%), while we were unable to save the lives of five.

FMD was initially recognised on the basis of reported history, inconspicuous symptoms in adult goats and sudden deaths in newborn goats. Haematobiochemical findings combined with clinical data were not sufficient to make a definitive diagnosis of the disease. However, microbiological and histological investigations were required to confirm the diagnosis. Two factors contributed to the diagnosis of the disease and explained the persistent viral activity and clinical course of FMD in the goats studied: (1) FMD infection occurred simultaneously with that of large ruminants in the study region; (2) sheep and goats were not included in the regular vaccination programme in Egypt.

The clinical signs of FMD in the infected adult goats were mild, and neither oral lesions nor systemic disease developed in the adult goats. These results differ from previous studies [7–9]. Jaisree and others documented a spontaneous epidemic of serotype O FMD in sheep and goats in India, in which affected animals showed characteristic symptoms such as fever, lameness, bilateral mucopurulent nasal discharge, congested conjunctival mucosa, cheek ulcers, and erosions. The authors also claimed that no clinical signs were observed in goats and lambs because they were sorted out shortly after infection [7]. Sudden deaths were also observed in lambs with the type O strain in Turkey [24] and in lambs and goats with the same type FMDV in India [25].

In the study conducted by Lazarus and others, goats exposed to the SAT1 serotype, produces fever, nasal discharge, ulcerative oral lesions, and foot lesions [8]. Despite this, goats in the latter study did not show lameness, and the challenged goats had normal appetites throughout the research study. In another experimental study [9], it has shown that sheep and goats challenged by FMD serotype O via coronary band route and the coronary band and intra-dermo-lingual route exhibited classical clinical signs of FMD (including inappetence, panting, pyrexia, and lameness) at 2–5 days post challenge. Whereas intra-dermo-lingually challenged sheep and goats did not exhibit FMD clinical signs. Other authors believed that FMDV-caused oral lesions could be more common in goats than in sheep [26]. In field epidemics involving both sheep and goats, the symptoms in the latter species were often milder [26].

Here, the disease onset was caused by FMDV serotype ‘O’ and histopathological findings showed different post-mortem lesions, while C. perfringens strain B1 was cultured, and the CPA toxin gene was detected in all tissues. In a previous study, it was estimated that FMD serotype "O" was responsible for 90% of FMD outbreaks in small ruminants worldwide [27]. As far as we know, this is the first study to report Clostridium infection as a complication of FMD in Boer goats worldwide. As natural cases of C. perfringens-related spontaneous pneumonia have rarely been described in the medical literature [28], the findings described here are consistent with a previous report documenting the ability of C. perfringens to affect the respiratory system by causing either severe acute pulmonary oedema, particularly in the interlobular septa in calves [29], or bronchopneumonia in cattle and buffaloes [23].

Surprisingly, the histopathological results of the heart tissue of the affected animals did not show hyaline degeneration or coagulative necrosis indicative of myocarditis. These findings are not consistent with reports previously described in lambs with type O FMDV in Turkey [24] and in lambs and goats with type O FMDV in India [25]. All heart tissues examined in these studies showed inflammatory infiltration, hyaline degeneration and necrosis of myocyte sheets. However, the cellular infiltrates (including lymphocytes, macrophages and neutrophils) were comparable to what we saw in our cases. The histopathological findings reported in our study could mimic the results of the CK-MB values, which showed insignificant changes comparable to the reference intervals. Boer kids could show less damage to cardiac tissue when infected with FMD. A previous report suggested that some breeds of calves (e.g., Malnad Gidda) may have fewer cardiac abnormalities due to FMD than others (e.g., Hallikar and HF cross calves) [3]. Therefore, further studies are needed to investigate the cardiac changes in Boer kids infected with FMD under natural conditions.

The complication of FMD-infected goats with bacterial infections such as C. perfringens could be due to the decrease of body immunity associated with viral infection. This consideration may be consistent with that described in a previous study [30]. However, the cause of systemic clostridial dispersion in the afflicted kids is still unknown. The CPA toxin gene was recently discovered for the first time in Egyptian cattle and buffalo herds with symptoms of panting and nasal discharge due to FMD infection [23].

The changes in the erythrocytic indices of the infected kids could indicate intravascular haemolysis caused by the CPA toxin. This finding is consistent with previous reports [13, 31]. The authors suggested that the intravascular haemolysis and capillary damage, platelet aggregation, hepatic necrosis and cardiac effects observed in animals with suspected C. perfringens infection are consistent with the action of a circulating toxin such as CPA. On the other hand, leukocytosis and lymphocytosis observed in affected kids, especially after drug treatment, could be indicative of ongoing systemic inflammation. These findings were consistent with those found in sheep with enterotoxaemia [31]. It has also been suggested that granulopoiesis may enhance the innate immune system of the host to protect it against bacterial infections [12].

The increase in serum total protein, globulin and decrease in serum albumin in the affected kids could indicate ongoing systemic inflammation. These findings were unlike to those previously collected in sheep and goats with an outbreak of FMDV serotype “O” in India [7]. In this study, the authors noted a marked decrease in serum total protein and an increase in liver enzymes. Several other studies reported hypoproteinaemia, hypoalbuminaemia and increased activities of ALT and AST in cattle with FMD infection [32] and in sheep that had enterotoxaemia caused by C. perfringens [31].

It is becoming increasingly clear that understanding the clinical presentation of complicated FMD cases in natural cases and the associated haematology and serum biochemistry is critical to developing therapeutic approaches to reduce the deleterious effects of infection in affected animals. Although this is the first report to look at Clostridium infections as a cause of death in Boer kids with FMD, the study has its own limitations, including a small sample size and lack of a control group, which may preclude a firm conclusion.

This study is the first to report an outbreak of sudden deaths in Boer goats on an organised farm in Dakahlia Governorate, Egypt, attributed to FMD infection with C. perfringens strain B1. Boer goats could be a potential carrier for transmission of FMD to cattle and buffalo. The present results would improve our understanding of the clinical presentation of FMD infections in goats under natural conditions. Based on the study results, goats should be included in a regular FMD vaccination programme to prevent future outbreaks.

The study followed the Guidelines for the Care and Use of Farm Animals in Research and Teaching (3^rd edition), and complied with the IUCN Policy Statement on Research Involving Species at Risk of Extinction and the Convention on the Trade in Endangered Species of Wild Fauna and Flora. The experimental protocols were approved by Mansoura University and its licensing committee. All methods used were carried out in accordance with the relevant guidelines and regulations of Mansoura University.

Ethics Approval and Consent to Participate

The field study complies with institutional, national or international guidelines and the local ethics committee (Medical Research Ethics Committee of Mansoura University). The animals were enrolled in the study with the consent of their owner and were provided with a document containing information on the definition of the disease, its economic impact and possible clinical consequences.

Consent for publication

A written consent to publish images and supplementary videos was granted under the Creative Commons Attribution Licence 4.0.

Availability of Data and Materials

The datasets generated and/or analysed during the current study are available in the National Centre for Biotechnology Information (NCBI) at the following link: https://www.ncbi.nlm.nih.gov/nuccore/OM616931.1/, accession number OM616931.

Competing Interest

The authors declare that they have no conflict of interest.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Authors' contributions

MEA conceived and designed the study, undertook the clinical investigations, interpreted the data and wrote the manuscript. R.K, S.A.E.R performed virological investigations, S.S and W.A performed pathological investigations, A.A performed bacteriological investigations, F.A and E.R performed the clinicopathological data. All authors contributed to the draft of the manuscript, revised it and approved the final version of the manuscript.

Acknowledgements

The authors thank the farm owner for supplying all facilities and information needed to carry out the study.

Ferretti L, Di Nardo A, Singer B, Lasecka-Dykes L, Logan G, Wright CF, et al. Within-host recombination in the foot-and-mouth disease virus genome. Viruses. 2018;10(5):1–14.
Sutmoller P, Barteling SS, Olascoaga RC, Sumption KJ. Control and eradication of foot-and-mouth disease. Virus Res. 2003;91(1):101–44.
Saravanan S, Umapathi V, Priyanka M, Hosamani M, Sreenivasa BP, Patel BHM, et al. Hematological and serum biochemical profile in cattle experimentally infected with foot-and-mouth disease virus. Vet World. 2020;13(3):426–32.
Brito BP, Rodriguez LL, Hammond JM, Pinto J, Perez AM. Review of the Global Distribution of Foot-and-Mouth Disease Virus from 2007 to 2014. Transbound Emerg Dis. 2017;64(2):316–32.
Madhanmohan M, Nagendrakumar SB, Kumar R, Anilkumar J, Manikumar K, Yuvaraj S et al. Clinical protection, sub-clinical infection and persistence following vaccination with extinction payloads of O1 Manisa foot-and-mouth disease monovalent vaccine and challenge in goats and comparison with sheep. Res Vet Sci [Internet]. 2012;93(2):1050–9. http://dx.doi.org/10.1016/j.rvsc.2011.10.006.
Hashem M, El-Mandrawy S, El- Araby I, El- Sayed A. Molecular Diagnosis of Foot and Mouth Disease Virus in Cattle with Reference to Hematological and Biochemical Changes. Zagazig Vet J. 2018;46(2):105–16.
Jaisree S, Hemaltha S, Mahaprabhu R, Roy P, Murali N, Arun L, et al. Outbreak of Foot and Mouth Disease in an organized sheep and goat farm. Indian Vet J. 2016;93(11):31–3.
Lazarus DD, Mutowembwa PB, Sirdar MM, Rametse TM, Heath L, Opperman PA, et al. Clinical presentation of FMD virus SAT1 infections in experimentally challenged indigenous South African goats. Small Rumin Res. 2019;180:15–20.
Muthukrishnan M, Singanallur Balasubramanian N, Villuppanoor Alwar S. Experimental Infection of Foot and Mouth Disease in Indian Sheep and Goats. Front Vet Sci. 2020;7(June):1–7.
Díaz-San Segundo F, Rodríguez-Calvo T, de Avila A, Sevilla N. Immunosuppression during acute infection with foot-and-mouth disease virus in swine is mediated by IL-10. PLoS ONE. 2009;4(5).
Chandranaik BM, Hegde R, Shivashankar BP, Giridhar P, Muniyellappa HK, Kalge R, et al. Serotyping of foot and mouth disease virus and Pasteurella multocida from Indian gaurs (Bos gaurus), concurrently infected with foot and mouth disease and haemorrhagic septicaemia. Trop Anim Health Prod. 2015;47(5):933–7.
Fu Y, Alenezi T, Sun X. Clostridium perfringens-Induced Necrotic Diseases: An Overview. Immuno. 2022;2(2):387–407.
Uzal FA, Songer JG. Diagnosis of Clostridium perfringens intestinal infections in sheep and goats. J Vet Diagnostic Investig. 2008;20(3):253–65.
Sakurai J, Ochi S, Tanaka H. Evidence for coupling of Clostridium perfringens alpha-toxin-induced hemolysis to stimulated phosphatidic acid formation in rabbit erythrocytes. Infect Immun. 1993;61(9):3711–8.
Hickey MJ, Kwan RYQ, Awad MM, Kennedy CL, Young LF, Hall P et al. Molecular and cellular basis of microvascular perfusion deficits induced by Clostridium perfringens and Clostridium septicum. PLoS Pathog. 2008;4(4).
Mason PW, Grubman MJ. Foot-and-Mouth Disease. Vaccines Biodefense Emerg Neglected Dis. 2009;(May):361–77.
Khan S, Ali Shah SA, Jamal SM. Evaluation of sandwich enzyme-linked immunosorbent assay and reverse transcription polymerase chain reaction for the diagnosis of foot-and-mouth disease. Intervirology. 2021;64(4):209–14.
Knowles NJ, Wadsworth J, Bachanek-Bankowska K, King DP. VP1 sequencing protocol for foot and mouth disease virus molecular epidemiology. OIE Rev Sci Tech. 2016;35(3):741–55.
Zhang T, Zhang W, Ai D, Zhang R, Lu Q, Luo Q, et al. Prevalence and characterization of Clostridium perfringens in broiler chickens and retail chicken meat in central China. Anaerobe. 2018;54:100–3.
Jousimies-Somer H. Wadsworth-KTL anaerobic bacteriology manual. (No Title) [Internet]. [cited 2023 Jul 10]; Available from: https://cir.nii.ac.jp/crid/1130282272595631872.
Wang RF, Cao WW, Franklin W, Campbell W, Cerniglia CE. A 16S rDNA-based PCR method for rapid and specific detection of Clostridium perfringens in food. Mol Cell Probes. 1994;8(2):131–7.
Yoo HS, Lee SU, Park KY, Park YH. Molecular typing and epidemiological survey of prevalence of Clostridium perfringens types by multiplex PCR. J Clin Microbiol. 1997;35(1):228–32.
Elgioushy M, Rizk MA, El-Adl M, Elhadidy M, El-Khodery S. The first molecular detection of Clostridium perfringens from pneumonic cases associated with foot and mouth disease in cattle and buffalo in Egypt. Trop Anim Health Prod. 2019;51(4):847–52.
Gulbahar MY, Davis WC, Guvenc T, Yarim M, Parlak U, Kabak YB. Myocarditis associated with foot-and-mouth disease virus type O in lambs. Vet Pathol. 2007;44(5):589–99.
Hemanth I, Amaravathi P, Babu NS, Kumar AA, Sailaja N. Malignant form of foot and mouth disease outbreak in sheep and goat with reference to cytological and histopathlogical findings. Indian J Vet Pathol. 2014;38(2):82.
Arzt J, Baxt B, Grubman MJ, Jackson T, Juleff N, Rhyan J, et al. The Pathogenesis of Foot-and-Mouth Disease II: Viral Pathways in Swine, Small Ruminants, and Wildlife; Myotropism, Chronic Syndromes, and Molecular Virus-Host Interactions. Volume 58. Transboundary and Emerging Diseases; 2011.
Kitching RP, Hughes GJ. Clinical variation in foot and mouth disease: sheep and goats. Rev Sci Tech [Internet]. 2002 Dec 1 [cited 2023 Jul 10];21(3):505–12. Available from: https://europepmc.org/article/med/12523691.
Palmacci C, Antocicco M, Bonomo L, Maggi F, Cocchi A, Onder G. Necrotizing pneumonia and sepsis due to Clostridium perfringens: A case report. Cases J. 2009;2(1):1–3.
Peter D, Constable KWHSHDWG. Veterinary Medicine: A textbook of the diseases of cattle, horses, sheep … Peter D. Constable, Kenneth W Hinchcliff, Stanley H. Done, Walter Gruenberg - Google Books [Internet]. [cited 2023 Jul 10]. Available from: https://books.google.com.eg/books?hl=en&lr=&id=mx5uDQAAQBAJ&oi=fnd&pg=PP1&dq=info:__7ZSRy3wB8J:scholar.google.com&ots=PdQbI_fibD&sig=kdh_TaQhHm1fi-xI7Lsn_FTnNsE&redir_esc=y#v=onepage&q&f=false.
Francoz D, Buczinski S, Bélanger AM, Forté G, Labrecque O, Tremblay D, et al. Respiratory Pathogens in Québec Dairy Calves and Their Relationship with Clinical Status, Lung Consolidation, and Average Daily Gain. J Vet Intern Med. 2015;29(1):381–7.
Hassanein KMA, Sayed MM, Hassan AM. Pathological and biochemical studies on enterotoxemia in sheep. Comp Clin Path. 2017;26(3):513–8.
Ghanem MM, Abdel-Hamid OM. Clinical, haematological and biochemical alterations in heat intolerance (panting) syndrome in Egyptian cattle following natural foot-and-mouth disease (FMD). Trop Anim Health Prod. 2010;42(6):1167–73.
Holman HH, Dew SM. The Blood Picture of the Goat: III.—Changes in Haemoglobin Concentration and Physical Measurements Occurring with Age. Res Vet Sci. 1965;6(2):245–55. 1 month Old.
Radostits OM, Gay CC, Blood DC, Hinchcliff KW. Veterinary Medicine. 9th ed. London: W.B. Saunders; 2000. pp. 1819–22.
Matthews J. Diseases of the Goat. Oxford: Blackwell Science; 1999. p. 332.
Jackson P, Cockcroft P. Clinical examination of farm animals. John Wiley & Sons. Blackwell Science Ltd; 2008. p. 301.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Clinical and laboratory investigations of a sudden death syndrome in newborn Boer goats

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

Introduction

Materials and Methods

Sampling and samples processing

Blood samples

Specimens

Genomic DNA extraction

Molecular characterization of C. perfringens

Sequencing of DNA products

Molecular detection of C. perfringens alpha toxin gene

Postmortem specimens

Medical management

Statistical analysis

Results

Clinical presentation

Haematology

Biochemical analysis

Molecular study

Gross and microscopic examination

Medical Management

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1