Cloning of PGRP Gene and Its Expression Responding to the Stimulations of Vibrio Alginolyticus, LPS, and Poly (I:C) in Pinctada fucata

doi:10.21203/rs.3.rs-3337036/v1

Download PDF

Research Article

Cloning of PGRP Gene and Its Expression Responding to the Stimulations of Vibrio Alginolyticus, LPS, and Poly (I:C) in Pinctada fucata

https://doi.org/10.21203/rs.3.rs-3337036/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The PfPGRP gene from the pearl oyster Pinctada fucata was cloned and expressed in different tissues with and without stimulation by Vibrio alginolyticus, LPS, and Poly (I:C) to investigate its role in the immune response. The cDNA sequence of PfPGRP was 789 bp long, containing an open reading frame of 591 bp that encoded 196 amino acids. Phylogenetic analysis showed that the genetic distance between vertebrate and invertebrate PGRPs was significant, and the homology of PGRP gene sequences in mollusks was around 50%. The PfPGRP gene had the highest homology with the PGRP gene from Crassostrea gigas, at 72.9%. Protein domain prediction identified a conserved canonical PGRP domain and an Ami_2 domain in PfPGRP, suggesting that it could hydrolyze invading bacteria and terminate the immune response. Quantitative PCR showed that PfPGRP was expressed constitutively in all tissues, with the highest levels in the mantle, followed by the gonad and hepatopancreas. The expression of PfPGRP in the mantle was significantly upregulated after LPS injection, indicating that this tissue is more sensitive to LPS and plays a crucial role in defending against bacterial invasions. Similarly, the expression of PfPGRP in the hepatopancreas was significantly upregulated after both Vibrio and LPS injections, but reached its maximum later in the Poly (I:C) group, suggesting that it is more sensitive to bacteria and may be involved in bacterial elimination.Overall, these results suggest that PfPGRP plays an essential role in the innate immune system of P. fucata and is involved in defense against bacterial and viral invasions.

Pinctada fucata

PGRP

gene cloning

gene expression

immune stimulation

The immune system can be broadly classified into two categories: innate immunity and acquired immunity[1]. While vertebrates possess both innate and acquired immunity systems, invertebrates rely solely on their innate immunity to protect themselves against pathogens. Invertebrates recognize pathogen-associated molecular patterns (PAMPs) using pattern recognition receptors (PRRs), which include polysaccharides, lipopolysaccharides (LPS), peptidoglycans (PGN), bacterial DNAs, RNAs of double-stranded viruses, and other molecules that are typically absent from the surfaces of multicellular organisms[2]. PGN is a key recognition target in the innate immunity of invertebrates, and PGN recognition proteins (PGRPs) play a crucial role in recognizing and responding to PGN[3]. Interestingly, PGRPs show structural conservation across both vertebrates and invertebrates, highlighting their importance in the innate immune response.

PGRPs are essential pattern recognition receptors (PRRs) involved in the innate immune system of various species. The first PGRP, with a molecular weight of 19 kDa[4], was isolated and characterized from the hemolymph of silkworms in 1996.Since then, PGRPs have been identified in numerous other organisms, including Anopheles gambiae[5], Drosophila melanogaster[6], Homo sapiens[7], Mus musculus[8], Hyriopsis cumingii[9], etc. Studies on PGRPs of marine animals started late, but an increasing number of studies have investigated on PGRPs of Crassostrea gigas[10], mussels[11], Azumapecten farreri[12], and so on in recent years. Depending on the length of their amino acid sequence, PGRPs can be categorized into three subclasses: short PGRPs (PGRP-S), long PGRPs (PGRP-L), and intermediate PGRPs (PGRP-I). While PGRP-S and PGRP-L are found in both invertebrates and vertebrates, PGRP-I is exclusive to mammals[14]. Invertebrate PGRPs play a crucial role in triggering the innate immune response to pathogens through multiple mechanisms. For instance, in Drosophila, PGRP-SA and PGRP-SD collaboratively activate the Toll pathway in response to Lys-type PGN, leading to the transcription of antimicrobial peptides[15]. Moreover, PGRP-LE and PGRP-LC function as signal transduction receptors that stimulate the death domain-containing immunodeficiency (IMD) proteins and result in the production of antimicrobial peptides that eliminate bacteria[16].Notably, PGRP-SC and PGRP-LB can regulate the immune response to bacterial infection by inhibiting the activation of the IMD pathway[17]. Similarly, PGRPs in marine organisms possess amidase activity and can degrade PGN, ultimately hindering bacterial growth. Overall, PGRPs play a vital role in safeguarding against potential pathogens in various species.

Research on pattern recognition receptors (PGRPs) in shellfish has been limited, with only a few studies conducted thus far. One of these studies identified a PGRP in the freshwater pearl mussel, Hyriopsis cumingii, designated as HcPGRP2, which possesses a molecular weight of approximately 33 kDa and contains two SH3b domains and a canonical PGRP domain[17]. Notably, PGRPs with dual SH3b domains are relatively uncommon. Functional analysis revealed that HcPGRP2 exhibits various immune-related activities, including binding to peptidoglycan (PGN), microbial binding, antibacterial activity, and regulation of immune genes. These findings suggest that HcPGRP2 may play a role in recognizing and eliminating pathogens through its bacterial recognition and effector functions[13].Another study identified two PGRPs in the mollusk Solen grandis, termed SgPGRP-S1 and SgPGRP-S2, which are secreted proteins lacking transmembrane domains[13].which is consistent with other PGRPs identified from mollusks, such as CfPGRP-S1, AiPGRP, and CgPGRPs[11, 20]. All the PGRPs identified from mollusks so far are PGRP-S, suggesting a PGRP-mediated immune defense mechanism probably different from those in Drosophila and Homo sapiens.

P. fucata, a species of warm-water marine bivalve mollusk in the family Pteriidae, is the primary source of seawater pearls in China, accounting for over 95% of the country's total seawater pearl production[21]. However, the mortality rate of P. fucata has been increasing in recent years due to the expansion of aquaculture and deterioration of seawater quality[22]. This has highlighted the need for a better understanding of the species' immune regulation mechanism to develop effective disease control strategies and ensure the long-term sustainability of P. fucata culture[23]. In pursuit of this goal, the PGRP gene from P. fucata was cloned, and its immune responses to Vibrio alginolyticus, LPS, and Poly (I:C) stimulations were studied. This research aims to provide a foundation for future investigations into the role of PGRPs in the immune response of P. fucata.

2.1 Experimental materials

Healthy P. fucata individuals aged 18 months were purchased from a pearl farm in Beihai, Guangxi, China and temporarily maintained in a laboratory aquarium system. The water was changed every two days, and the mollusks were fed Chlorella vulgaris. After a week of acclimation, 10 healthy P. fucata were selected for dissection. Various tissues, including adductor muscle, hemolymph, intestine, heart, hepatopancreas, foot, gill, mantle, and gonad, were carefully excised and quickly frozen in liquid nitrogen. The frozen tissue samples were then stored at -80°C for later analysis.

2.2 Extraction of total RNA and synthesis of cDNA

The total RNA of the sample was extracted using the Tirzol method, which is a widely used protocol for isolating high-quality RNA from various sources. The integrity of the total RNA was evaluated by visualizing it on a 10 g/L agarose gel. The concentration of the total RNA was subsequently measured using a high-throughput microfluidic full-spectrum spectrophotometer. Next, we synthesized cDNA from the total RNA using a FastKing RT Kit (with gDNase). The resulting cDNA was then stored at -80°C for later use.

2.3 Cloning of PGRP cDNA

To obtain the full-length cDNA sequence of the PGRP gene, we first performed PCR-based cloning of the intermediate fragments using specifically designed primers PGRP-F and PGRP-R (Table 1). The PCR reaction mixture consisted of 9.5 µL of ddH2O, 12.5 µL of 2×Es Taq MasterMix (Dye), 1.0 µL of each forward/reverse primer (F/R), and 1.0 µL of cDNA template. The PCR cycling conditions included an initial denaturation step at 94°C for 2 minutes, followed by 34 cycles of 94°C for 30 seconds, 50°C for 30 seconds, and 72°C for 30 seconds, and a final extension step at 72°C for 2 minutes. The PCR product was then analyzed by agarose gel electrophoresis, and the desired band was excised and purified using the M5 Gel Extraction Kit (with column).

Table 1

Primer sequences used in the cloning and real-time PCR of PGRP
Primer name	Sequence(5’-3’)	Purpose
PGRP-1-F	CGAAGTAAATGGGGAGCAG	cDNA克隆
PGRP-1-R	GCCGGGTGAGTTAGTATGGT	cDNA克隆
PGRP-1-5' -GSP1	TTTGGTGCTGCGTGTTC	5' -RACE
PGRP-1-5' -GSP2	TAACGGCTCTACCCTCC	5' -RACE
PGRP-1-5' -GSP3	GTCCTCCTACTACATTCCAG	5' -RACE
PGRP-1-3' -GSP1	CGACTAAGGACGAGTGTATC	3'-RACE
PGRP-1-3' -GSP2	CGAGGCTGGAATGTAGT	3'-RACE
PGRP-1-qF	ATCGCCAACATTGTACGACT	qRT-PCR
PGRP-1-qR	GCGACCTTCATACACATTACCG	qRT-PCR

The purified PCR product was then ligated into the M5 Hiper pTOPO-TA Vector, and the recombinant plasmid was transformed into Escherichia coli DH5α competent cells. The transformants were grown overnight in LB solid medium, and positive clones were screened and sent to Guangzhou Sangon Biotech Co., Ltd. for sequencing.

Using the obtained PGRP sequence, we further designed 3'RACE and 5'RACE specific amplification primers (Table 1) with Primer Premier 5.0 software. The 5'/3'-Full RACE Kit (TaKaRa) was then employed for RACE amplification to obtain the full-length cDNA sequence of the PGRP gene.

2.4 PGRP gene sequencing

Sequence alignment and homology analysis were performed using the Blast program on the NCBI website (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Nucleic acid sequence assembly and analysis of cloning results were conducted with DNAMAN5.2 (Lynnon Biosoft). Amplified fragments were analyzed using Chromas. Sequences were aligned and analyzed using Megalign. Protein phosphorylation sites were predicted using NetPhos 2.0 (http://www.cbs.dtu.dk/services/NetPhos/). Multiple sequence alignment of the AA sequences of the PGRP genes of P. fucata and other species was performed using ClustalX 1.83 (http://www.ebi.ac.uk/clustalw/). A phylogenetic tree was constructed in MEGA 7.0 using the neighbor-joining (NJ) method.

2.5 PGRP tissue expression analysis

Total RNA was extracted from eight healthy P. fucata tissues (adductor muscle, hemolymph, intestine, heart, hepatopancreas, foot, gill, mantle, and gonad) using the Trizol method. One tube of each tissue sample was cryopreserved in liquid nitrogen and stored at -80°C for future use. cDNA was synthesized from the total RNA using a reverse transcription kit, following the manufacturer's protocol. The resulting cDNA was used as a template for real-time PCR, which was performed under the following conditions: 95°C for 5 minutes, followed by 34 cycles of 95°C for 10 seconds, 60°C for 15 seconds, and 72°C for 15 seconds. Finally, the temperature was raised to 95°C for 10 seconds, then lowered to 65°C for 60 seconds, and finally raised again to 97°C for 1 second. Each reaction was run in triplicate, and the average threshold cycle (CT) value was calculated for each sample.

2.6 Analysis of PGRP gene expression post immune stimulation

Eight pearl oysters (P. fucata) were divided into five groups: blank, control, Vibrio alginolyticus, Poly (I:C), and LPS. The blank group received no treatment, while the control group received an intramuscular injection of 100 µL PBS (pH 6.8) into the adductor muscle. The Vibrio alginolyticus experimental group received a 100 µL injection of Vibrio suspension with an OD600 value of 0.4 into the adductor muscle. The LPS experimental group received a 100 µL injection of LPS solution at a mass concentration of 1×10^− 3g/L into the obturator muscle, and the Poly (I:C) experimental group received a 100 µL injection of Poly (I:C) solution at a mass concentration of 1.0×10^− 3g/L into the adductor muscle. Samples of adductor muscles, hemolymphs, intestines, hearts, hepatopancreases, feet, gills, mantles, and gonads were taken from each group at 0 h, 1 h, 3 h, 6 h, 12 h, 24 h, 48 h, 72 h, and 96 h after injection, flash-frozen in liquid nitrogen, and stored at -80°C for subsequent analysis.

2.7 Data processing

We used SPSS 22.0 software to analyze the experimental data. We performed a one-way analysis of variance (ANOVA) to compare the means of the different groups. We also used the LSD method to make multiple comparisons between the groups. The results are shown as the mean ± standard error (SE). We considered a difference to be significant if the p-value was less than 0.05.

3.1 cDNA sequencing of the PGRP Gene of P. fucata

3.2 PGRP sequence alignment and phylogenetic analysis

To investigate the evolutionary relationships between the PGRP gene of P. fucata and those of other species, we performed a BLAST analysis on NCBI website. Our results showed that the PGRP gene of P. fucata exhibits the highest degree of similarity (72.9%) with the PGRP gene of C. gigas (accession number XP_011438455.2), followed by a lower but still significant level of similarity (54.1%) with the PGRP gene of Mizuhopecten yessoensis (accession number XP_021355549.1).

High levels of homology were detected in comparisons of PGRP AA sequences among various species. Specifically, the PGRP AA sequence of PfPGRP showed strong similarity to those of C. gigas, M. yessoensis, and C. virginica (XP_022286547.1.) (Fig. 4). In addition, the PGRP AA sequence of PfPGRP shared high homology with those of other invertebrates, such as H. cumingii (AGU68334.1), Oncorhynchus mykiss (XP_021437475.1), and Xenopus laevis (NP_001088771.1.), forming a distinct cluster in the phylogenetic tree. Interestingly, the PGRP AA sequence of PfPGRP was distant from those of insects and fishes, such as Danio rerio (NP_001038631.1) and Rhincodon typus (XP_020367652.1), indicating a divergent evolutionary pathway (Fig. 5). The results of this study provide new insights into the evolutionary history of PGRPs across different species.

3.3 Analysis of PGRP gene expression in tissues of P. fucata

Quantitative PCR analysis was employed to investigate the expression profile of the PGRP gene in various tissues of P. fucata. The results demonstrated that PfPGRP mRNA was expressed in all examined tissues, with varying levels of expression. Notably, the highest expression levels were observed in the mantle and gonad, followed by the hepatopancreas, feet, hemolymph, and intestine. Conversely, the lowest expression level was detected in the adductor muscle (Fig. 6). To further evaluate the differences in expression levels between tissues, a one-way analysis of variance (ANOVA) was performed, using the adductor muscle as a reference. The results revealed that the expression levels of PGRPs in the gills, heart, intestine, hemolymph, feet, hepatopancreas, mantle, and gonad were significantly higher compared to the adductor muscle (P < 0.05).

3.4 Responses of PGRP gene expression to different immune stimulations

After being exposed to V. alginolyticus, the expression of PGRP in the mantle of P. fucata increased significantly at 24 hours (Fig. 7a1), peaking at a value of 8.693, before decreasing sharply to a minimum value of 0.293. This represents a dynamic range of approximately 29.57 fold between the maximum and minimum values. Similarly, PGRP expression in the hepatopancreas of P. fucata fluctuated (Fig. 7a2), with significant upregulation observed at both 3 hours and 6 hours, reaching a maximum value of 4.931 at 6 hours, which was 5.27 times greater than the lowest value at 1 hour (0.935). PGRP expression was also significantly upregulated again at 72 hours. In contrast, there was no significant change in PGRP expression in the PBS control group.

PGRP expression in the mantle of P. fucata increased significantly after LPS stimulation, peaking at 6 hours (Fig. 7b1) and then decreasing, followed by a significant increase to the highest value of 45.663 at 72 hours, which was 124.76 times the lowest value at 1 hour. PGRP expression in the hepatopancreas also increased gradually over time, with significant upregulation at 6, 24, and 96 hours (Fig. 7b2), reaching a maximum value of 6.157 at 6 hours and a minimum value of 1.027 at 72 hours, with a dynamic range of approximately 6.00 fold. PfPGRP expression remained stable throughout the process in the PBS control group.

Following Poly (I:C) stimulation, PGRP expression in the mantle of P. fucata exhibited a fluctuating pattern (Fig. 7c1), with a significant increase to the highest level of 6.629 at 24 hours and a subsequent decrease to the lowest level of 0.503 at 48 hours, resulting in a dynamic range of approximately 13.18 fold. PGRP expression in the hepatopancreas also showed a fluctuating trend (Fig. 7c2), with significant upregulation at 12 and 24 hours, reaching a peak value of 6.766 at 12 hours, which was 6.54 times the lowest value at 0 hour (1.035). No significant changes were observed in PfPGRP mRNA expression in the PBS control group.

Increasing evidence suggests that PGRP plays a vital role in regulating various immune responses in both drosophila and vertebrates, exhibiting multiple immune activities. Although some PGRPs have been discovered in other animals, there have been limited reports on PGRP genes in mollusks until now[19]. In this study, we successfully obtained the full-length PGRP cDNA of P. fucata using RACE technology, naming it PfPGRP. The protein consists of 196 amino acids and contains a signal peptide at the N-terminus (amino acids 1–16), but lacks a transmembrane domain, classifying it as a PGRP-S. This finding aligns with other PGRPs identified in mollusks, including CfPGRP-S1, AiPGRP, and CgPGRP[24]. Notably, all PGRPs identified in mollusks thus far belong to the PGRP-S subfamily, suggesting that the PGRP-mediated immune defense mechanism in mollusks may differ significantly from those of Drosophila and Homo sapiens.

BLAST and phylogenetic tree analysis revealed that PfPGRP was genetically distinct from PGRPs of other species, with low overall homology. Therefore, we focused on comparing the domain sequences of PfPGRP with those of other PGRPs. Our analysis showed that PfPGRP was highly homologous to CgPGRPs of C. gigas, with a sequence identity of 72.9%. In fact, PfPGRP and CgPGRPs formed a distinct branch in the evolutionary tree. It's interesting to note that even though PGRPs from the same animal may belong to the same type, they don't always display high sequence similarity. For instance, the sequence identity between Ar-S2a and Ar-S1a was only 38% and 45%, respectively.

PGRPs can be categorized into different groups based on their predicted domains. The high variability among PGRP members suggests that they might have undergone separate adaptive evolutionary processes to cope with diverse pathogens. This hypothesis is supported by the observation that different PGRPs have varying degrees of similarity, even within the same species. Overall, our findings indicate that the diversification of PGRPs may be an adaptation to the complex pathogenic environment they encounter.

PGRPs are involved in various biological processes, including immune responses. Four PGRPs from bivalve mollusks, namely PfPGRP from P. fucata, AiPGRP from A. irradians, HcPGRP2 from H. cumingii, and HdPGRP from Haliotis discus hannai Ino, have been studied for their potential roles in immune functions. PfPGRP contains a highly conserved canonical PGRP domain (20–162) and an Ami_2 domain (31–170), which suggests that it may have amidase activity and the ability to recognize peptidoglycan (PGN). The PGRP domain of PfPGRP shows high similarity to the active site of type II N-acetyl hybridized acyl-L-alanine amidase (32–183), providing a theoretical basis for its amidase activity. Moreover, the amidase catalytic residues of PfPGRP are conserved, implying that it is likely to have amidase activity and the PGN recognition function. Notably, amidase activity can kill bacteria by hydrolyzing their cell walls, and some PGRPs with amidase activity can terminate the immune response by eliminating bacteria. While the immune responses in bivalves are not fully understood, it is speculated that PfPGRP may hydrolyze invading bacteria and terminate immune responses. AiPGRP is classified as a member of the PGRP-S family due to its predicted structural features, and it possesses three PGRP domains (I, II, and III) that are conserved in both invertebrates and vertebrates[25]. HcPGRP2 has multiple immunoactivities, including PGN binding, microbial binding, antibacterial activity, and immune gene regulation[18]. Lastly, HdPGRP contains an SH3b domain, a PGRP domain, and an Ami_2 domain, suggesting that it may be secreted extracellularly to recognize and bind peptidoglycan[26].

The expression levels of PGRPs differ among various tissues in bivalve mollusks. For example, AiPGRP is expressed in the gonad, gills, mantle, and adductor muscle in A. irradians, with the highest expression level detected in blood cells[25]. In C. gigas, CgPGRP-S1 and CgPGRP-S3 are predominantly expressed in the mantle and hepatopancreas, whereas CgPGRP-S2 is widely distributed throughout the body, with a higher expression level in blood cells[29]. In H. cumingii, HcPGRP is expressed in blood cells, hepatopancreas, gills, and mantle, with the highest expression level found in the hepatopancreas[28]. Similarly, the PfPGRP gene is expressed in various tissues of P. fucata, including the adductor muscle, hemolymph, intestine, heart, hepatopancreas, feet, gills, mantle, and gonad, with the highest expression level observed in the mantle, followed by the gonad and hepatopancreas. This suggests that PfPGRP, like scallop CfPGRP-S1[30], plays a crucial role in the immune system, and that the hepatopancreas, gonad, and mantle may be the primary effector organs involved in this process.

When exposed to certain bacteria, PGRP expression levels can be significantly upregulated in bivalve mollusks. For instance, CfPGRP-S1 expression was upregulated in the blood cells of C. farreri upon injection with M. lysodeikicus or V. anguillarum[29]. Similarly, CgPGRP-L expression was upregulated in the blood cells of C. gigas following exposure to M. halophilus or V. tubiashii[30]. In H. cumingii, HcPGRPS1 expression was significantly upregulated in tissues such as gonads and muscles after LPS injection[31]. Furthermore, AbPGRP expression was significantly upregulated in the hepatopancreas of H. discus hannai Ino after LPS injection. In addition, the expression of the PLYRP2 gene in human corneal epithelial cells was significantly increased after Poly (I:C) injection[32], and the expression levels of PGRP5 and PGRP6 genes in EPC cells of common carp also significantly increased post-Poly (I:C) infection[33].

To investigate the immune function of PfPGRP, an immune stimulation experiment was conducted using V. alginolyticus, LPS, and Poly (I:C) in this study. The results showed that PfPGRP expression was significantly up-regulated in both mantle and hepatopancreas tissues in response to the three immune stimuli, but the timing and magnitude of the response differed between the two tissues. In the mantle, PfPGRP expression was significantly up-regulated at 24 hours after injection with V. alginolyticus or Poly (I:C) alone, but there were no significant differences at other time points compared to controls. However, in the LPS injected group, significant up-regulation of PfPGRP expression was observed at 6 hours, 12 hours, 24 hours, and 72 hours, with the highest level reached at 72 hours. This suggests that the mantle is more sensitive to LPS and plays an important role in defense against bacterial invasion. In contrast, in the hepatopancreas, up-regulation of PfPGRP expression was observed 3 hours after V. alginolyticus injection, and 1 hour after the injection of LPS and Poly (I:C) alone, respectively. Furthermore, PfPGRP expression was significantly upregulated and reached the highest level at 6 hours in both the V. alginolyticus and LPS groups, while it reached the maximum at 12 hours in the Poly (I:C) group. These findings suggest that hepatopancreatic PfPGRP is more sensitive to bacteria than viruses, indicating that it may be involved in bacterial elimination primarily as a potent amidase.

In this study, we obtained the cDNA sequence of the PfPGRP gene from the pearl oyster, P. fucata, and found that PfPGRP is constitutively expressed in various tissues of the oyster, suggesting its potential importance in immune function. Using functional assays, we demonstrated that PfPGRP possesses multiple immune activities, including binding to LPS and microorganisms, exhibiting antibacterial activity. Our findings indicate that PfPGRP plays a vital role in the immune response of P. fucata, particularly in defense against viral infection. This study provides valuable insights into the function of PGRPs in the immune response of bivalves and could have practical implications for improving disease resistance in aquaculture.

Data availability

All the required data are available in the manuscript.

Acknowledgments

This work was supported by grants from Guangxi Natural Science Foundation Program (2021GXNSFAA075008), The Earmarked Fund for Science and Technology Development Supported by Central Government (GK ZY21195020), Marine Science Program for Guangxi First-Class Discipline, Beibu Gulf University (DRB001, DRB002), Guangxi Key Laboratory of Beibu Gulf Marine Biodiversity Conservation, Beibu Gulf University (2021ZB02, 2022ZA01).

Wang H C K .Peptidoglycan recognition proteins in insect immunity[J].Molecular Immunology, 2019, 106.
Dziarski R, Kashyap D R, Gupta D. Mammalian Peptidoglycan Recognition Proteins Kill Bacteria by Activating Two-Component Systems and Modulate Microbiome and Inflammation[J]. Microbial Drug Resistance, 2012,18(3):280-285.
Dong W , Zhe W , Hui-Qian X U ,et al.Cloning and functional characterization of two peptidoglycan recognition protein isoforms (PGRP-LC) in Bactrocera dorsalis (Diptera: Tephritidae)[J].2020.DOI:10.1016/S2095-3119(20)63202-6.
Qi-Hao H U , Yu-Zhen L U , Xiao-Qiang Y U .Advances in research on the innate immune system of Drosophila melanogaster[J].Chinese Journal of Applied Entomology, 2019.
García-Valtanen P. Corrigendum: Zebra Fish Lacking Adaptive Immunity Acquire an Antiviral Alert State Characterized by Upregulated Gene Expression of Apoptosis, Multigene Families, and Interferon-Related Genes[J]. Frontiers in Immunology, 2017,8.
Liu C, Xu Z, Gupta D, et al. Peptidoglycan Recognition Proteins[J]. Journal of Biological Chemistry, 2001,276(37):34686-34694.
Kang D S U S, Liu G, Lundstrom A, et al. A peptidoglycan recognition protein in innate immunity conserved from insects to humans[J]. Proceedings of the National Academy of Sciences - PNAS, 1998,95(17):10078-10082.
Huang Y , Pan J , Li X ,et al.Molecular cloning and functional characterization of a short peptidoglycan recognition protein from triangle-shell pearl mussel (Hyriopsis cumingii)[J].Fish & Shellfish Immunology, 2019, 86:571-580.DOI:10.1016/j.fsi.2018.12.007.
Zhang Y, Yu Z. The first evidence of positive selection in peptidoglycan recognition protein (PGRP) genes of Crassostrea gigas[J]. Fish & Shellfish Immunology, 2013,34(5):1352-1355.
Ikuta T, Tame A, Saito M, et al. Identification of cells expressing two peptidoglycan recognition proteins in the gill of the vent mussel, Bathymodiolus septemdierum[J]. Fish & shellfish immunology, 2019,93:815-822.
Vinu,S,Siva,et al.Association between the polymorphism of CfPGRP-S1 gene and disease susceptibility/resistance of zhikong scallop (Chlamys farreri) to Listonella anguillarum challenge - ScienceDirect[J].Fish & Shellfish Immunology, 2012, 33(4):736-742.DOI:10.1016/j.fsi.2012.06.016.
Xin X U , Zhong-Yuan L .Progress on Peptidoglycan Recognition Proteins in Innate Immune System[J].Progress in Veterinary Medicine, 2014.[13] Zhang D L, Yu D H, Chen J, et al. Expression profiles and interaction suggest TBK1 can be regulated by Nrdp1 in response to immune stimulation in large yellow croaker Larimichthys crocea[J]. Fish & Shellfish Immunology, 2015,46(2):745-752.
Chungen,Wen.Molecular cloning and expression of peptidoglycan recognition protein gene from freshwater mussel Hyriopsis cumingii[J]. 2016.
Tanji T, Ip Y T. Regulators of the Toll and Imd pathways in the Drosophila innate immune response[J]. Trends in Immunology, 2005,26(4):193-198.
Maillet F, Bischoff V, Vignal C, et al. The Drosophila peptidoglycan recognition protein PGRP-LF blocks PGRP-LC and IMD/JNK pathway activation[J]. Cell host & microbe, 2008,3(5):293-303.
Huang Y, Pan J, Li X, et al. Molecular cloning and functional characterization of a short peptidoglycan recognition protein from triangle-shell pearl mussel (Hyriopsis cumingii)[J]. Fish & Shellfish Immunology, 2019,86:571-580.
igang F , Daizhi Z , Baosuo L ,et al.Molecular cloning and expression analysis of BMP7b from Pinctada fucata[J].[2023-08-17].[18] Wu Y, He J, Yao G, et al. Molecular cloning, characterization, and expression of two TNFRs from the pearl oyster Pinctada fucata martensii[J]. Fish & Shellfish Immunology, 2020,98:147-159.
Zhenzhen W , Guiju H , Sigang F ,et al.Molecular cloning and expression profiles of matrilin-1 in pearl oyster (Pinctada fucata)[J].South China Fisheries Science, 2017.
Itoh N, Takahashi K G. A novel peptidoglycan recognition protein containing a goose-type lysozyme domain from the Pacific oyster, Crassostrea gigas[J]. Molecular Immunology, 2009,46(8-9):1768-1774.
Ni D, Song L, Wu L, et al. Molecular cloning and mRNA expression of peptidoglycan recognition protein (PGRP) gene in bay scallop ( Argopecten irradians, Lamarck 1819)[J]. Developmental and comparative immunology, 2007,31(6):548-558.
Premachandra H K A , Elvitigala D A S , Whang I ,et al.Identification of a novel molluscan short-type peptidoglycan recognition protein in disk abalone (Haliotis discus discus) involved in host antibacterial defense[J].Fish & Shellfish Immunology, 2014.DOI:10.1016/j.fsi.2014.04.018.[23] Coteur G, Mellroth P, De Lefortery C, et al. Peptidoglycan recognition proteins with amidase activity in early deuterostomes (Echinodermata)[J]. Dev Comp Immunol, 2007,31(8):790-804.
Huang Y, Pan J, Li X, et al. Molecular cloning and functional characterization of a short peptidoglycan recognition protein from triangle-shell pearl mussel (Hyriopsis cumingii)[J]. Fish & Shellfish Immunology, 2019,86:571-580.
Itoh N, Takahashi K G. A novel peptidoglycan recognition protein containing a goose-type lysozyme domain from the Pacific oyster, Crassostrea gigas[J]. Molecular Immunology, 2009,46(8-9):1768-1774.
Itoh N, Takahashi K G. Distribution of multiple peptidoglycan recognition proteins in the tissues of Pacific oyster, Crassostrea gigas[J]. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 2008,150(4):409-417.
Huang Y , Pan J , Li X ,et al.Molecular cloning and functional characterization of a short peptidoglycan recognition protein from triangle-shell pearl mussel (Hyriopsis cumingii)[J].Fish & Shellfish Immunology, 2019, 86:571-580.DOI:10.1016/j.fsi.2018.12.007.
Li X, Wang S, Wang H, et al. Differential Expression of Peptidoglycan Recognition Protein 2 in the Skin and Liver Requires Different Transcription Factors[J]. Journal of Biological Chemistry, 2006,281(30):20738-20748.
Zhang F, Shan S, Xu X, et al. Molecular characterization and expression analysis of two peptidoglycan recognition proteins (CcPGRP5, CcPGRP6) in larvae ontogeny of common carp Cyprinus carpio L. and upon immune stimulation by bacteria[J]. BMC Veterinary Research, 2019,15(1).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Cloning of PGRP Gene and Its Expression Responding to the Stimulations of Vibrio Alginolyticus, LPS, and Poly (I:C) in Pinctada fucata

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.1 Experimental materials

2.2 Extraction of total RNA and synthesis of cDNA

2.3 Cloning of PGRP cDNA

2.4 PGRP gene sequencing

2.5 PGRP tissue expression analysis

2.6 Analysis of PGRP gene expression post immune stimulation

2.7 Data processing

3. Results

3.1 cDNA sequencing of the PGRP Gene of P. fucata

3.2 PGRP sequence alignment and phylogenetic analysis

3.3 Analysis of PGRP gene expression in tissues of P. fucata

3.4 Responses of PGRP gene expression to different immune stimulations

4. Discussion

Declarations

References

Additional Declarations

Status:

Version 1