A Multi-Omics Analysis of the Prognostic Biomarker GDF15 Associated with Immune Infiltration and Regulated Mitochondrial-Dependent Apoptosis in Colorectal Cancer

doi:10.21203/rs.3.rs-3341290/v1

Download PDF

Research Article

A Multi-Omics Analysis of the Prognostic Biomarker GDF15 Associated with Immune Infiltration and Regulated Mitochondrial-Dependent Apoptosis in Colorectal Cancer

https://doi.org/10.21203/rs.3.rs-3341290/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Growth differentiation factor 15 (GDF15), also known as NSAID activated gene-1 (NAG-1), is associated with a large number of biological processes and diseases, including cancer. However, the correlation between the use of GDF15 and the development and immune infiltration of colorectal cancer (CRC) has rarely been studied.

Methods: The expression level of GDF15 in pan-cancer was examined using the TIMER 2.0 and TCGA databases. Using the TCGA database and GEPIA, the potential utility of GDF15 as a diagnostic and prognostic biomarker in pan-cancer was assessed. Analysis of the relationship between GDF15 and immune infiltration in CRC was performed using the ESTIMATE method. To examine the level of GDF15 expression in CRC tissues and CRC cell lines, Western blot analysis and qRT‒PCR were carried out. The ability of CRC cells to proliferate, migrate, and invade was examined using colony formation, Transwell assays, and EdU tests. To examine how GDF15 affects the cell cycle and apoptosis, flow cytometry and JC-1 assays were employed.

Results: Both CRC and most malignancies had high overexpression of GDF15. In most malignancies, higher expression levels of GDF15 were linked to worse overall survival (OS) and disease-free survival (DSS), according to Kaplan‒Meier survival analyses. The expression of GDF15 was also found to be negatively connected with tumor immune infiltration, as well as with CD4+ T cells, CD8+ T cells, and neutrophil infiltration, in the majority of malignancies. According to thein vitro research, DGF15 levels were higher in CRC tissues and cell lines. Additionally, GDF15 knockdown markedly reduced CRC cell motility, proliferation, and G0/G1 arrest. Most importantly, we also observed that downregulation of GDF15 can promote mitochondrial-related apoptosis in CRC cells.

Conclusions: In multiple human cancers, particularly in CRC, GDF15 overexpression predicts progression and a poor prognosis. GDF15 may also be an entirely novel diagnostic marker and offer a possible immune treatment target for tumor immunotherapy.

GDF15

Colorectal cancer

Prognosis

Immune infiltration

Apoptosis

Colorectal cancer (CRC) is one of the most common cancers worldwide, and the 5-year survival rate for patients with metastatic colorectal cancer is only 12–14% (1). Immunotherapy, such as immune checkpoint inhibitors, has been widely used in colorectal cancer (2, 3). However, there are still some patients who do not benefit from it (3). Additionally, the mechanisms by which CRC occurs and develops have not been fully elucidated, and effective markers for early diagnosis are lacking (4). Therefore, it is important to identify novel molecular markers for the early diagnosis, treatment, and prognostic assessment of CRC.

GDF15, a member of the TGF-β superfamily, plays an important role as an inflammatory marker in oncogenesis, ischemic disease, metabolic disease, and neurodegenerative diseases (5). Regarding oncogenesis, previous studies have found that the mRNA transcription of GDF15 was significantly upregulated in tumor biopsy samples (6). Further studies have shown that GDF15 is one of the major secreted proteins induced by the tumor suppressor gene p53 to inhibit tumor growth in ovarian tumors (7). The cellular environment in tumors also promotes tumor angiogenesis by increasing the secretion of GDF15 (8). It was found that the use of monoclonal antibodies to inhibit the downstream pathway of GDF15 inhibited tumor and body weight growth in mice (9). Therefore, inhibition based on GDF15 can be used as a new approach to combat cancer cachexia. However, the specific role of GDF15 in CRC has not been fully elucidated.

In this study, we identified GDF15 as an independent prognostic factor that is associated with immune infiltration and immunotherapy in CRC. At the same time, we examined the differential expression of GDF15 in CRC patients and explored the relationship between GDF15 and clinicopathological features. We observed that GDF15 promotes the proliferation, migration, and invasion of CRC cells while concurrently suppressing mitochondrial-related apoptosis in CRC cells. These findings suggest that GDF15 may serve as a novel therapeutic target for colorectal cancer."

Expression and Survival Analysis

The difference in GDF15 expression between normal and malignant samples in each tumor in the TCGA and GTEx databases was calculated in this work using R software (version 3.6.4) and shown using ggplot2 (3.3.3). To assess the statistical significance of differential expression, the Wilcoxon test was performed.

Diagnostic and Prognostic Analysis

We utilized R software (version 3.6.4) to examine tumor samples from the TCGA database to examine the relationship between the expression of GDF15 and OS and disease-specific survival (DSS) in pan-cancer. The log-rank test was used to determine the statistical significance of differential expression. The "Stage plot" module of GEPIA (gepia2.cancer-pku.cn/#index) was used to evaluate the relationship between GDF15 and cancer stage.

Immune infiltration analysis

We employed TIMER2.0 to assess the association between GDF15 expression levels and the extent of lymphocyte infiltration. Furthermore, we utilized TISIDB (accessible at http://cis.hku.hk/TISIDB/) to analyze the relationship between GDF15 expression and the expression of immune checkpoint genes across various cancer types. The statistical significance of these associations was evaluated using Spearman's test.

Functional Enrichment Analysis

We conducted an analysis of GDF15 gene expression using the LinkedOmics platform (accessible at www.linkedomics.org/login.php). Specifically, we employed the 'HiSeq RNA' platform and focused on the 'TCGA_CRC' cohort for our investigation. The correlation between GDF15 and coexpressed genes was assessed using the Pearson test. To delve deeper into the functional implications, we leveraged single-cell sequencing data sourced from the CancerSEA website to explore the associations between GDF15 and the functional states across 14 different cancer types.

Specimen Collection

Colorectal cancer (CRC) tissue specimens were obtained from the First Affiliated Hospital of Nanjing University of Chinese Medicine. Postsurgery, all specimens were promptly preserved at -80°C. All included patients received a confirmed diagnosis of CRC. This study received ethical approval from the Ethics Committee of the First Affiliated Hospital of Nanjing University of Chinese Medicine. Detailed clinicopathological information pertaining to the patients can be referenced in Table 1.

Table 1

༎Clinical characteristics of CRC patients with low GDF15 expression and high GDF15 expression
Parameters Group			GDF15 expression
Parameters Group		Cases	Low	High	P value
Age	≤ 53	24	10	14	0.8315
	༞53	36	16	20
Gender	Male	32	15	17	0.2837
	Female	28	17	11
T grade	T1 + T2	14	6	8	0.8032
	T3 + T4	46	18	28
Tumor size	≤ 5 cm	23	10	13	0.2777
	༞5 cm	37	11	26
Stage	Ⅰ-Ⅱ	23	15	8	0.0035
	Ⅲ-Ⅳ	37	10	27
Distant metastasis	M0	34	20	14	0.2046
	M1	26	11	15
Lymphatic invasion	Negative(N0)	25	11	14	0.1478
	Positive(N1-N3)	35	22	13

Immunoblot

Colorectal cancer (CRC) cells and tissues were harvested and subsequently lysed in immunoprecipitation buffer. Protein content was quantified utilizing the BCA assay, and 20 µg of protein samples were subjected to electrophoresis. Subsequently, membranes were exposed to specific primary antibodies at 4°C overnight. A horseradish peroxidase-conjugated secondary antibody was subsequently introduced and allowed to incubate with the membranes for 1 hour. Protein bands were visualized using the ChemiDocXRS + System.

Quantitative real-time polymerase chain reaction

Total RNA was extracted using TRIzol reagent (Invitrogen, CA) according to the manufacturer's instructions. cDNA was synthesized from RNA using a reverse transcription kit (Accurate Biology, China) and SYBR Green Master Mix (Bimake, UAS). The primers were as follows: GDF15: F: GCAAGAACTCAGGACGGTGA; R: TGGAGTCTTCGGAGTGCAAC. GAPDH: F: TGTGGGCATCAATGGATTTGG; R: ACACCATGTATTCCGGGTCAAT.

Cell counting kit‑8 proliferation assay

The assessment of colorectal cancer (CRC) cell proliferation was conducted in accordance with the manufacturer's guidelines employing the Cell Counting Kit-8 (CCK-8) assay (APExBIO, Houston, USA). Briefly, 10 µl of CCK-8 solution was added to each well, followed by a 2-hour incubation at 37°C. Subsequently, the absorbance at 450 nm was measured using spectrophotometry, and this measurement was performed at three time points over a 24-hour interval.

5-Ethynyl‐2'‐deoxyuridine incorporation assay

EdU assays were conducted utilizing the Cell-light EdU DNA cell proliferation kit (RiboBio, Guangzhou, China) following the manufacturer's instructions. The quantification of positively stained cells was determined based on the ratio of red to blue fluorescence staining.

Colony formation assay

For the EdU assay, a total of 1000 cells per well were seeded in a six-well plate and allowed to grow until they reached confluence. Subsequently, after 2–3 weeks of growth, cells were fixed with 4% paraformaldehyde for 15 minutes, followed by staining with a 0.1% crystal violet solution for 10 minutes. The number of colonies formed was enumerated, and the average values were derived from the results of three independent experiments.

Transwell assay

We employed 8 µm Transwell chambers in accordance with the manufacturer's instructions. A suspension of colorectal cancer (CRC) cells (1×105 cells/well) in serum-free medium was introduced into the upper chamber, while the lower compartment of the Transwell chamber received medium containing 10% fetal bovine serum (FBS). Subsequently, any remaining cells above the chamber were removed using a cotton ball. The cells that had migrated and adhered to the membrane were fixed using 4% paraformaldehyde and stained with crystal violet. The stained cells were then photographed and quantified from three randomly selected visual fields.

Small interfering RNA (siRNA) transfection

Custom-designed and synthesized small interfering RNAs (siRNAs) were procured from RiboBio (Guangzhou, China), while all plasmid vectors employed in this study were meticulously crafted by RiboBio Biotechnology. Notably, the control siRNA utilized in our experiments was derived from a distinct source devoid of any homology with human genome sequences. The transfection of colorectal cancer (CRC) cells with either siRNA or vectors was carried out using Lipofectamine 3000 (Invitrogen, USA) in strict accordance with the manufacturer's instructions. The specific siRNA targeting GDF15 was designed with the following sequence: GDF15 siRNA, 5’- ACAUGGUCACUUGCACCUCCC-3’. The assessment of GDF15 expression levels was conducted through reverse transcription quantitative polymerase chain reaction (RT‒qPCR) and Western blotting (WB) analyses.

Statistical analysis

Statistical analyses were conducted using GraphPad Prism version 7.0 software (GraphPad Software, Inc., California, USA). Data are presented as the mean ± standard error of the mean (SEM) from three independent experiments. Group differences were assessed utilizing Student's t test for pairwise comparisons and one-way analysis of variance (ANOVA) for multiple group comparisons. Prognostic factors were assessed through both univariate and multivariate Cox regression models. Survival rates were determined using the Kaplan‒Meier method, and differences in survival curves were evaluated using the log-rank test. Differences were considered significant at *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. NS: not significant.

GDF15 was upregulated in multiple human cancers

In the initial phase of our investigation, we sought to assess the expression levels of growth differentiation factor 15 (GDF15). Utilizing the TIMER 2.0 database, we conducted an analysis of GDF15 expression across TCGA datasets. Our findings revealed a consistent upregulation of GDF15 in several cancer types, including but not limited to breast invasive carcinoma (BRCA), cholangiocarcinoma (CHOL), colon adenocarcinoma (COAD), esophageal carcinoma (ESCA), head and neck squamous cell carcinoma (HNSC), liver hepatocellular carcinoma (LIHC), lung squamous cell carcinoma (LUSC), prostate adenocarcinoma (PRAD), rectum adenocarcinoma (READ), stomach adenocarcinoma (STAD), thyroid carcinoma (THCA), and uterine corpus endometrial carcinoma (UCEC). In contrast, GDF15 was downregulated in kidney chromophobe (KICH), kidney renal papillary cell carcinoma (KIRP), kidney renal clear cell carcinoma (KIRC), and a subset of lung squamous cell carcinoma (LUSC). Furthermore, an in-depth analysis of the TCGA RNA-seq database indicated a statistically significant increase in GDF15 expression within colorectal cancer (CRC) tissues compared to adjacent normal colon tissues (Fig. 1B). Subsequently, we corroborated these findings at the protein level through immunohistochemical assessment using data sourced from the HPA, revealing elevated expression of GDF15 in CRC tissues (Fig. 1C).

The clinicopathologic features and prognostic value of GDF15 in pan-cancer.

We conducted an assessment of the correlation between GDF15 expression levels and patient prognosis within the pan-cancer dataset. The prognostic measures encompassed both overall survival (OS) and disease-specific survival (DSS). Our analysis, employing Cox regression, unveiled significant insights. In Fig. 2A, it is evident that elevated GDF15 expression was associated with an increased risk in glioma (GBMLGG), brain lower grade glioma (LGG), mesothelioma (MESO), acute myeloid leukemia (LAML), esophageal carcinoma (ESCA), kidney renal papillary cell carcinoma (KIRP), and uveal melanoma (UVM). Conversely, it served as a protective factor in the pankidney cohort (KIPAN), colon adenocarcinoma/rectum adenocarcinoma (COADREAD), lung adenocarcinoma (LUAD), and colon adenocarcinoma (COAD). As depicted in Fig. 2B, the heightened expression of GDF15 was notably associated with poorer disease-specific survival (DSS) in GBMLGG, LGG, MESO, KIRP, and UVM, while demonstrating a more favorable DSS in kidney renal clear cell carcinoma (KIRC), COADREAD, COAD, and LUAD. Subsequently, we delved into the relationship between GDF15 and cancer stage across the pancancer landscape using the GEPIA2 platform. Our analysis revealed significant associations between GDF15 expression and cancer stage in colon adenocarcinoma (COAD), breast invasive carcinoma (BRCA), diffuse large B-cell lymphoma (DLBC), ESCA, KIRP, testicular germ cell tumors (TGCT), bladder urothelial carcinoma (BLCA), and adrenocortical carcinoma (ACC) (Fig. 1C–H).

GDF15 was related to immune infiltration and the efficacy of immunotherapy in pan-cancer.

With the increasing prominence of tumor immunotherapy, the investigation of the tumor immune microenvironment has assumed a pivotal role in cancer research (10). Tumor-infiltrating lymphocytes constitute a distinctive subset of lymphocytes that migrate into the tumor microenvironment, where they detect cancer antigens and release proinflammatory molecules. Utilizing TIMER 2.0, we delved into the potential role of GDF15 in modulating immune cell infiltration and its implications for immunotherapy.

Our findings unveiled a prominent pattern wherein GDF15 exerted a notable influence within the tumor immune microenvironment across various malignancies (Fig. S1). Notably, our analyses revealed a significant inverse correlation between immune cell infiltration and GDF15 expression in colorectal adenocarcinoma (COAD) (Fig. 3A). Moreover, elevated GDF15 expression was associated with reduced infiltration of B cells, CD8 + T cells, macrophages, neutrophils, dendritic cells, and other immune infiltrating lymphocytes in COAD (Fig. 3A). This trend extended to other tumor types, as elevated GDF15 expression correlated with decreased infiltration of the same immune cell types (Fig. 3B). Subsequently, we conducted an extensive analysis of the correlation between GDF15 expression and 60 genes linked to two distinct immune checkpoint pathways, the inhibitory (24 genes) and stimulatory (36 genes) pathways, across a pancancer context, leveraging the UCSC database (https://xenabrowser.net/). Intriguingly, our results indicated a positive association between GDF15 expression and the infiltration levels of certain immune checkpoints, including IL10, CTLA4, and IL13, in most tumors. Additionally, our data from Fig. 3C suggested a negative correlation between GDF15 expression and the expression of tumor immune checkpoints (stimulatory), such as IFNG, CXCL9, CCL5, and PRF1, across multiple tumor types. In summary, our data strengthen the argument that GDF15 holds promise as a potential biomarker for immunotherapy."

Functional analysis of GDF15-related genes in the COAD cohort

To gain further insights into the role of GDF15 in tumor progression, we conducted an in-depth analysis using single-cell sequencing data from CancerSEA to investigate its associations with 14 distinct functional states within cancer. Notably, our analysis revealed a positive correlation between GDF15 and the cell cycle across the majority of tumor types (Fig. 4A). Intriguingly, in most tumors, particularly colorectal cancer (CRC), which ranked highest, GDF15 exhibited an inverse relationship with inflammatory states (Fig. 4A). Furthermore, we delved into the functional correlations of GDF15 across various cell subpopulations. Our findings indicated widespread high expression of GDF15 across most cell types, underscoring its relevance to tumor heterogeneity. Notably, within CRC, GDF15 displayed significant positive correlations with epithelial-to-mesenchymal transition (EMT) (correlation coefficient = 0.36), inflammation (correlation coefficient = 0.35), metastasis (correlation coefficient = 0.35), and hypoxia (correlation coefficient = 0.31).

Then, to discover the underlying molecular mechanism of GDF15 in COAD, the LinkedOmics database was used to explore the biological function of GDF15. Figure 5A shows genes positively and negatively related to GDF15. The top 50 genes are shown in Fig. 5C, D. Moreover, GO analysis (biological function) demonstrated that GDF15 mainly participates in DNA replication, cell cycle, DNA repair, ribonucleoprotein complex biogenesis, etc. (Fig. 5B). KEGG analysis illustrated enrichment in ubiquitin-like protein conjugating enzyme activity, ubiquitin conjugating enzyme activity, RNA polymerase binding, single-stranded DNA binding, DNA-dependent ATPase activity, GDP binding, double-stranded RNA binding, etc. (Fig. 5E, F). Based on the above results, GDF15 coexpressed genes may be involved in the tumor cell cycle and metastasis, which provides a theoretical basis for further study of the biological function of GDF15.

GDF15 was upregulated in colorectal cancer tissues and cells

To corroborate the aforementioned findings, we conducted quantitative polymerase chain reaction (qPCR) and Western blot (WB) analyses to assess the expression of GDF15 in colorectal cancer (CRC) tissues compared to their corresponding adjacent normal tissues (ANT). The results consistently revealed higher GDF15 protein expression in the majority of CRC samples than in their respective ANTs (Fig. 6A and B). Subsequently, we performed survival analyses, employing Kaplan‒Meier methodology, in a cohort of 60 patients for whom complete follow-up information was available. These analyses revealed that elevated GDF15 expression was associated with diminished overall survival (OS) among CRC patients (P = 0.0419, Fig. 6C). Moreover, a robust correlation emerged between high GDF15 expression and reduced progression-free survival time in patients (P = 0.02231, Fig. 6D). Detailed patient characteristics are summarized in Table 1. Figure 6E and 6G further illustrate that GDF15 expression levels in CRC cell lines were significantly higher than those in FHC cells, with HCT116 exhibiting the highest expression and HT29 exhibiting the lowest expression. In summary, our findings collectively underscore the significant upregulation of GDF15 in CRC cells.

GDF15 inhibited the proliferation and metastasis of CRC cells

To analyze the biological function of GDF15, we transfected GDF15 siRNA into HCT116 CRC cells with high expression of GDF15. The results showed that the expression of both GDF15 mRNA and protein was significantly reduced in cells transfected with GDF15 siRNA compared with the control group (Fig. 6F and H). CCK-8 and colony formation assays confirmed that the knockdown of GDF15 significantly inhibited the proliferative activity of cells (Fig. 7A-C). Moreover, EdU assays further demonstrated that the cell proliferation capabilities of CRC cells were clearly impaired by the downregulation of GDF15 (Fig. 7D and E). Consistent with proliferative function experiments, subcutaneous Transwell assays showed that knockdown of GDF15 inhibited the migration and invasion ability of HCT116 cells (Fig. 7F and G). We also conducted cell cycle assays to validate this hypothesis (Fig. 7H and I). In summary, these data indicate that GDF15 could inhibit the proliferation and metastasis of CRC cells.

GDF15 promoted the mitochondrial-dependent apoptosis of CRC cells

We further examined the relationship between GDF15 and mitochondria-associated apoptosis in HCT116 cells (11). The results revealed that downregulating GDF15 enhanced apoptosis in HCT116 cells (Fig. 8A, B), significantly increasing the expression of JC-1 monomers (Fig. 8D, E). Subsequently, cytological experiments confirmed that GDF15 knockdown reduces the protein levels of Bcl-2. Concurrently, downregulation of GDF15 increased the expression of C-PARP, C-Caspase3, and Bax (Fig. 8C, F). These findings provide additional evidence that the downregulation of GDF15 promotes mitochondria-associated apoptosis in CRC cells.

Recently, with the development of gene sequencing technology, genomic analysis has helped us develop individualized treatment strategies for CRC patients (12, 13). Exploring the genetic characteristics of CRC patients can help identify potential driver mutations and uncover novel therapeutic targets. GDF15 belongs to the TGF-β superfamily, which plays an important role in the oncogenesis of tumors (6). Pathological cancer specimens from the Protein Atlas database further confirmed that GDF-15 is expressed at elevated levels in various types of cancer, most notably in prostate, uroepithelial, kidney, melanoma, and colorectal cancers, with relatively low levels in cervical, breast, endometrial, thyroid, and pancreatic cancers (14). Single-cell RNA sequencing showed that serum GDF15 levels were high in HCC patients and increased with tumor progression (15). Meanwhile, SULF2 was also found to promote the initiation and progression of pancreatic cancer by enhancing the expression of GDF15 (16). In addition, prostate cancer can also stimulate the growth and invasion of prostate cancer by inducing bone cells to secrete GDF15 and promote the vicious cycle of the bone metastasis process (17).

In this study, we showed that GDF15 was overexpressed in CRC and other tumors and that the overexpression level of GDF15 was associated with the poor prognosis of patients. The downregulation of GDF-15 expression in CRC cell lines was observed with reduced cell proliferation in vitro. A decrease in cell invasion and migration was observed in cells with GDF15 knockdown. As previous studies have shown, GDF15 acts as an oncogene in many tumors (6). We explored the expression of GDF15 in other tumors and its relationship with clinical prognosis. The results showed that GDF15 was overexpressed in pan-cancer and was associated with poor prognosis in many tumors. Moreover, we also found that GDF15 showed heterogeneity in many tumors by single-cell sequencing analysis. GDF15 is also associated with the proliferation, invasion, metastasis, cell cycle, and inflammation of many tumors.

The tumor microenvironment (TME) plays an important role in tumor development and immunotherapy (18, 19). The immune cells of the TME are closely related to the effect of immunotherapy, such as CD4 + T cells, CD8 + T cells, MDSCs and NKT cells (20–22). Studies have shown that GDF15 is positively correlated with an increase in Treg cells in the TME of HCC patients (23). Hepatocellular carcinoma GDF15 gene ablation can transform the immunosuppressive TME into an inflammatory state. Our results show that in most cancers, GDF15 expression was inversely correlated with tumor immune infiltration, as well as with CD4 + T cells, CD8 + T cells, and neutrophil infiltration. Moreover, the expression of GDF15 was positively correlated with most inhibitory immune checkpoints and negatively correlated with stimulant immune checkpoints. For CRC, the obtained results showed that there was a negative association between GDF15 and CD4 + T cells, CD8 + T cells, B cells, and myeloid dendritic cell infiltration. Furthermore, the single-cell sequence data also suggested that GDF15 was positively correlated with the inflammation level of CRC. Thus, GDF15 is related to the infiltration level of immune cells and may function as a potential biomarker of immunotherapy in CRC.

Although our study had many interesting findings, there are still some limitations in this study. First, the mechanism of GDF15 in colorectal cancer needs to be explored further. Second, this study mainly used bioinformatics analysis and preliminary functional exploration to screen potential biomarkers, and large clinical cohorts are needed to validate the results of this study.

In summary, our study first described the role of GDF15 as an oncogene in the development of CRC. GDF15 promotes the proliferation, migration, and invasion of CRC cells. In addition, we also confirmed that high GDF15 expression is associated with poor immune cell infiltration and inhibitory immune checkpoint expression in CRC tissues. In the future, GDF15 may serve as a biomarker for prognostic or immunotherapy effect prediction and as a potential therapeutic target for CRC diagnosis and treatment.

Acknowledgments

This work was supported by the National Science Foundation of China (82174466 to WXY), the Project of Jiangsu Province (BK20211390 to WXY), the Social Development Project of Jiangsu Province (BE2019768 of WXY), the Key Projects of Jiangsu Province Traditional Chinese Medicine Technology Development Plan (ZD202201 to SDD), and a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions.

Author contributions WXY and SDD designed the research, WXY and CQH wrote the manuscript, ZYM and WWY performed the in vitro experiments, and YG and YH analyzed and interpreted the data. All authors contributed to this work.

Data availability

The original contributions presented in the study are included in the article materials. Further inquiries can be directed to the corresponding authors.

Footnote

Conflict of Interest: The authors declare that there are no conflicts of interest regarding the publication of this article.

Ethical Statement: This study was approved by the Ethics Committee of the First Affiliated Hospital of Nanjing University of Chinese Medicine.

Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209–49.
Fan A, Wang B, Wang X, Nie Y, Fan D, Zhao X, et al. Immunotherapy in colorectal cancer: current achievements and future perspective. Int J Biol Sci. 2021;17(14):3837–49.
Ganesh K, Stadler ZK, Cercek A, Mendelsohn RB, Shia J, Segal NH, et al. Immunotherapy in colorectal cancer: rationale, challenges and potential. Nat Rev Gastroenterol Hepatol. 2019;16(6):361–75.
Franke AJ, Skelton WP, Starr JS, Parekh H, Lee JJ, Overman MJ, et al. Immunotherapy for Colorectal Cancer: A Review of Current and Novel Therapeutic Approaches. J Natl Cancer Inst. 2019;111(11):1131–41.
Wang D, Day EA, Townsend LK, Djordjevic D, Jorgensen SB, Steinberg GR. GDF15: emerging biology and therapeutic applications for obesity and cardiometabolic disease. Nat Rev Endocrinol. 2021;17(10):592–607.
Siddiqui JA, Pothuraju R, Khan P, Sharma G, Muniyan S, Seshacharyulu P, et al. Pathophysiological role of growth differentiation factor 15 (GDF15) in obesity, cancer, and cachexia. Cytokine Growth Factor Rev. 2022;64:71–83.
Izaguirre DI, Ng CW, Kwan SY, Kun EH, Tsang YTM, Gershenson DM et al. The Role of GDF15 in Regulating the Canonical Pathways of the Tumor Microenvironment in Wild-Type p53 Ovarian Tumor and Its Response to Chemotherapy. Cancers (Basel). 2020;12(10).
Li S, Ma YM, Zheng PS, Zhang P. GDF15 promotes the proliferation of cervical cancer cells by phosphorylating AKT1 and Erk1/2 through the receptor ErbB2. J Exp Clin Cancer Res. 2018;37(1):80.
Suriben R, Chen M, Higbee J, Oeffinger J, Ventura R, Li B, et al. Antibody-mediated inhibition of GDF15-GFRAL activity reverses cancer cachexia in mice. Nat Med. 2020;26(8):1264–70.
Zhao W, Jin L, Chen P, Li D, Gao W, Dong G. Colorectal cancer immunotherapy-Recent progress and future directions. Cancer Lett. 2022;545:215816.
Tsai VWW, Husaini Y, Sainsbury A, Brown DA, Breit SN. The MIC-1/GDF15-GFRAL Pathway in Energy Homeostasis: Implications for Obesity, Cachexia, and Other Associated Diseases. Cell Metab. 2018;28(3):353–68.
Beroukhim R, Mermel CH, Porter D, Wei G, Raychaudhuri S, Donovan J, et al. The landscape of somatic copy-number alteration across human cancers. Nature. 2010;463(7283):899–905.
Siegel RL, Miller KD, Goding Sauer A, Fedewa SA, Butterly LF, Anderson JC, et al. Colorectal cancer statistics, 2020. CA Cancer J Clin. 2020;70(3):145–64.
Uhlen M, Zhang C, Lee S, Sjostedt E, Fagerberg L, Bidkhori G, et al. A pathology atlas of the human cancer transcriptome. Science. 2017;357:6352.
Myojin Y, Hikita H, Sugiyama M, Sasaki Y, Fukumoto K, Sakane S, et al. Hepatic Stellate Cells in Hepatocellular Carcinoma Promote Tumor Growth Via Growth Differentiation Factor 15 Production. Gastroenterology. 2021;160(5):1741–54e16.
He R, Shi J, Xu D, Yang J, Shen Y, Jiang YS, et al. SULF2 enhances GDF15-SMAD axis to facilitate the initiation and progression of pancreatic cancer. Cancer Lett. 2022;538:215693.
Wang W, Yang X, Dai J, Lu Y, Zhang J, Keller ET. Prostate cancer promotes a vicious cycle of bone metastasis progression through inducing osteocytes to secrete GDF15 that stimulates prostate cancer growth and invasion. Oncogene. 2019;38(23):4540–59.
Meurette O, Mehlen P. Notch Signaling in the Tumor Microenvironment. Cancer Cell. 2018;34(4):536–48.
Hinshaw DC, Shevde LA. The Tumor Microenvironment Innately Modulates Cancer Progression. Cancer Res. 2019;79(18):4557–66.
Hossain MA, Liu G, Dai B, Si Y, Yang Q, Wazir J, et al. Reinvigorating exhausted CD8(+) cytotoxic T lymphocytes in the tumor microenvironment and current strategies in cancer immunotherapy. Med Res Rev. 2021;41(1):156–201.
Borst J, Ahrends T, Babala N, Melief CJM, Kastenmuller W. CD4(+) T cell help in cancer immunology and immunotherapy. Nat Rev Immunol. 2018;18(10):635–47.
Li T, Liu T, Zhu W, Xie S, Zhao Z, Feng B, et al. Targeting MDSC for Immune-Checkpoint Blockade in Cancer Immunotherapy: Current Progress and New Prospects. Clin Med Insights Oncol. 2021;15:11795549211035540.
Wang Z, He L, Li W, Xu C, Zhang J, Wang D et al. GDF15 induces immunosuppression via CD48 on regulatory T cells in hepatocellular carcinoma. J Immunother Cancer. 2021;9(9).

No competing interests reported.

FigureS1.tif
Fig. S1. GDF15 shapes an immune barrier in the tumor microenvironment of most cancers. (A-M):The expression of GDF15 was negatively correlated with immune infiltration in various tumors.

Download PDF

Version 1

posted

You are reading this latest preprint version

A Multi-Omics Analysis of the Prognostic Biomarker GDF15 Associated with Immune Infiltration and Regulated Mitochondrial-Dependent Apoptosis in Colorectal Cancer

Status:

Version 1

Abstract

Figures

Introduction

Methods

Expression and Survival Analysis

Diagnostic and Prognostic Analysis

Immune infiltration analysis

Functional Enrichment Analysis

Specimen Collection

Immunoblot

Quantitative real-time polymerase chain reaction

Cell counting kit‑8 proliferation assay

5-Ethynyl‐2'‐deoxyuridine incorporation assay

Colony formation assay

Transwell assay

Small interfering RNA (siRNA) transfection

Statistical analysis

Results

GDF15 was upregulated in multiple human cancers

Functional analysis of GDF15-related genes in the COAD cohort

GDF15 was upregulated in colorectal cancer tissues and cells

GDF15 inhibited the proliferation and metastasis of CRC cells

GDF15 promoted the mitochondrial-dependent apoptosis of CRC cells

Discussion

Conclusions

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1