Effect of Ursolic Acid, Selenium Nanoparticles, and Their Combination on the Metastasis-Associated Gene Expression in MDA-MB-231 Breast Cancer Cells: In-vitro Study

doi:10.21203/rs.3.rs-3342362/v1

Download PDF

Research Article

Effect of Ursolic Acid, Selenium Nanoparticles, and Their Combination on the Metastasis-Associated Gene Expression in MDA-MB-231 Breast Cancer Cells: In-vitro Study

https://doi.org/10.21203/rs.3.rs-3342362/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Metastasis is a leading cause of cancer-related mortality. Triple-negative human breast carcinoma (TNBC) exhibits increased invasion and metastatic activity compared to other types of breast cancer, often resulting in a poor prognosis. The aim of this study was to examine the impact of selenium nanoparticles (SeNPs), ursolic acid, and their combination on the MDA-MB-231 TNBC cell line in terms of their potential antiproliferative and antimetastatic effects. The cytotoxic effect of the aforementioned substances was evaluated using an MTT assay. Additionally, their impact on the expression levels of ICAM-1, a transmembrane glycoprotein that promotes metastasis, and two matrix metalloproteinases (MMP-2 and MMP-9) that are essential for tumor invasion and migration, was investigated by using real-time PCR. Moreover, the scratch assay was used to observe cell migration after SeNPs and ursolic acid treatment. The findings suggest that although applying 150 µg/mL SeNPs and 20 µg/mL UA separately revealed more cell inhibition rate, a combination group of SeNPs and ursolic acid not only decreases the viability of cancer cells in comparison to the control group, but also harbors synergistic actions in reducing the migration and metastasis of MDA-MB-231 cells by their most effective downregulation of MMP-9, MMP-2, and ICAM-1 expression. It can be considered a novel potential treatment for triple-negative metastatic breast cancer (TNBC). However for better justification of this mechanism, more detailed studies on animal models should be performed.

Biological selenium nanoparticles

Ursolic acid

Triple-negative breast cancer

Biomarker targeted therapy

Breast cancer is one of the most malignant cancers among women [1]. Breast cancer makes up the highest portion of all cancer cases in 2020, accounting for 11.7%, as reported by the World Health Organization. Breast cancer is categorized into different subtypes based on the expression levels of progesterone receptor (PR), human epidermal growth factor 2 receptor (HER2), and estrogen receptor (ER). Triple-negative breast cancer (TNBC) is a subset of breast carcinoma that represents approximately 15–20% of all breast cancer that is not positive for the expression (or very low expressed) of PR, ER, and HER2 genes. TNBC tumors possess a high histologic grade and a higher percentage of early relapses that are frequently diagnosed at an advanced stage [2]. In contrast to receptor-positive tumors, TNBC tumors are considered more aggressive and incapable of treatment. Patients with TNBC who developed distant metastases had a low overall survival rate of around eighteen months [3]. Breast tumor mortality is often caused by its ability to spread to other parts of the body, known as metastasis. This process consists of various stages including (i) tumor cells’ transformation by degradation of extracellular matrix (ECM), (ii) intravasation that is denoted by tumor cells’ migration to vessels, (iii) extravasation, and (iv) proliferation in the target organ [4], during which cancerous cells spread from the primary tumor site to other parts of the body via the lymphatic system, bloodstream, or direct extension. This is due to the poor prognosis and lack of success with traditional forms of treatment such as chemotherapy. Chemotherapy is the only accepted treatment; however, the patient’s life span is short. Moreover, it harbors noticeable toxicity. Therefore, discovering a new TNBC treatment strategy is critical to increasing life expectancy [5, 6]. Biomarker-targeted therapies are among the new treatments that prevent the growth or spread of cancer cells while preserving normal cells.

Cell adhesion molecules (CAMs) are considered crucial to preserving tissue structure and function. CAMs participate as a binding agent in which they mediate cell-to-cell or cell-to-extracellular matrix (ECM) binding [7]. Among them, intercellular adhesion molecule-1 (ICAM-1), a transmembrane glycoprotein of the immunoglobulin (Ig)-like superfamily, demonstrates overexpression in highly metastatic cancers [8] such as TNBC, around 8 to 25 fold higher [9]. It has been claimed that ICAM-1 lead to the interaction between leukocytes and endothelium, which facilitates tumor cells’ extravasation [10, 11].

Matrix metalloproteinases (MMPs), other biomarkers of invasive cancers, are from the zinc-dependent endopeptidases involved in tissue remodeling, and cancer development. MMPs elevate the cancer invasion rate by reducing cell adhesion through the degradation of the ECM which acts as a physical barrier to tumor metastasis [12]. As reported in several studies, MMP-2 and MMP-9 are significantly increased in various metastatic cancers, leading to the eradication of basement membrane (BM) and ECM and, in turn, cancer metastasis [13–15].

Selenium (Se), is a trace element that plays a crucial role in living organisms. Among different forms of Se, red elemental selenium (Se⁰), which is known as selenium nanoparticle (SeNP) has greatly attracted attention due to its therapeutic advantages, including anti-cancer, antioxidant, anti-inflammatory and antimicrobial effects. Moreover, nanosized Se is more bioavailable, affordable, and less toxic compared with other selenium-containing compounds [16]. SeNPs can be synthesized through different methods, including physical, chemical, and biological. Chemical synthesis is mostly a common and rapid method. In contrast, microbes and plants are used for the biological synthesis of SeNPs [17]. Reports suggested that oral administrations of SeNP in affected mice by metastatic breast tumors enhanced their immune response and reduced metastasis to the liver [18, 19].

On the other hand, natural components have become more interesting, as they are cost-effective, and harbor lower toxicity. Ursolic acid (UA) is a pentacyclic triterpenoid compound of many plants and has received attention for its specific therapeutic applications, including anti-apoptotic, antioxidant, anti-inflammatory, and anti-carcinogenic effects. UA regulates multiple targets including nuclear factor κB (NF-κB), serine/threonine-protein kinase B (AKT), and signal transducer and activator of transcription 3 (STAT3), which all are associated with cancer progression [20]. Suppression of MMP-9 and ICAM-1 after UA treatment of colorectal cancer revealed the potential anti-angiogenesis and anti-metastatic effects of UA [20]. Furthermore, it has been shown that the application of 5–20 µM UA can induce apoptosis in malignant cells by activating caspase-3 in a dose- and time-dependent manner [21].

In this study, we aimed to examine the potential synergistic effect of Ursolic acid in combination with SeNPs on the reduction of invasion rate of MDA-MB 231 cells as a highly invasive breast cancer cell line and a good model of TNBC (ER⁻, PR⁻, HER2). To evaluate this hypothesis, the expression levels of MMP2, MMP9, and ICAM-1 were investigated by quantitative real-time PCR.

Cell culture condition

Human breast cancer cell line MDA-MB-231 (IBRC C11325) was obtained from the Iranian Biological Resource Center (IBRC), (Tehran, Iran). The cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Germany) supplemented with 10% fetal bovine serum (FBS) (Gibco, Germany), 100 Units of penicillin/ml (Gibco, Germany), and 100 µg of streptomycin/ml (Gibco, Germany), then incubated at 37°C with 5% CO₂.

selenium nanoparticles’ preparation

According to our previous study, biological SeNPs were produced using Lactobacillus plantarum [22]. Briefly, 1 mL of a 254 mM stock solution of SeO2 along with 1 mL of L. plantarum culture with OD₆₀₀ = 1 was added to 100 mL of fresh MRS broth and incubated at 37°C for 72h. To release the intracellular red elemental selenium, L. plantarum cell pellets were broken with liquid nitrogen and ultrasound treatment. SeNPs were purified using an n-Octyl alcohol/water extraction system [23]. The SeNPs solution was stored at 4° C until use.

Ursolic acid preparation

10 mg of ursolic acid was solved in 500 µL DMSO to prepare a stock solution. In the next steps, high glucose DMEM culture medium without FBS was used to dilute the stock solution and prepare the desired concentrations.

MDA-MB-231 cell viability assay

Cell viability was evaluated by MTT assay (Sigma, United Kingdom). To this end, 2×10⁴ MDA-MB-231 cells/well were seeded in 96-well cell culture plates and incubated at 37° C for 24 h. Then, the medium was changed with the fresh one containing different concentrations of SeNPs (50,100,150,200,250 µg/mL) and ursolic acid (5,10,15,20,25 µg/mL). The treated cells were incubated separately for 24, 48, and 72 h to evaluate the time dependency of the treatment. 20µL MTT reagent (5 mg/mL) was added to each well after the mentioned times. Then the plates were further incubated for 2 h in darkness. Finally, the complete cell culture medium was replaced with 200 µL of dimethyl sulfoxide (DMSO) (Sigma, United Kingdom). After 15 minutes, the absorbance was measured at 570 nm to quantify the amount of formazan crystals. The cell viability percentage of treated cells was calculated using the following formula:

%Cell viability \(=\frac{\text{M}\text{e}\text{a}\text{n}\text{O}\text{D}\text{t}\text{r}\text{e}\text{a}\text{t}\text{e}\text{d} \text{c}\text{e}\text{l}\text{l}\text{s}-\text{M}\text{e}\text{a}\text{n}\text{O}\text{D}\text{b}\text{l}\text{a}\text{n}\text{k}}{\text{M}\text{e}\text{a}\text{n}\text{O}\text{D}\text{c}\text{o}\text{n}\text{t}\text{r}\text{o}\text{l} \text{c}\text{e}\text{l}\text{l}\text{s}-\text{M}\text{e}\text{a}\text{n}\text{O}\text{D}\text{b}\text{l}\text{a}\text{n}\text{k}}\) ×100

RNA extraction and cDNA synthesis

Approximately 2.5 × 10⁵ MDA-MB-231 cells/well were seeded in three separate six-well plates and incubated for 4h. Each plate was treated with three different protocols including 1: SeNPs group (150 µg/mL SeNPs), 2: ursolic acid group (20 µg/mL ursolic acid), and 3: mixed group (150 µg/mL SeNPs + 20 µg/mL ursolic acid) and incubated separately for 24, 48, and 72 h. Total RNA was extracted using TRIzol reagent (Sinaclon, Tehran, Iran) according to the method previously described [24]. Isolated RNA was evaluated using Nanodrop with a spectrophotometer. The complementary DNA (cDNA) was synthesized from 3 µL of total RNA by incubation in a thermocycler for 1 h at 43°C with M-MLV reverse transcriptase enzyme (Fermentas, Lithuania) according to the manufacturer's instruction. Then, to visualize the results of the PCR product, amplificated cDNA with gene-specific primers (Table 1) were run through 1.5% agarose gel electrophoresis with ethidium bromide staining (Meryer, Shanghai).

Table 1

Primers’ sequences for qPCR
Target gene	Forward primer	Reverse primer
MMP-2	CAGGCTCTTCTCCTTTCSCAAC	AAGCCACGGCTTGGTTTTCCTC
MMP-6	GCACGACGTCTTCCAGTACC	CAGGATGTCATAGGTCACGTAGC
ICAM-1	CCTGATGGGCAGTCAACAGCTA	ACAGCTGGCTCCCGTTTCA
β-actin	GAGACCTTCAACACCCCAGCC	AGACGCAGGATGGCATGGG

Real-time polymerase chain reaction

Quantitative real-time PCR was performed with 25 µL of the PCR reaction mix, according to the manufacturer’s instructions. Briefly, each PCR reaction contains 12 µL of SYBR Green master mix, 2 µL of primers (Table 1), 3 µL of cDNA template, and 8 µL doubled distilled water. The PCR procedure consisted of 95°C for 10 min followed by 40 cycles of 95°C for 15 seconds, 60°C for 1 minute, and 72°C for 5 min. All the tests were run in triplicates on an ABI 7500 Fast Real-time PCR system. Data were analyzed by a comparative threshold (C_t), using the 2^−ΔΔCT method [25] and the mean fold inductions of samples were compared with the untreated samples.

Scratch assay

Cells were plated into a 6-well cell culture plate and incubated up to the approximate confluence of 90%. To minimize cell proliferation, 5 percent of FBS was used in culture media. Then, cells were carefully scratched using a yellow pipette tip, and cellular debris was washed away with PBS [26]. Afterward, cells were treated with 150 µg/mL SeNPs, 20 µg/mL ursolic acid, and a combination of them. Each cell-containing well was monitored during the following time (0, 24, 48, and 72 h) by taking the photos under an inverted microscope (Olympus Corp.), and the closure of the wound in each treated cell was compared with the control to observe the potential of cell migration.

Statistical analysis

Statistical analysis was performed using GraphPad Prism software version 8.4.3 (GraphPad Software, San Diego, CA, USA). Data were reported as group means ± SEM and were analyzed via two-way ANOVA followed by Tukey’s test. Differences were considered significant when the p-value was < 0.05.

Cell viability by MTT assay

To evaluate the cytotoxic effect of different doses of SeNPs (50–250 µg/mL), ursolic acid (5–25 µg/mL), and the combination of them (SeNPs 50–200 µg/mL + UA 20 µg/mL) on MDA-MB-231 cells, MTT assay was performed. A significant decrease in MDA-MB-231 cell viability was observed in cells treated with 150 µg/mL of SeNPs (Fig. 1a), 20 µg/mL of UA (Fig. 1b), and the combination dose of 150 µg/mL SeNPs + 20 µg/mL UA (Fig. 1c). The percentage of reduction in cell viability related to each of SeNPs, UA, and combined group treatments was about 90%, 70%, and 80%, respectively compared to the control group (Fig. 1). Therefore, the most effective doses of SeNPs and UA on cell viability were obtained from MTT analysis and are considered for performing the following experiments on expression and metastasis development.

Figure 1.

Effect of SeNPs and Ursolic acid on MMP-2, MMP-9, and ICAM-1 expression levels

Our study aimed to investigate the effect of SeNPs and UA on tumor metastasis and invasion. In this regard, the expression levels of genes involved in tumor invasion, including MMP-2, MMP-9, and ICAM-1 were measured by real-time PCR. MDA-MB-231 cells were incubated in three separate cell culture plates with selective concentrations of 150 µg/mL SeNPs, 20 µg/mL ursolic acid, and a combination of 150 µg/mL SeNPs + 20 µg/mL UA for 24, 48, and 72 h (Fig. 2). As shown in Fig. 2a, MMP-9 expression level was significantly decreased in all treated cells compared to the control group (**** 𝑃 < 0.0001). Likewise, MMP-2 expression level indicates significant reduction after treatment with 20 µg/mL UA and the combination of 150 µg/mL SeNPs plus 20 µg/mL UA (**** 𝑃 < 0.0001) and 150 µg/mL SeNPs (** 𝑃 < 0.001, * 𝑃 < 0.05) (Fig. 2b).

Additionally, the results of ICAM-1 expression showed a significant reduction after incubation with the combination of 150 µg/mL SeNPs plus 20 µg/mL UA (**** 𝑃 < 0.0001) and 20 µg/mL UA alone (** 𝑃 < 0.001). Despite this, 150 µg/mL SeNPs did not affect the expression level of ICAM-1 in a statistically meaningful way (Fig. 2c). Of note, the most reduction of MMP-9, MMP-2, and ICAM-1 gene expression belonged to the combination-treated compared with 150 µg/mL SeNPs or 20 µg/mL UA alone (Fig. 2).

Moreover, the inhibition of MMP-2, MMP-9, and ICAM-1 gene expression using UA, SeNPs, and their combination showed a time-dependent manner, in which treated cells indicated significant results after 72 h of incubation with all treatments (Fig. 2). The relative expression data were normalized using β-actin as a housekeeping gene.

Figure 2.

Scratch assay

To investigate the effect of SeNPs and ursolic acid on cell migration, the scratch assay was performed. As shown in Fig. 3, the motility of treated cells with 150 µg/mL SeNPs, 20 µg/mL UA, and the combination of them were reduced, according to the density of cells that filled the gap, compared to the control group. In addition, the combination of 150µg SeNPs plus 20µg UA demonstrates the lowest invasion rate rather than other treated cells with single groups. It was also obtained that all treated groups exhibited the highest inhibition of cell motility after 72 h of incubation.

Figure 3.

Despite many progresses in cancer treatment, metastasis is remained a challenging issue and is the focus of recent cancer treatment trials. Cancer metastasis requires a cascade of events such as cell adhesion, extracellular matrix (ECM) degradation, and invasion. Matrix metalloproteinases especially MMP-9 and MMP-2, are crucial for cancer invasion and metastasis that cause ECM degradation due to their proteolytic function. In the tumor microenvironment of the highly metastatic carcinomas, MMP-9 and MMP-2 are up-regulated, which leads to Epithelial-mesenchymal transition (EMT) events and metastasis [27, 28]. Furthermore, it is crucial for tumor cells to reduce cell adhesion to promote migration. ICAM-1, a glycoprotein that belongs to the immunoglobulin superfamily and is involved in a variety of immune and inflammatory responses, lymphoid trafficking, and several malignancies, including TNBC, has the potential to be positively correlated with tumor metastasis and invasion through modulating cell-cell adhesion. Also, ICAM-1 harbors the potential to be detected as a molecular target for treating patients suffering from TNBC [29]. Hence, downregulation of MMP2, MMP-9, and ICAM-1 could practically suppress the metastatic potential of malignant carcinomas. In the present study, the effect of SeNPs, ursolic acid, and their combination on the proliferation and viability of MDA-MB-231 cells; and gene expression levels of MMP-9, MMP-2, and ICAM-1 were investigated. Nanoparticle-sized selenium showed the most significant anti-proliferative effect on MDA-MB-231 cells at the concentration of 150 µg/mL rather than other treatment and control groups (Fig. 1a). Ursolic acid inhibited cell proliferation significantly at the dose of 20 µg/mL in comparison to other doses of UA and the control group (Fig. 1b). Interestingly, the combination of 150 µg/mL SeNPs and 20 µg/mL UA indicated a significant effect on reducing cell viability compared with other mixed doses and control group (Fig. 1c).

Results of gene expression level assay by Real-time PCR (Fig. 2) showed a time-dependent reduction in the expression level of MMP-9 and MMP-2 after treatment with 150 µg/mL SeNPs, 20 µg/mL ursolic acid, and their combination at mentioned doses. The fold induction of MMP-2 was decreased by SeNPs, UA, and the combination group by about 0.4, 0.5, and 0.6 compared with the control group, and the reduction of MMP-9 was about 0.5, 0.6, and 0.7 respectively. The outcomes indicated that the combination treatment with SeNPs and UA resulted in the utmost decrease in MMP-9 and MMP-2 gene expression levels in contrast to applying each of them separately. Thus, based on the obtained data, it can be concluded that SeNPs and Ursolic acid possess the potential synergistic effect on the reduction of cell viability and motility. Furthermore, ICAM-1 expression was significantly reduced with ursolic acid by about 0.3-fold and 0.5-fold with a combination of SeNPs and UA, while administration of 150 µg/mL SeNPs alone indicated the lowest effect on ICAM-1 expression with less than 0.2-fold reduction, which was not statistically significant.

The scratch assay was carried out to clarify the potential relationship between cell migration and metastasis with the downregulation of MMPs and ICAM-1 on treated cells. As shown in Fig. 3, all treated cells demonstrated lower mobility than the control group, which exhibits that migration in drug-exposed cells has occurred at a lower rate. As concluded in this study, although applying 150 µg/mL SeNPs and 20 µg/mL UA separately revealed more cell inhibition rate, a combination group of SeNPs and Ursolic acid not only decreases the viability of cancer cells in comparison to the control group, but also harbors synergistic actions in reducing the migration and metastasis of MDA-MB-231 cells by their most effective downregulation of MMP-9, MMP-2, and ICAM-1 expression. Also, previous studies proved that the high expression of these markers is positively associated with aggressive tumor phenotypes and a lower prognosis of breast cancer [11]. Therefore, this combination can be considered a novel potential treatment for triple-negative metastatic breast cancer (TNBC). Although for better justification of this mechanism, more detailed studies on animal models should be performed.

Acknowledgments

This work was supported by the deputy of research at Tehran University of Medical Sciences (Grant No. 38504).

Data Availability

All data generated or analyzed during this study are included in the article.

Disclosure of interest

The authors report no conflicts of interest.

Author contributions

F.A. carried out the experiments. M.S. drafted the manuscript. S.R. revised the manuscript. R.A. contributed cell culture and MTT assay. A.SH. supervised the preparation of the nanoparticles. M.Y. designed and supervised the cell culture and molecular assays.

Consent to participate

Informed consent was obtained from all individual participants included in the study.

Consent to publish

All authors have read and reviewed the manuscript and consented to publication.

Dai X, et al. Breast Cancer Cell Line Classification and Its Relevance with Breast Tumor Subtyping. J Cancer. 2017;8(16):3131–41. https://doi.org/10.7150/jca.18457.
Singh DD, Yadav DK. TNBC: Potential Targeting of Multiple Receptors for a Therapeutic Breakthrough, Nanomedicine, and Immunotherapy. Biomedicines. 2021;9(8):876. https://doi.org/10.3390/biomedicines9080876.
Vagia E, Mahalingam D, Cristofanilli M. The Landscape of Targeted Therapies in TNBC. Cancers. 2020;12(4):916. https://doi.org/10.3390/cancers12040916.
van Zijl F, Krupitza G, Mikulits W. Initial steps of metastasis: cell invasion and endothelial transmigration. Mutat Res. 2011;728(1–2):23–34. https://doi.org/10.1016/j.mrrev.2011.05.002.
Chien Y-C, et al. EZH2 promotes migration and invasion of triple-negative breast cancer cells via regulating TIMP2-MMP-2/-9 pathway. Am J Cancer Res. 2018;8(3):422–34.
Wang Q-m, et al. MMP-1 is overexpressed in triple-negative breast cancer tissues and the knockdown of MMP-1 expression inhibits tumor cell malignant behaviors in vitro. Oncol Lett. 2019;17:1732–40.
Ren G, Roberts AI, Shi Y. Adhesion molecules: key players in Mesenchymal stem cell-mediated immunosuppression. Cell Adh Migr. 2011;5(1):20–2. https://doi.org/10.4161/cam.5.1.13491.
Schröder C, et al. Prognostic value of intercellular adhesion molecule (ICAM)-1 expression in breast cancer. J Cancer Res Clin Oncol. 2011;137(8):1193–201.
Guo P et al. ICAM-1 as a molecular target for triple-negative breast cancer. Proceedings of the National Academy of Sciences 2014; 111 (41): 14710-5. https://doi.org/10.1073/pnas.1408556111.
10, Figenschau SL, et al. ICAM1 expression is induced by proinflammatory cytokines and associated with TLS formation in aggressive breast cancer subtypes. Sci Rep. 2018;8(1):11720. https://doi.org/10.1038/s41598-018-29604-2.
Reina M, Espel E. Role of LFA-1 and ICAM-1 in Cancer. Cancers. 2017;9(11). https://doi.org/10.3390/cancers9110153.
Tang X, McMullen TPW, Brindley DN. Increasing the low lipid phosphate phosphatase 1 activity in breast cancer cells decreases transcription by AP-1 and expressions of matrix metalloproteinases and cyclin D1/D3. Theranostics. 2019;9(21):6129–42. https://doi.org/10.7150/thno.37094.
Vizoso F, et al. Study of matrix metalloproteinases and their inhibitors in breast cancer. Br J Cancer. 2007;96:903–11. https://doi.org/10.1038/sj.bjc.6603666.
Katunina AI, et al. Matrix metalloproteinases 2, 7, and 9 in tumors and sera of patients with breast cancer. Bull Exp Biol Med. 2011;151(3):359–62. https://doi.org/10.1007/s10517-011-1330-z.
Parsons SL, et al. Gelatinase (MMP-2 and – 9) expression in gastrointestinal malignancy. Br J Cancer. 1998;78(11):1495–502. https://doi.org/10.1038/bjc.1998.712.
Forootanfar H, et al. Antioxidant and cytotoxic effect of biologically synthesized selenium nanoparticles in comparison to selenium dioxide. J Trace Elem Med Biol. 2014;28(1):75–9. https://doi.org/10.1016/j.jtemb.2013.07.005.
Skalickova S, et al. Selenium nanoparticles as a nutritional supplement. Nutrition. 2017;33:83–90. https://doi.org/10.1016/j.nut.2016.05.001.
Faghfuri E, et al. Dose-Response Relationship Study of Selenium Nanoparticles as an Immunostimulatory Agent in Cancer-bearing Mice. Arch Med Sci. 2015;46(1):31–7. https://doi.org/10.1016/j.arcmed.2015.01.002.
Yazdi MH, et al. The immunostimulatory effect of biogenic selenium nanoparticles on the 4T1 breast cancer model: an in vivo study. Biol Trace Elem Res. 2012;149(1):22–8. https://doi.org/10.1007/s12011-012-9402-0.
Shanmugam MK, et al. Ursolic acid in cancer prevention and treatment: molecular targets, pharmacokinetics, and clinical studies. Biochem Pharmacol. 2013;85(11):1579–87. https://doi.org/10.1016/j.bcp.2013.03.006.
Wang J, et al. Ursolic Acid Inhibits Proliferation and Induces Apoptosis in Human Glioblastoma Cell Lines U251 by Suppressing TGF-β1/miR-21/PDCD4 Pathway. Basic Clin Pharmacol Toxicol. 2012;111(2):106–12. https://doi.org/10.1111/j.1742-7843.2012.00870.x.
Zare H, Sanaei M, Yazdi MH et al. Selenium Nanoparticle-Enriched Lactobacillus plantarum Causes More Anti-carcinogenic Effect on Human Colon Cancer Cells Compared to Non-enriched Ones. BioNanoSci 2023; https://doi.org/10.1007/s12668-023-01133-x.
Shakibaie M, Khorramizadeh MR, Faramarzi MA, Sabzevari O, Shahverdi AR. Biosynthesis and recovery of selenium nanoparticles and the effects on matrix metalloproteinase-2 expression. Biotechnol Appl Biochem. 2010;56:7–15. https://doi.org/10.1042/BA20100042.
Sanaei M, Mahdavi M, Setayesh N, et al. Comparison of Cytokine Expression in Human PBMCs Stimulated with Normal and Heat-Shocked Lactobacillus plantarum Cell Lysate. Probiotics & Antimicro Prot. 2021. https://doi.org/10.1007/s12602-021-09785-5.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2∆∆C(T). Method Methods. 2001;25(4):402–8. https://doi.org/10.1006/meth.2001.
Di D, et al. Downregulation of human intercellular adhesion molecule-1 attenuates the metastatic ability in human breast cancer cell lines. Oncol Rep. 2016;35(3):1541–8. https://doi.org/10.3892/or.2016.4543.
Creighton CJ, Chang JC, Rosen JM. Epithelial-mesenchymal transition (EMT) in tumor-initiating cells and its clinical implications in breast cancer. J Mammary Gland Biol Neoplasia. 2010;15(2):253–60. https://doi.org/10.1007/s10911-010-9173-1.
Li H, et al. The relationship between MMP-2 and MMP-9 expression levels with breast cancer incidence and prognosis. Oncol Lett. 2017;14(5):5865–70. https://doi.org/10.3892/ol.2017.6924.
Aysola K, et al. Triple Negative Breast Cancer - An Overview. Hereditary Genet. 2013;2001. https://doi.org/10.4172/2161-1041.s2-001.

Download PDF

Editorial decision: Reject
15 Oct, 2023
Reviewers agreed at journal
25 Sep, 2023
Reviewers invited by journal
23 Sep, 2023
Editor assigned by journal
11 Sep, 2023
First submitted to journal
10 Sep, 2023

You are reading this latest preprint version

Effect of Ursolic Acid, Selenium Nanoparticles, and Their Combination on the Metastasis-Associated Gene Expression in MDA-MB-231 Breast Cancer Cells: In-vitro Study

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Cell culture condition

selenium nanoparticles’ preparation

Ursolic acid preparation

MDA-MB-231 cell viability assay

RNA extraction and cDNA synthesis

Real-time polymerase chain reaction

Scratch assay

Statistical analysis

Results

Cell viability by MTT assay

Effect of SeNPs and Ursolic acid on MMP-2, MMP-9, and ICAM-1 expression levels

Scratch assay

Discussion

Declarations

References

Status:

Version 1