Connexin32 promotes autophagy of cervical cancer to resistance to chemotherapy-induced apoptosis via AMPK pathway

doi:10.21203/rs.3.rs-337122/v1

PDF

Research

Connexin32 promotes autophagy of cervical cancer to resistance to chemotherapy-induced apoptosis via AMPK pathway

https://doi.org/10.21203/rs.3.rs-337122/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 22 Mar, 2021

You are reading this latest preprint version

Background

The roles of gap junction and its components, connexins in autophagy of cervical cancer cells are rarely investigated. Our previous study demonstrated that connexin32 (Cx32) exerted an anti-apoptotic effect on cervical cancer (CaCx). However, as an important regulator of apoptosis, whether the autophagy is involved in the function of Cx32 on cervical cancer cells are not well defined.

Methods

The expression of Connexin32 and the autophagy-associated protein LC3-Ⅱ in paracancerous cervical tissues (n = 30) and cervical cancer (n = 50) tissues were determined by Western blotting. Forty-five cervical cancer specimens were used to evaluate the clinical relevance of Connexin32 and LC3-Ⅱ. The effect of Connexin32 on autophagy was examined by detecting the change of LC3-Ⅱ using Western blotting, transfection with enhanced green fluorescent protein-LC3 plasmid and transmission electron microscopy analysis. The mechanism of Connexin32-mediated autophagy was assessed by Western blotting and flow cytometry.

Results

Both Connexin32 and LC3-Ⅱ are upregulated in cervical cancer tissues compared to those in paracancerous cervical tissues. Overexpression of Connexin32 significantly enhanced autophagy in HeLa-Connexin32 cells, whereas knockdown of Connexin32 suppressed autophagy in C-33A cells. Connexin32 inhibited apoptosis of cervical cancer cells by promoting autophagy. Moreover, Connexin32 triggered autophagy by activation of the AMP-activated protein kinase signalling, which was gap junction-independent.

Conclusion

Connexin32 exerts its anti-apoptotic effect by activating autophagy through the AMPK pathway in cervical cancer. This finding suggests that Connexin32 is a potential biomarker and a new therapeutic target for cervical cancer.

Trial registration

The study was approved by the Research Committee of Ethics of the Affiliated Cancer Hospital of Xinjiang Medical University (K-201354).

Clinical Pharmacology

Urology & Nephrology

Biomedical Engineering

Connexin32

Cervical carcinoma

Autophagy

Apoptosis

AMP-activated protein kinase

Cervical cancer (CaCx) ranks third in morbidity and mortality among gynaecological malignancies worldwide (1, 2). Despite recent advances in diagnostic criteria and clinical therapeutic strategies, a great number of women suffer from advanced disease (3). Surgery, radiotherapy, and chemotherapy are currently the three main treatments for CaCx, but the therapeutic efficiency is not so satisfactory (4). Connexin (Cx) is an important component of gap junction (GJ), which modulates various cellular processes, including electrical coupling, proliferation, differentiation, and apoptosis (5). Previous studies revealed that GJs and Cx are defective in tumour progression and that GJ recovery impedes cell proliferation and metabolism in tumours (6, 7).However, there are also emerging studies have demonstrated that Cx protein itself affects the development of carcinoma in a GJ-independent manner in recent years (8, 9). In fact, different connexin isoforms have various channel-dependent and-independent functions that are tissue and stage specific (10)

Among the 21 human connexin protein family,Cx32, Cx43 and Cx26 are widely studied. Our previous studies showed that unlike other Cxs,a specific type of Cx, connexin32 (Cx32) is aberrantly upregulated and mislocalized in human CaCx tissue, which mediates anti-apoptotic and pro-tumour effects via the EGFR and NF-κB pathways in CaCx (11–14). However, besides apoptosis, the role of Cx32 on other types of cell death (e.g. autophagic cell death or necrosis) still needs to be further investigated in CaCx.

Autophagy is a conserved process for bulk degradation and recycling of cytoplasmic protein and organelles in lysosomes, providing free fatty acids and amino acids to maintain energy production and protein synthesis (15, 16). Autophagy contributes to the turnover of membrane proteins, including surface receptors and structural components (17, 18). As membrane protein-based structures,the stability and degradation of GJ plaques and Cx are regulated by macroautophagy via the ubiquitin–proteasome system and lysosomes (19–21). Endocytosed GJ is degraded by autophagy (22), while Cx43 degradation and gap junctional intercellular communication (GJIC) impairment induced by simulated ischaemia is prevented by chemical or genetic inhibitors of autophagy (23). On the other hand, Cx inversely acts as negative regulators of autophagic flux (24). In fact, Cx suppress autophagy by recruiting pre-autophagosomal Atg proteins and PI3K components (25). However, as a specific type of Cx, the role of Cx32 in the processes of autophagy formation is unclear, especially in CaCx.

In addition, to explore the correlation of Cx32 and autophagy in isolation cannot reflect the practical significance of Cx32 in CaCx progression.Autophagy and apoptosis are two distinct mechanisms that may be antagonistic in cancer cells (26). It has been reported that inhibition of autophagy enhances N, N-diethylnorspermine-induced apoptosis in colon cancer cells (27). Conversely, activation of autophagy by globular adiponectin attenuates ethanol-induced apoptosis in liver cancer cells (28). However, whether autophagy is involved in the anti-apoptotic effect of Cx32 in CaCx remains unclear.Therefore, we investigated the relationship between Cx32 and autophagy in the presence or absence of GJ formation, in order to elaborate new findings ornovel mechanisms of Cx32 in CaCx cancerization.

Reagents and antibodies

Streptonigrin (SN), chloroquine (CQ), bafilomycin A1 (BA1), rapamycin (RAP), doxycycline (Dox), compound C, anti-GAPDH and anti-actin antibodies were obtained from Sigma-Aldrich (St. Louis, MO, USA). G418 and hygromycin B were purchased from Calbiochem (San Diego, CA, USA). Primary antibodies against GAPDH, β-tubulin, β-actin, LC3, Atg4, Atg5, Atg7, cleaved-caspase3, cleaved-PARP, AMPK/p-AMPK, and mTOR/p-mTOR were purchased from Cell Signalling Technology (Danvers, MA, USA). Anti-Cx32 antibody was obtained from Santa Cruz (Dallas, TX, USA). SiRNA targeting Cx32, Atg5 and AMPK were constructed by RiboBio (Guangzhou, China). EGFP-LC3 plasmids were constructed by Genecopoeia (Rockville, MD, USA). The BCA protein assay kit was purchased from Bio-Rad (Hercules, CA, USA). An Annexin V-FITC apoptosis detection kit was purchased from Biotool (Houston, TX, USA). A Chemiluminescent HRP substrate kit was obtained from Millipore Corporation (Billerica, MA, USA). Secondary antibody, Lipofectamine™ 2000, DEME and Eagle's minimum essential medium (EMEM) media were purchased from Invitrogen (Carlsbad, CA, USA).

Human cervical specimens and clinical data

The study was approved by the Research Committee of Ethics of the Affiliated Cancer Hospital of Xinjiang Medical University (13, 14). Human cervical tissue samples were collected from patients from 2012 to 2014 at the Affiliated Cancer Hospital of Xinjiang Medical University, Xinjiang, China. None of the patients had received any chemoradiotherapeutic agents preoperatively. We collected 50 specimens of CaCx from patients who underwent total hysterectomy and 30 specimens of benign multiple uterine fibroids as normal cervical controls. All the CaCx tissue specimens, corresponding peritumoural tissues (< 3 cm distance from the tumour tissue), and remote normal liver tissues (5 cm away from the tumour tissue) were collected within 10 min. After hysterectomy, cervical specimens were stored in liquid nitrogen for protein extraction. The expression of Cx32 and LC3 was detected by Western blotting.

Cell lines and low-density cultures

The humanCaCx cell line (C-33A) was purchased from American Type Culture Collection (Manassas, VA, USA) and were cultured in EMEM; HeLa-Cx32 cells (a gift from Dr. Andrew L. Harris) are a stable transgenic cell line expressing Cx32 under the control of a bidirectional tetracycline-inducible promoter that was previously described and characterized (14). The cells were grown as monolayer cultures in DMEM supplemented with 100 μg·ml⁻¹ G418 sulfate and 200 μg·ml⁻¹ hygromycin B. Cx32 expression was induced with 1 μg·ml⁻¹ Dox for 48 h. All the cell lines were supplemented with 10% foetal bovine serum and were grown at 37°C in a 5% CO₂ atmosphere. To physically inhibit gap junction formation, we adopted the low-density culture method, and 1×10⁵ cells were seeded in a 150 mm dish to ensure that the cells were not in direct contact with each other (11, 13).

Western blotting

Tissue or cells were lysed with RIPA buffer (50 mM Tris-HCl pH 7.8, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, and 0.1% SDS) containing a protease inhibitor cocktail (Sigma-Aldrich). The proteins were quantified by using a Bio-Rad protein assay kit (Hercules, CA, USA), and equivalent amounts of protein (20 μg) were resolved on 12% or 9% SDS-PAGE gels and transferred onto 0.2 μm or 0.45 μm Immobilon-P transfer membranes (Millipore, Billerica, MA, USA). The membranes were subsequently incubated in blocking buffer (5% nonfat milk) for 1 h at room temperature and then incubated with appropriate primary antibodies in blocking buffer at 4°C overnight. The dilutions of the antibodies were as follows: anti-LC3 and anti-Cx32 were 1:1000; anti-cleaved-caspase3, anti-cleaved-PARP, anti-Atg4, anti-Atg5, anti-Atg7, anti-AMPK/p-AMPK and anti-mTOR/p-mTOR were 1:1500; and anti-β-tubulin, anti-β-actin and anti-GAPDH were 1:10000. The proteins were probed with the relevant secondary antibody, detected with an ECL reagent (Millipore) and quantified by ImageQuant LAS 4000TM and ImageJ software. Anti-β-tubulin, anti-β-actin and anti-GAPDH were used as loading controls.

Hoechst 33258 staining

Briefly, HeLa cells were fixed with 4% paraformaldehyde for 20 min and permeabilized with a solution containing 1% BSA and 0.5% Triton X-100 for 15 min at 37 °C. Then, the apoptotic cells were detected by staining with 0.1 μg·ml⁻¹ Hoechst 33258 for 15 min in the dark and washed with PBS. Finally, morphological changes in apoptotic nuclei were observed under a fluorescence microscope (IX71; Olympus, Tokyo, Japan) with an ultraviolet filter.

Apoptosis analysis

Apoptosis was induced in cells by incubation with 1 μM SN for 7 h (11, 13). Apoptosis was assessed via flow cytometry using an annexin V-FITC apoptosis detection kit according to the manufacturer's protocol. After exposure to SN, the cells were trypsinized, washed and collected. Then, the cells were resuspended in annexin-V binding buffer and incubated with 5μl fluorescein isothiocyanate (FITC)-Annexin V and 2 μl PI for 15 min in the dark at 37°C. The apoptotic cellswere immediately analysed by flow cytometry using the Expo32 Software (Beckman XL, USA). The ratio of early apoptotic cells was compared to that of the controls for each experiment. Cell apoptosis was analysed with FlowJo 7.6 software.

Immunofluorescence staining

Cells were fixed with 4% paraformaldehyde for 20 min, permeabilized with 0.5% Triton X-100 for 15 min, washed and blocked in 10% normal goat serum for 1 h. After blocking, the cells were incubated with a primary antibody against Cx32 (1:200) at 4°C overnight, washed and incubated with FITC-conjugated goat anti-mouse secondary antibody (1:400) in the dark at 37°C for 1 h. For identification of nuclear and cytoplasmic architecture, the cells were stained with 0.1 μg·ml⁻¹ Hoechst 33342 for 10 min and Alexa Fluor 488 Phalloidin (1:20) for 20 min in the dark. The cells were observed under a confocal microscope.

Transmission electron microscopy

Cells were harvested by trypsinization, washed and fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer. After washing in phosphate buffer, the samples were post-fixed in 1% osmium tetroxide, washed again, and dehydrated in a graded series of ethanol. Then, the cells were embedded in spur resin for cutting into ultrathin sections. Transmission electron microscopy was used to observe all autophagosomal structures after staining the sections (a thickness of 50 nm) with uranyl acetate and lead citrate (29).

EGFP-LC3 plasmid transfection and siRNA interference

Cells were seeded in 6-well plates and grown to 80% confluence and then transfected with EGFP-LC3 plasmid using Lipofectamine 2000. For siRNA interference, the cells were grown to 30%-50% confluence, and then the cells were transfected for 6 h with the corresponding non-specific siRNA, targeted siRNA (50 nM) or scrambled control siRNA with Lipofectamine™ 2000. The cells were cultured in complete medium for 48h, and EGFP-LC3 plasmid transfection and siRNA interference were detected by immunofluorescence and Western blotting. The sequences for the synthetic DNA targeting EGFP-LC3 were as follows: forward primer: 5’ATGCCGTCGGAGAAGA

CCTTCAAG3’ and reverse primer: 5'TTACAC TGACAATTTCATCCCGAACGT3'. The sequences of the synthetic siRNAs targeting Cx32 (siCx32) were as follows: siCx32_1: 5’-CACCAACAACACATAGAAA-3’, siCx32_2: 5-GCATCTGCATTAT

CCTCAA-3’, and siCx32_3: 5’-GCCTCTCACCTGAATACAA-3’. The sequences of the synthetic siRNAs targeting Atg5 (siAtg5) were as follows: siAtg5_1: 5’-GGAATATCCTGCAGAAGAA-3’, siAtg5_2:5’-GGAACATCACAGTACATT

T-3’, and siAtg5_3:5’-GTGAGATATGGTTTGAATA-3’. The sequences of the synthetic siRNAs targeting AMPK (siAMPK) were as follows: siAMPK_1: 5′GAGGAGAGCTATTTGATTA_3′, siAMPK_2:5′-GCAGAAGTATGTAGAGCAA

-3′, and siAMPK_3: 5′-GATTGATGATGAAGCCTTA-3′.

Statistical analysis

All data are representative of at least three independent experiments and are presented as the mean ± standard error. Normal distribution test and homogeneity of variance test have been performed prior to statistical analysis. Analysis of variance (ANOVA), a Student’s t-test, and a Wilcoxon test were used to evaluate statistical significance. Pearson's correlation analysis was used toanalyse the correlation between Cx32 and LC3-II expression, and GraphPad Prism 6.0 software was used to create the histograms and scatter plots. A value of P<0.05 was considered to indicate a statistically significant difference.

Cx32 positively correlates with autophagy in human CaCx

LC3-II is a well-known indicator of autophagosome formation (30). Thus, the expression of Cx32 and LC3-II was detected in normal cervix controls (n=30) and CaCx tissue (n=50) to evaluate the relationship between Cx32 and autophagy. Both Cx32 and LC3 were significantly increased in CaCx tissues compared with those in normal cervical tissues (Fig. 1a and 1b). Moreover, LC3-II was increased in cervical tissues with upregulated Cx32 expression, and there was a significant association between Cx32 and LC3-II (n=45, r=0.625, P=0.00055) (Fig. 1c).

Overexpression of Cx32 promotes autophagy in HeLa cells

Next, we examined the effect of Cx32 on autophagy in HeLa-Cx32 cell, a stable transgenic cell line expressing Cx32 by a bidirectional tetracycline-inducible promoter, since Cx32 is not naturally expressed in HeLa cells. Western blotting and immunofluorescence demonstrated that Cx32 expression was induced by doxycycline (Dox, 1μg•ml ⁻¹, 48 h) (Fig. 2a and 2b) . However, LC3-II expression was unchanged in the presence of Dox in control Hela cells (Fig. 2c). Induction of Cx32 expression with Dox was accompanied by upregulation of LC3-II, autophagy-related gene 4 (Atg4), Atg5 and Atg7 (Fig. 2d). These data suggest that Cx32 promotes autophagy in HeLa-Cx32 cells.

To figure out whether the upregulation of LC3-II was due to autophagy induction or blockage of late steps of autophagy, such as autophagosome fusion with lysosomes and lysosomal degradation, HeLa-Cx32 cells were treated simultaneously with Dox and the lysosomal inhibitor CQ (25 μM, 4 h), which blocks autophagic flux by impairing autophagosome-lysosome fusion (31). The expression of LC3-II in the Dox+CQ group was significantly increased compared to that of the Dox group (Fig. 2e), indicating an effect of Cx32 on autophagic flux. Dox-induced expression of Cx32 significantly increased LC3 puncta aggregation compared to that of control group and treatment with CQ further increased LC3 puncta accumulation induced by Cx32 (Fig. 2f). Transmission electron microscopy observation showed that Cx32 induction increased the number and size of autophagic vacuoles, whereas few vacuoles were observed in control cells. Additionally, Lysosomal inhibition by CQ further increased the number and size of autophagic vacuoles mediated by Cx32 (Fig. 2g). Together, these results suggest that Cx32 promotes the autophagosome formation and autophagic flux.

Knockdown of Cx32 negatively modulates autophagy in C-33A cells

Three different sequences of siCx32 was tested in C-33A cells that endogenously express Cx32 in cell membrane and cytoplasm. The results demonstrated that both siCx32-2 and siCx32-3 efficiently reduced Cx32 expression (Fig. 3a and 3b). Knockdown of Cx32 decreased the protein levels of LC3-II, Atg4, Atg5 and Atg7 (Fig. 3c), indicating that silencing of Cx32 inhibited autophagy in C-33A cells. Interestingly, the downregulated expression of LC3-II by Cx32 knockdown was restored by CQ (25 μM, 4 h) (Fig. 3d). Next, C-33A was transfected with siCx32-3 for 24 h, followed by transfection with the EGFP-LC3 plasmid for 36 h and then treatment with or without CQ. The result showed that silencing of Cx32 decreased the aggregation of LC3 puncta and this effect was reversed by CQ (Fig. 3e). Similar result was observed in the transmission electron microscopy experiment (Fig. 3f). These results indicate that knockdown of Cx32 blocks autophagy in C-33A cells.

Cx32 promotes autophagy in CaCx cells in a GJ-independent manner

It is known that Cx exerts its biological function through GJ-dependent and GJ-independent mechanisms. To uncover whether Cx32-induced autophagy depends on GJ, low-density culture was used to physically inhibit GJIC. In low-density culture, Dox-induced Cx32 upregulated LC3-II expression in HeLa-Cx32 cells (Fig 4a). In contrast, knockdown of Cx32 decreased LC3-II expression in C-33A cells (Fig. 4b). These data suggest that the effect of Cx32 on autophagy is mediated by Cx32 protein rather than by GJ.

Cx32 promotes autophagy via the AMPK pathway in CaCx cells

Recent studies have shown that AMPK/mTOR signalling plays an important role in regulating autophagy (32). We then examined whether AMPK/mTOR signalling was involved in Cx32-induced autophagy. Induction of Cx32 increased the levels of LC3 and p-AMPK in HeLa-Cx32 cells (Fig. 5a). In contrast, knockdown of Cx32 decreased the levels of LC3 and p-AMPK in C-33A cells (Fig. 5b). To verify the involvement of AMPK in Cx32-induced autophagy, siAMPK and inhibitor (compound C) were used to inhibit AMPK expression (33). The upregulation of LC3-II and p-AMPK expression by Cx32was reversed by siAMPK or compound C (10 μM, 6 h) in HeLa-Cx32 cells (Fig.5c and 5d). Together, these data demonstrate that Cx32 mediates autophagy via the AMPK signalling pathway.

Cx32 inhibits apoptosis by promoting autophagy

Autophagy is supposed to be a crucial modulator of apoptosis (34) . We explored the relationship between autophagy and apoptosis in CaCx cells and found that pretreatment with an autophagy activator rapamycin (RAP, 2 μM, 4 h) significantly inhibited SN (1 μM, 6 h)-induced apoptosis in HeLa cells (Fig. 6a). In contrast, treatment with autophagy inhibitors CQ (25 μM, 4 h) or Baf-A1 (100 nM, 4 h) enhanced apoptosis (Fig. 6a). The Atg5-Atg12 conjugation system is essential for autophagy, and inhibition of Atg5 specifically inhibits autophagy (35). Atg5 is key regulator controlling autophagy. Knockdown of Atg5 reduced LC3-II expression (Fig. 6b). Moreover, inhibition of autophagy by siAtg5-3 increased the level of apoptosis (Fig. 6c). Together, these data indicate that autophagy suppresses apoptosis in HeLa cells.

Next, we determined the effect of autophagy on Cx32-mediated apoptosis. Induction of Cx32 significantly inhibited SN-induced apoptosis in HeLa-Cx32 cells and this inhibition was blocked by pretreatment with autophagy inhibitor CQ (25 μM, 4 h) or Baf-A1 (100 nM, 4 h) (Fig. 7a). In agreement with this result, overexpression of Cx32 reduced the levels of apoptosis-related protein, cleaved caspase3 and cleaved PARP, which was increased by SN. Moreover, pretreatment with CQ or Baf-A1 reversed the suppressive effect of Cx32 (Fig. 7b). Together, these results suggest that Cx32 inhibits apoptosis by activating autophagy in CaCx cells.

Both augophagy and apoptosis are complex process. Previously we had elucidated that Cx32 could inhibited apoptosis in CaCx by EGFR and NF-κB pathways.However, besides apoptosis, various other functions of Cx32 in CaCx are still needed to be explored. In the present study, a positive correlation between Cx32 and LC3 was revealed in CaCx specimens. Importantly, by activation of AMPK signalling that promoted autophagy, Cx32 produces a resistance to chemotherapy-induced apoptosis. This work reveals a previously unknownmechanism between Cx32and autophagy together with apoptosisin the processed of CaCx progression.

Cx is an indispensable transmembrane protein with a short half-life and is suggested to be an autophagy substrate (22, 24). But increasing studies also have reported that Cxs themselves can suppress autophagy by recruiting pre-autophagosomal Atg proteins and PI3K components (25). With a series of experiments on CaCx cells, we explored the relationship between Cx32 and autophagy in CaCx and found that Cx32 was involved in the activation of autophagy.

Cx is an important component of GJs that maintains the normal activities of cells and it functions beyond GJs or hemichannels (36). Emerging studies have reported that in some tumour types, Cx facilitates specific stages of tumour progression through both junctional and non-junctional signalling pathways (37, 38). Cytoplasmic distribution of Cx32 exerts anti-apoptotic effects in hepatocellular carcinoma (14) and mediates cisplatin resistance in ovarian cancer cells (39, 40). Cytoplasmic expression of Cx26 in colorectal cancer was responsible for lung metastasis (41). However, the carboxy-tail of Cx43 localizes to the nucleus and inhibits cell growth (42). Therefore, the role of non-junctional Cx is still under controversial. In this study, the low-density cell culture data indicated that the induction of autophagy was mediated by the Cx32 protein rather than by its role in intercellular communication. This study further illuminated the role of the Cx32 protein itself in the progression of CaCx. In future studies, uncovering the turnover and trafficking of Cx would be indispensable in understanding the correlation between Cx and cancer progression and provide potential strategies for tumour treatment.

We also identified the molecular mechanism by which Cx32 promotes autophagy in CaCx. The AMPK/mTOR pathway is one of the classic autophagy regulatory pathways and plays an important role in regulating cell metabolism, growth, proliferation and apoptosis (43, 44). Therefore, we examined whether Cx32 promoted autophagy by this pathway. Our results demonstrated that Cx32 stimulated AMPK phosphorylation but had no effect on mTOR and p-mTOR proteins levels. Accumulating evidence has reported that AMPK is an upstream molecule of mTOR and directly promotes autophagy by phosphorylating autophagy-related proteins in the mTORC1, ULK1, and PIK3C3/VPS34 complexes or indirectly by regulating the expression of autophagy-related genes downstream of transcription factors such as FOXO3, TFEB, and BRD4 (32). In addition, autophagy was reported to be induced by mTOR-independent Activation of the AMPK-ULK1 Pathway (45). Therefore, further investigation are still needed to explore the detailed mechanism of AMPK signalling involved in Cx32-mediated autophagy.

The role of autophagy in tumor growth remains controversial (46). On the one hand, autophagy inhibits tumour formation by reducing oxidative stress and DNA damage in normal tissues. On the other hand, autophagy provides cells with energy and vital compounds upon various stress stimuli in developed cancers, thus promoting tumour cell survival (47). Autophagy and apoptosis cross-regulate each other through an elaborate network (48). Autophagy reduces apoptosis by regulating the activity of caspase family proteins(49). In contrast, autophagy promotes apoptosis by autophagic degradation of certain types of IAPs (inhibitor of apoptosis proteins)(50, 51). In the present study, induction of autophagy reversed SN-induced apoptosis in HeLa cells, suggesting that autophagy antagonizes apoptosis in CaCx. To our knowledge, this is the first evidence showing that autophagy and apoptosis are antagonists in CaCx cells.

Our results further indicated that Cx32-induced autophagy antagonizes SN-induced apoptosis. These findings revealed a new mechanism by which Cx32 promotes autophagy and inhibits apoptosis, which accounts for the pro-tumour effect and drug resistance resulting from Cx32 in CaCx. This study may demonstrates a novel mechanism and provide a theoretical basis for Cx32 as a potential therapeutic target in CaCx

In conclusion, Cx32 promotes autophagy via the AMPK signalling pathway to protect CaCx cells from chemotherapy-induced apoptosis, suggesting that Cx32 may be a potential biomarker for chemotherapy resistance and may serve as a key link for autophagy and apoptosis in CaCx.

CaCx, cervical cancer; Cx, Connexin; GJs, gap junctions; Cx32,Connexin32;GJIC, gap junctional intercellular communication; Atg, autophagy-related gene; PI3K, phosphoinositide 3-kinase; SN, Streptonigrin; CQ, chloroquine, BA1, bafilomycin A1; RAP, rapamycin; Dox, doxycycline; AMPK, AMP-activated protein kinase

Ethics approval and consent to participate

Ethical approval (K-201354) of clinical tissues was obtained from the Research Committee of Ethics in the Affiliated Cancer Hospital of Xinjiang Medical University.

Consent for publication

Written informed consent form for the experimental studies was obtained from the patients or their guardians.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Competing interests

All authors declare that they have no competing interests.

Funding

This work was supported by the Guangdong Basic and Applied Basic Research Foundation (Grant No. 2019A1515012215), the grant from Department of Science and Technology of Guangdong Province (Grant No.20160908), the National Natural Science Foundation of China (Grant No. 81473234) and the Joint Fund of the National Natural Science Foundation of China (Grant No. U1303221).

Authors' contributions

LT and QW designed research. LXF and LT performed the study. SYC and ZYZ participated in Western blotting of cervical tissues tissue. FY and RYS analyzed the data and prepared the figures and tables. LXF and YCL wrote the paper.

Acknowledgements

We thank the Affiliated Cancer Hospital of Xinjiang Medical University for providing parts of experimental assistance.

Tsikouras P, Zervoudis S Fau - Manav B, Manav B Fau - Tomara E, Tomara E Fau - Iatrakis G, Iatrakis G Fau - Romanidis C, Romanidis C Fau - Bothou A, et al.: Cervical cancer: screening, diagnosis and staging. J BUON 2016; 21: 320-5.
Moshkovich OA-O, Lebrun-Harris LA-O, Makaroff L, Chidambaran PA-O, Chung M, Sripipatana AA-O, et al.: Challenges and Opportunities to Improve Cervical Cancer Screening Rates in US Health Centers through Patient-Centered Medical Home Transformation. Adv Prev Med 2015; 2015: 182073.
Boussios S, Seraj E, Zarkavelis G, Petrakis D, Kollas A, Kafantari A, et al.: Management of patients with recurrent/advanced cervical cancer beyond first line platinum regimens: Where do we stand? A literature review. Crit Rev Oncol Hematol 2016; 108: 164-74.
Marth C, Landoni F, Mahner S, McCormack M, Gonzalez-Martin A, Colombo N, et al.: Cervical cancer: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol 2017; 28: iv72-iv83.
Sinyuk M, Mulkearns-Hubert EE, Reizes O and Lathia J: Cancer Connectors: Connexins, Gap Junctions, and Communication. Front Oncol 2018; 8: 646.
Wang Q, You T, Yuan D, Han X, Hong X, He B, et al.: Cisplatin and oxaliplatin inhibit gap junctional communication by direct action and by reduction of connexin expression, thereby counteracting cytotoxic efficacy. J Pharmacol Exp Ther 2010; 333: 903-11.
Zhang Y, Tao L, Fan L, Peng Y, Yang K, Zhao Y, et al.: Different gap junction-propagated effects on cisplatin transfer result in opposite responses to cisplatin in normal cells versus tumor cells. Sci Rep 2015; 5.
Li Q, Omori Y, Nishikawa Y, Yoshioka T, Yamamoto Y and Enomoto K: Cytoplasmic accumulation of connexin32 protein enhances motility and metastatic ability of human hepatoma cellsin vitro andin vivo. International Journal of Cancer 2007; 121: 536-46.
Luo H, Wang X, Ge H, Zheng N, Peng F, Fu Y, et al.: Inhibition of ubiquitinspecific protease 14 promotes connexin 32 internalization and counteracts cisplatin cytotoxicity in human ovarian cancer cells. Oncol Rep 2019; 42: 1237-47.
Aasen T, Leithe E, Graham SV, Kameritsch P, Mayán MD, Mesnil M, et al.: Connexins in cancer: bridging the gap to the clinic. Oncogene 2019; 38: 4429-51.
Lai Y, Fan L, Zhao Y, Ge H, Feng X, Wang Q, et al.: Cx32 suppresses extrinsic apoptosis in human cervical cancer cells via the NFkappaB signalling pathway. Int J Oncol 2017; 51: 1159-68.
Lai Y, Tao L, Zhao Y, Zhang X, Sun X, Wang Q, et al.: Cx32 inhibits TNFalpha-induced extrinsic apoptosis with and without EGFR suppression. Oncol Rep 2017; 38: 2885-92.
Zhao Y, Lai Y, Ge H, Guo Y, Feng X, Song J, et al.: Non-junctional Cx32 mediates anti-apoptotic and pro-tumor effects via epidermal growth factor receptor in human cervical cancer cells. Cell Death and Disease 2017; 8: e2773.
Xiang Y, Wang Q, Guo Y, Ge H, Fu Y, Wang X, et al.: Cx32 exerts anti-apoptotic and pro-tumor effects via the epidermal growth factor receptor pathway in hepatocellular carcinoma. J Exp Clin Cancer Res 2019; 38: 145.
Ravanan P, Srikumar IF and Talwar P: Autophagy: The spotlight for cellular stress responses. Life Sci 2017; 1: 53-67.
Kardideh B, Samimi Z, Norooznezhad F, Kiani S and Mansouri K: Autophagy, cancer and angiogenesis: where is the link? Cell Biosci 2019; 9: 65.
Jin EJ, Kiral FR and Hiesinger PR: The where, what, and when of membrane protein degradation in neurons. Dev Neurobiol 2018; 78: 283-97.
Wang S, Zhu X, Xiong L, Zhang Y and Ren J: Toll-like receptor 4 knockout alleviates paraquat-induced cardiomyocyte contractile dysfunction through an autophagy-dependent mechanism. Toxicol Lett 2016; 22: 11-22.
Zhu X, Ruan Z Fau - Yang X, Yang X Fau - Chu K, Chu K Fau - Wu H, Wu H Fau - Li Y, Li Y Fau - Huang Y, et al.: Connexin 31.1 degradation requires the Clathrin-mediated autophagy in NSCLC cell H1299. J Cell Mol Med 2015; 19: 257-64.
Shen ZA-Ohoo, Chen Q, Jin T, Wang M, Ying H, Lu J, et al.: Theaflavin 3,3'-digallate reverses the downregulation of connexin 43 and autophagy induced by high glucose via AMPK activation in cardiomyocytes. J Cell Physiol 2019; 234: 17999-8016.
Yang X, Xu S, Su Y, Chen B, Yuan H, Xu A, et al.: Autophagy-Src Regulates Connexin43-Mediated Gap Junction Intercellular Communication in Irradiated HepG2 Cells. Radiat Res 2018; 190: 494-503.
Fong JT, Kells Rm Fau - Gumpert AM, Gumpert Am Fau - Marzillier JY, Marzillier Jy Fau - Davidson MW, Davidson Mw Fau - Falk MM and Falk MM: Internalized gap junctions are degraded by autophagy. Autophagy 2012; 8: 794-811.
Martins-Marques T, Catarino S, Zuzarte M, Marques C, Matafome P, Pereira P, et al.: Ischaemia-induced autophagy leads to degradation of gap junction protein connexin43 in cardiomyocytes. Biochem J 2015; 467: 231-45.
Iyyathurai J, Decuypere JP, Leybaert L, D'Hondt C and Bultynck G: Connexins: substrates and regulators of autophagy. BMC Cell Biol 2016; 17: 20.
Bejarano E, Yuste A, Patel B, Stout RF, Jr., Spray DC and Cuervo AM: Connexins modulate autophagosome biogenesis. Nat Cell Biol 2014; 16: 401-14.
Maiuri MC, Zalckvar E Fau - Kimchi A, Kimchi A Fau - Kroemer G and Kroemer G: Self-eating and self-killing: crosstalk between autophagy and apoptosis. Nat Rev Mol Cell Biol 2007; 8: 741-52.
Gurkan AC, Arisan ED, Yerlikaya PO, Ilhan H and Unsal NP: Inhibition of autophagy enhances DENSpm-induced apoptosis in human colon cancer cells in a p53 independent manner. Cell Oncol (Dordr) 2018; 41: 297-317.
Nepal S and Park PH: Activation of autophagy by globular adiponectin attenuates ethanol-induced apoptosis in HepG2 cells: involvement of AMPK/FoxO3A axis. Biochim Biophys Acta 2013; 1833: 2111–25.
Martinet W, Timmermans JP and De Meyer GR: Methods to assess autophagy in situ--transmission electron microscopy versus immunohistochemistry. Methods Enzymol 2014; 543: 89-114.
Mizushima N and Yoshimori T: How to interpret LC3 immunoblotting. Autophagy 2007; 3: 542-5.
Mauthe M, Orhon I, Rocchi C, Zhou X, Luhr M, Hijlkema KJ, et al.: Chloroquine inhibits autophagic flux by decreasing autophagosome-lysosome fusion. Autophagy 2018; 14: 1435-155.
Li Y and Chen Y: AMPK and Autophagy. Adv Exp Med Biol 2019; 1206: 85-108.
Hardie DG: AMPK and autophagy get connected. EMBO J 2011; 30: 634-5.
Sun X, Momen A, Wu J, Noyan H, Li R, von Harsdorf R, et al.: p27 protein protects metabolically stressed cardiomyocytes from apoptosis by promoting autophagy. J Biol Chem 2014; 289: 16924-35.
Mizushima N, Yoshimori T Fau - Ohsumi Y and Ohsumi Y: The role of Atg proteins in autophagosome formation. Annu Rev Cell Dev Biol 2011; 27: 107-32.
Goodenough DA and Paul DL: Beyond the gap: functions of unpaired connexon channels. Nat Rev Mol Cell Biol 2003; 4: 285-94.
Polusani SR, Kalmykov EA, Chandrasekhar A, Zucker SN and Nicholson BA-O: Cell coupling mediated by connexin 26 selectively contributes to reduced adhesivity and increased migration. J Cell Sci 2016; 129: 4399-410.
Chen Q, Boire A, Jin X, Valiente M, Er EE, Lopez-Soto A, et al.: Carcinoma-astrocyte gap junctions promote brain metastasis by cGAMP transfer. Nature 2016; 533: 493-8.
Wu W, Fan L, Bao Z, Zhang Y, Peng Y, Shao M, et al.: The cytoplasmic translocation of Cx32 mediates cisplatin resistance in ovarian cancer cells. Biochem Biophys Res Commun 2017; 487: 292-9.
Zhang Y, Tao L, Fan LX, Huang K, Luo HM, Ge H, et al.: Cx32 mediates cisplatin resistance in human ovarian cancer cells by affecting drug efflux transporter expression and activating the EGFRAkt pathway. Mol Med Rep 2019; 19: 2287-96.
Ezumi K, Yamamoto H Fau - Murata K, Murata K Fau - Higashiyama M, Higashiyama M Fau - Damdinsuren B, Damdinsuren B Fau - Nakamura Y, Nakamura Y Fau - Kyo N, et al.: Aberrant expression of connexin 26 is associated with lung metastasis of colorectal cancer. Clin Cancer Res 2008; 14: 677-84.
Dang X, Doble Bw Fau - Kardami E and Kardami E: The carboxy-tail of connexin-43 localizes to the nucleus and inhibits cell growth. Mol Cell Biochem 2003; 242: 35-8.
Tamargo-Gomez I and Marino G: AMPK: Regulation of Metabolic Dynamics in the Context of Autophagy. Int J Mol Sci 2018; 19: pii: E3812.
Visnjic D, Dembitz V and Lalic H: The Role of AMPK/mTOR Modulators in the Therapy of Acute Myeloid Leukemia. Curr Med Chem 2019; 26: 2208-29.
Li RL, Wu SS, Wu Y, Wang XX, Chen HY, Xin JJ, et al.: Irisin alleviates pressure overload-induced cardiac hypertrophy by inducing protective autophagy via mTOR-independent activation of the AMPK-ULK1 pathway. J Mol Cell Cardiol 2018; 121: 242-55.
Cristofani RA-OX, Montagnani Marelli M, Cicardi ME, Fontana F, Marzagalli M, Limonta P, et al.: Dual role of autophagy on docetaxel-sensitivity in prostate cancer cells. Cell Death Dis 2018; 9: 889.
Cotzomi-Ortega I, Aguilar-Alonso P, Reyes-Leyva J and Maycotte P: Autophagy and Its Role in Protein Secretion: Implications for Cancer Therapy. Mediators Inflamm 2018; 2018: 4231591.
Chung Y, Lee J, Jung S, Lee Y, Cho JW and Oh YJ: Dysregulated autophagy contributes to caspase-dependent neuronal apoptosis. Cell Death Dis 2018; 9: 1189.
Tsapras P and Nezis IP: Caspase involvement in autophagy. Cell Death Differ 2017; 24: 1369-79.
He W, Wang Q, Srinivasan B, Xu J, Padilla MT, Li Z, et al.: A JNK-mediated autophagy pathway that triggers c-IAP degradation and necroptosis for anticancer chemotherapy. Oncogene 2014; 33: 3004-13.
Xu J, Xu X, Shi S, Wang Q, Saxton B, He W, et al.: Autophagy-Mediated Degradation of IAPs and c-FLIP(L) Potentiates Apoptosis Induced by Combination of TRAIL and Chal-24. J Cell Biochem 2016; 117: 1136-44.

PDF

Version 1

posted 22 Mar, 2021

You are reading this latest preprint version

Connexin32 promotes autophagy of cervical cancer to resistance to chemotherapy-induced apoptosis via AMPK pathway

Status:

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Version 1