Finding a needle in a haystack: DNA Haemoproteus columbae enrichment using percoll density gradient and flow cytometry

doi:10.21203/rs.3.rs-3396718/v1

Download PDF

Research Article

Finding a needle in a haystack: DNA Haemoproteus columbae enrichment using percoll density gradient and flow cytometry

https://doi.org/10.21203/rs.3.rs-3396718/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 29 Feb, 2024

Read the published version in Veterinary Parasitology →

Version 1

posted

You are reading this latest preprint version

Isolation of genomic DNA of blood parasites in birds, herpetofauna, and fishes is a challenging task, given that their red blood cells are nucleated; for that reason, parasite genomic DNA is only a fraction of the total extracted DNA, and it is challenging to obtain concentrated high-quality genetic material. Percoll Density Gradient (PDG) and flow cytometry are tools for separating and analyzing cell populations or even a single cell, and both represent potent approaches for isolating avian blood parasites. Our experimental design included several steps seeking to concentrate the parasite´s DNA. We used blood samples from a Rock pigeon infected with Haemoproteus columbae. After inducing parasite exflagellation in vitro, we subjected the samples to a Percoll Density Gradient to separate the parasites from the rest of the blood cells. Following centrifugation, the layer containing extracellular parasites underwent a flow cytometry and cell sorting process, during which we selected two different subpopulations of cells for analysis. Based on qPCR analyses, we demonstrate parasite DNA enrichment in Percoll Density Gradient and flow cytometry samples; simultaneously, these samples showed the lowest concentration of Columba livia DNA. However, the concentration of parasite DNA was higher in the PDG than in the cell sorting sample. This study reports the concentration of the Haemoproteus parasite by flow cytometry without DNA-intercalating dyes, and this methodology can serve as a technique for DNA enrichment of blood parasites that infect nucleated red blood cells to obtain complete genomes.

Blood parasites

DNA enrichment

Exflagellation

haemosporida

genomics

Haemosporidia (Haemosporida, Apicomplexa) can parasitize various vertebrate hosts including mammals, birds and reptiles (Valkiūnas, 2005). Experimental models of avian malaria were primarily used in the 19th century to understand aspects of the life cycle and transmission of malaria-causing parasites in humans (Trager, 1950; Garnham, 1966).

Haemoproteus spp. are a sister group to Plasmodium spp. (Borner et al., 2016; Toscani Field et al., 2018). Like other haemosporidians, they exhibit a heteroxenous life cycle, sexual dimorphism and parasitic forms in peripheral blood and tissues. Sexual reproduction (gametogenesis and fertilization) and sporogony (sexual reproduction) occur in dipteran vectors, whereas merogony (asexual reproduction) occurs in vertebrates (Atkinson, 2008; Coral et al., 2015; Cepeda et al., 2019). Two subgenera of Haemoproteus are recognised, related to the genetic differences between the species, as well as the families of Diptera they use as vectors; then the species within the subgenus Parahaemoproteus are transmitted by ceratopogonids (Culicoides), while the parasites of the subgenus Haemoproteus use hypoboscid flies (Hippoboscidae) as vectors (Valkiūnas, 2005; Martinsen et al., 2008).

Haemoproteus (Haemoproteus) columbae is a widely distributed parasite that infects rock pigeons (Columba livia) and other columbiforms and is transmitted by the bite of louseflies (Pseudolynchia canariensis) (Aragão, 1908; Klei, 1971; Cepeda et al., 2019). Despite significant advances in molecular diagnostic tools and sequencing, there is still an information gap for haemosporidians infecting wildlife (Chakarov et al., 2012). This is because: i) the erythrocytes of birds, reptiles and amphibians are nucleated, so a large amount of host DNA dilutes the parasite DNA, making it difficult to obtain the necessary amount of genetic material for sequencing; ii) parasitemia in wildlife is usually low; iii) the genome size of vertebrate hosts is 50 to 100 times larger than that of parasites; iv) they are obligate intracellular parasites in their vertebrate host (Omori et al, 2010; Chakarov et al., 2012).

Previous assays to obtain high quality DNA from avian haemosporidia have included recreating the exflagellation process in vitro to extract sexually differentiated parasite gametes from infected red blood cells (Valkiūnas et al., 2012; Palinauskas et al., 2013; Coral et al., 2015). Exflagellation occurs when the vector consumes the infected blood of the host and the mature gametocytes inside the erythrocytes leave the red blood cell to initiate fertilization (Palinauskas et al., 2013; Coral et al., 2015). For male gametocytes, the process is relatively rapid; each nucleus produces eight microgametes, whereas a macrogametocyte produces only one macrogamete. Under in vitro conditions, this process can be simulated to promote gametocyte maturation without the need for a vector by exposing the parasite to infected blood and temperature changes, yielding the following parasitic stages: mature gametocytes, gametes, zygotes and ookinetes (Coral et al., 2015). Other approaches to separating avian haemosporidian parasites include Ficoll or Percoll density gradients (Henry & Dick, 1978; Graczyk et al., 1994). Percoll is a colloidal substance composed of silica particles, which facilitates the isolation of specific cells based on their density and buoyancy to the other cellular components in blood. This separation is achieved through the formation of density gradients during centrifugation (Pertoft, 2000).

Flow cytometry is a non-destructive technique with low impact on cell viability and function (Daubenberger et al., 2007; Miao & Cui, 2011; Lelliott et al., 2014). This technique analyses the light-scattering properties associated with intracellular complexity and size, generated by the passage of individual cells through a channel that allows them to be detected and signalled to a counter. The size of the cell can be interpreted as the intensity of the forward scattered light (FSC), while the granularity or complexity of the cell is obtained from the 90° side scatter (SSC). Infected cells are selected based on their morphological characteristics or by using fluorescent markers to signal parasite nucleic acids (Omori et al., 2010; Chakarov et al., 2012). The aim of this study was to standardise a methodology that allows DNA enrichment of the Haemoproteus columbae parasite from infected Columba livia blood samples.

2.1 Ethics and Permissions

The Bioethics Committee (Faculty of Science) of the Universidad Nacional de Colombia (Act Number: 04 of 2017 and 03 of 2018) approved the methodology used in this study. The fieldwork was carried out under permit No. 0255, granted by Colombia's National Authority for Environmental Licenses (ANLA) in 2014.

2.2 Blood samples

The methodology used for this study is described in Fig. 1. A pigeon (Columba livia) was manually captured at the Bogotá campus of the Universidad Nacional de Colombia at 2,560 meters above sea level (masl). Upon arrival at the laboratory, the bird's health status was assessed and the individual, hereafter GERPHUN929, was quarantined in a 40 x 34 x 64 cm cage covered with silk netting. A diet based on small grains (canary food supplemented with calcium carbonate) and water ad libitum was administered. Another individual of Columba livia, hereafter GERPHUN873, previously purchased in a shop and diagnosed as non-infected by blood smear and PCR, was used as a negative control for the experiment.

Blood samples were taken by puncture of the bird's brachial vein. Three blood smears were prepared, fixed and stained with 4% Giemsa for 45 minutes. Parasitemia was calculated by microscopic observation (X1000 magnification) for 20 minutes using an Olympus BX43 microscope (Olympus Corp., Tokyo, Japan) according to Cepeda et al. (2019). Blood samples were taken twice a week to monitor for gametocytemia. According to Heatley and Russell (2020), the amount of blood that can be collected from birds should not exceed 1% of body weight (10 ml/Kg).

2.3 In vitro exflagellation

The procedure was performed according to Coral et al, 2015. Briefly, 600 µL of infected blood obtained by puncture of the brachial vein and anticoagulated with 300 µL of 7.3% sodium citrate was mixed with 45 µL of minimal essential medium-MEM in a 1.5 ml Eppendorf tube. The tube was incubated at 40°C for two hours in a humid chamber with the lid open. After this time, blood smears were prepared and gametocytemia were detected by microscopy (×1000). After incubation in a humid chamber, 0.9% saline (100 µL) was added to replace the fluid lost during incubation. The smears were prepared and stained with 4% Giemsa for 45 min.

2.4 Parasite stages separation by a discontinuous gradient of Percoll

Percoll dilutions of 35% and 60% (Percoll® P4937 Sigma-Aldrich) were prepared according to Miao & Cui (2011) and stored at 4°C. 400 µL of 60% Percoll was added to the bottom of a 2 ml Eppendorf tube, 400 µL of 35% Percoll was added to this layer and finally 300 µL of treated blood sample was added as described in section 2.3. The sample was then centrifuged at 5000g for 30 minutes at 4°C (Hermle Labnet z326k).

Samples were carefully removed from each layer in descending order and each layer was washed 3 times with 10X PBS for 5 minutes at 3500 rpm. Smears were made from each layer, later fixed with absolute methanol for 5 min and stained with Giemsa at 4% for 45 min for microscopic examination to determine which interface had the highest number of extracellular parasites and the type of cells recovered. Approximately 50 µL of each interface was stored at -20°C until use.

2.5 Flow cytometry and cell sorting.

Cells from the second layer (Fig. 2) were obtained after centrifugation in the previous step and were sorted by FACS ARIA III (BD Biosciences). A distinction was made between H. columbae-infected and uninfected blood samples. Samples were analysed for size and complexity using Forward Scatter (FSC) and Side Scatter (SSC); the assigned voltage values for FSC and SSC were 10 and 400 respectively, with a threshold of 25,000 for FSC. For each experiment, instrument performance was confirmed using BD Biosciences CS&T software. Population analyses were performed using FlowJo software (Tree Star, OR, USA).

The manufacturer's instructions for configuring the 70 µM nozzle were followed to calibrate the draw. Accudrops TM beads from BD Biosciences were used to determine the "drop delay" of the instrument; 1 drop in 1 ml PBS, using the "auto-delay" option. Analysis and population determination were performed as described in the previous section. Samples were homogenised by vortexing prior to collection. A minimum of 100,000 cells were sorted for the populations defined as infected and uninfected. Sorted cells were collected in 5 ml cytometry tubes containing 1 ml PBS.

Cell sorting involved the selection of two distinct cell populations, labelled subpopulation 1 (PSS1) and subpopulation 2 (PSS2). Following the sorting process, smears of each isolated population were prepared and then stained with 4% Giemsa for 45 minutes to confirm the isolated parasitic forms of H. columbae.

2.6 Host and parasite DNA quantification by qPCR

For parasite and host DNA quantification, we used 1. a whole blood sample from an H. columbae infected pigeon with a parasitemia of 4%, 2. a sample from layer 2 of the Percoll density gradient (PDG) (Fig. 2 layer 2), after washing with PBS 10X (PW) and without washing (PWW), 3. samples of PSS1 and PSS2 cells were identified by flow cytometry and cell sorting analyses (Fig. 4). In addition, a whole blood sample from an uninfected pigeon was processed for host DNA quantification (Fig. 1).

2.6.1 Primer design for caseinolytic protease C (ClpC) fragment cloning and standard curve

An absolute quantification strategy was used to quantify parasite DNA using a standard curve of a cloned fragment of the ClpC gene. First, an alignment was made using 500 base pair fragments of ClpC fragments, including 57 taxa of the genera Plasmodium, Leucocytozoon and Haemoproteus. The primers (ClpCF1q: 5'-GATGAAATAGAAAAAGCTC-3' and ClpCR1q: 5'-GGACAACCTAAATTACTTG- 3') were then designed to amplify a 120 bp fragment of this gene.

A ClpC fragment was amplified as previously described (Cepeda et al., 2021; Martinsen et al., 2008). Purified fragments of approximately 500 bp were cloned into the TOPO T/A cloning vector (Thermo Fischer Scientific) and replicated in E. coli. After 48 hours of incubation, the plasmid was purified using the GeneJET Plasmid Miniprep Kit. The concentration of the plasmid was then determined, and a five-step serial dilution was performed, starting from a concentration of 19.4 ng/ml-1 down to 0.019 ng/ml-1 (Table 1).

Table 1

Standard curves for *H. columbae* and *C. livia* quantification.
Standard curve Haemoproteus columbae - ClpC (Plasmid)			Standard curve Columba livia - GAPDH
Concentration (ng/µl)	C_t	Copy number	Concentration (ng/µl)	C_t	Copy number
19.4	19.6	1.5x10¹¹	11	14.6	8.2x10¹⁰
1.94	20	1.5x10¹⁰	5.5	14.8	4.51x10¹⁰
0.19	23.5	1.5x10⁹	2.8	15.9	2.3x10¹⁰
0.019	26.6	1.5x10⁸	1.3	16.9	1.07x10¹⁰
0.0019	30.9	1.5x10⁷	0.8	18.5	6.56x10⁹
			0.4	18.9	3.28x10⁹
Five dilution points at different concentrations were used to construct a standard curve for the ClpC gene to assess the presence of Haemoproteus columbae and a fragment of GAPDH to detect Columba livia (Rock Pigeon) DNA.

Amplification was performed using the SYBR-green detection method on an Applied Biosystems QuantStudio5 (Waltham, Massachusetts, United States). PCR reactions were performed in a final volume of 20 µl containing 5.1 µl Luna Universal qPCR Master Mix (New England Biolabs, Massachusetts, USA), 1 µl DNA and 0.2 µM of each primer. The thermal cycling conditions were as follows: denaturation at 95°C x 2 min, followed by 40 cycles of 30 s at 95°C, 30 s at 47°C and 30 s at 72°C. Each sample was run in triplicate. The number of genomic copies in each dilution made for the standard curve was calculated using the tool "Calculator for determining the number of copies of a template" (Eq. 1) from the URI Genomics & Sequencing Center, available at https://cels.uri.edu/gsc/cndna.html, which applies the formula:

$$number of copies =\frac{\left(amount of DNA \right(ng\left)*6.022x{10}^{23}\right)}{\left(length of the fragment \right(bp\left) *1x {10}^{9 }*650\right)}$$

2.6.2. Host DNA quantify

We amplified a 113 bp fragment of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene sequence for Columba livia DNA quantification. We designed the primers GAPF2: 5'- GGTATGATAATGAGTATGGATACAGCAAC − 3' and GAPR3: 5'- CAGGATGCAGAGCTAAGCGGTGGTG − 3'. Genomic DNA was isolated using the DNeasy kit according to the manufacturer's instructions (QIAGEN, Germany).

The standard curve for this assay was constructed by diluting non-infected pigeon DNA from 11 ng ml-1 down to 0.4 ng ml-1 in six steps (Table 1). All samples were amplified in triplicate. Reactions were performed in a final volume of 20 µl using 10 Luna Universal qPCR Master Mix (New England Biolabs, Massachusetts, USA), 5 µl DNA and 0.2 µM of each primer. The thermal profile consisted of a 3-minute denaturation cycle at 95°C followed by 35 cycles of 95°C for 30 seconds, 55°C for 30 seconds and 72°C for 30 seconds. Genomic copy number was estimated in the same manner as described for the parasite standard curve.

3.1 Parasite exflagellation

Pigeon GERPHUN929 had a parasitemia of 4%. No clinical signs associated with the infection were observed. After exflagellation, macrogametes, microgametes and zygotes were observed (Fig. 3), with macrogametes being the predominant stage (Fig. 3b). Some round gametocytes deforming the erythrocyte membrane were also observed (Fig. 3n). The gametocytemia count after exflagellation was 2.88% (288 macrogametes/10,000 erythrocytes).

3.2 Separation of parasite stages by Percoll density gradient

Parasite stages were concentrated in layer 2 of the PDG, between Percoll layers 35% and 60% (Fig. 2). Within this layer, macrogametes and ookinetes were the most abundant stages, while infected erythrocytes were observed sporadically. Interestingly, no microgametes were recovered from this layer. The macrogametes observed in layer 2 were accompanied by remnants of the erythrocyte nucleus (Fig. 3o). A Giemsa-stained smear was performed to verify the presence of parasitic forms of H. columbae.

Layer 1 contained mononuclear cells and thrombocytes, while layer 3 contained polymorphonuclear leukocytes. In contrast, layer 4 was rich in erythrocytes infected with juvenile stages of H. columbae and uninfected erythrocytes (Fig. 2).

3.3 Parasite isolation by cell sorting

Layer 2, obtained by centrifugation of PDG washed with PBS, was analysed by flow cytometry. This method did not use DNA intercalating dyes for parasite identification. The 2-dimensional scatter plot of layer 2, where parasite stages were concentrated, did not show a fully differentiated area compared to the negative sample (Fig. 4). The region with the highest number of recorded events was selected for cell sorting. Subsequently, approximately 51.8% (PSS1) of the events recorded in the sorting process from the selected area corresponded to parasitic forms of H. columbae, as confirmed by Giemsa-stained smear examination of the sorted cells (see Fig. 3d, h, l, p). The PSS2 sample, associated with 28.8% cell sorting events, shows cellular debris (Fig. 4).

3.4 Quantification of host and parasite DNA by qPCR

The results of the quantification of parasite and host DNA are presented in Table 2, according to the threshold cycle (Ct) obtained: two samples showed no amplification of ClpC; these were the whole blood sample from the infected pigeon with 4% parasitemia and the layer 2 obtained from the PWW. Meanwhile, in the sample obtained from the PDG, corresponding to the layer 2 washed with PBS, the concentration of parasite DNA increased (PW-Ct = 20.3), corresponding to 7.42 ng/µl. After the sorting process, subpopulation 1 (PSS1) showed an apparent decrease in parasite DNA (Ct = 22.3), with this sample having a parasite DNA concentration of 1.76 ng/ul. For subpopulation 2 (PSS2), the parasite DNA concentration is approximately one order of magnitude lower than PSS1 (PSS1: 1.76 ng/ml vs. PSS2: 0.16 ng/ml).

Table 2

ClpC and GAPDH copy number determination in blood samples after Percoll and cell sorting treatments.
Sample	Haemoproteus columbae - ClpC gene			Columba livia - GAPDH gene
Sample	C_t	Concentration (ng/µl)	Copy number	C_t	Concentration (ng/µl)	Copy number
Layer 2 of Percoll without wash (PWW)	-	-	-	27.4	0.004	3.28x10⁷
Layer 2 of Percoll washed (PW)	20.3	7.42	5.73x10¹⁰	28.7	0.001	8.2x10⁶
Post sorting subpopulation 1 (PSS1)	22.3	1.76	1.36x10¹⁰	29.1	0.0004	3.28x10⁶
Post sorting subpopulation 2 (PSS2)	25.7	0.16	1.24 x10⁹	29.4	0.00036	2.95x10⁶
Infected blood (parasitemia 4% )	-	-	-	14.6	11	8.2x10¹⁰
ClpC was used to determine the presence of H. columbae and GAPDH to evaluate the presence of host DNA (Columba livia). Genomic copy number was estimated for each sample analyzed. Cut-off values and approximate concentrations are given for each sample. Ct (ClpC) is given for each positive sample.

On the other hand, an apparent reduction of the host DNA concentration is observed, starting from a concentration of about 11 ng/µl (≈ 8.2x1010, Ct = 14.6) to a concentration lower than 0.0004 ng/µl. This reduction in genomic copies corresponds to an order of magnitude from 8.2x1010 to less than 3.28x106 copies. An increase of more than one amplification cycle in Ct was obtained for each of the purification steps of the parasites obtained.

Our results demonstrate a feasible, reproducible and efficient approach to enrich blood parasites that infect hosts with nucleated red blood cells. We obtained 1.76 ng/µl of pure DNA post-sorting (PSS1) through three consecutive parasite enrichment steps, providing sufficient parasite DNA for future genomic studies. Of these steps, the sample containing parasites concentrated in layer 2 of the PDG-PW showed the highest enrichment of H. columbae DNA, with a fold enrichment of 7.42 ng/µl. It is noteworthy that the original blood sample from the rock pigeon was only 300µl, and by repeating this process we can further increase the final DNA yield. The results from the standard curve (Table 1) indicate a maximum C_t value of 31. By observing that each 1/10 dilution results in an increase of 4 cycles, we determined that the concentration of H. columbae DNA is 100,000 times higher. In addition, our results show that flow cytometry is optional in this process. However, the flow cytometry samples did yield purer H. columbae DNA compared with PW samples; there around 2.5 times less C. livia DNA after cell sorting. By using exflagellation and PDG alone, we were able to obtain sufficient DNA for genomic studies without the need for flow cytometry.

In previous studies, in vitro exflagellation of haemosporidian parasites was used to obtain partial genomes of Haemoproteus tartakovskyi (Bensch et al., 2016). Using this technique, DNA concentrations of 0.06 to 0.2 ng/µl were obtained from approximately 200 µl of blood from infected European siskins (Spinus spinus). For example, 2% parasitemia yielded 0.13 ng/µl of parasite DNA, while 4% and 5% parasitemia yielded 0.06 and 0.26 ng/µl of pure DNA, respectively (Palinauskas et al., 2013).

In our analysis, the ClpC gene was not detected by qPCR in a sample with 4% parasitemia, proving that we are looking for a needle in a haystack. We chose the ClpC marker because it has fewer copies than other molecular markers of the mitochondrial genome. This allowed us to find a more realistic balance between parasite and host DNA. Genomic copies of ClpC range from 1 to 25 in Apicomplexa parasites such as Plasmodium and Toxoplasma (Cepeda et al., 2021; Matsuzaki et al., 2001). Despite having 4% parasitemia, the amount of DNA present in the erythrocytes of the rock pigeon is still not enough to successfully amplify the target sequence.

Layer 2 of the PDG-PWW sample was not amplified, suggesting that Percoll may interfere with DNA extraction. This interference could be due to the colloidal substance formed by this reagent, which acts as a protein barrier and prevents the DNA solution from penetrating the column.

The use of PDG facilitated the separation and identification of the layer with the highest concentration of parasite forms. This standardized procedure was designed to adapt to the limited volume of blood typically obtained from passerines and small birds. Notably, this approach could also be applied to small lizards or amphibians. Previously, this method had been successfully used in pigeons to obtain H. columbae antigens, but using more blood (Graczyk et al., 1994).

On the other hand, the sample analysed by flow cytometry showed the highest significant decrease in Rock Pigeon DNA, with a concentration of 0.0004 ng/µl. The amount of parasite DNA obtained after sorting according to qPCR quantification was 1.76 ng/µl, which is higher than previous reports using other DNA concentration methods from samples with parasitemia similar to the present study (Palinauskas et al., 2013; Bensch et al., 2016). Flow cytometry has previously been used to separate parasite forms from other haemosporidian parasites, such as Leucocytozoon, without DNA intercalating dyes (Chakarov et al., 2012). However, after exflagellation, the parasitic forms obtained from H. columbae have areas ranging from 20.4 to 48.4 µm (Coral et al., 2015). The difference in size, granularity and density between the Leucocytozoon and Haemoproteus parasites results in an uneven distribution on the two-dimensional scatter plot when identified by flow cytometry. Consequently, the methods for isolation using a PDG reported for Leucocytozoon are not directly applicable to Haemoproteus gametes.

Flow cytometry-based applications have been widely used in human malaria to track parasite biological processes and interactions with host cells, host immune response, diagnosis or parasite isolation (Gallo et al., 2012; Cai et al., 2016; Hopp et al., 2022). Most of these studies require the use of labels to isolate cell populations, which increases the success of sorting (Boissière et al., 2012). For avian haemosporidia, this approximation has only been used for Leucocytozoon caulleryi (Omori et al., 2010). Although the authors did not report the final concentration of the sorted fraction, they also observed that the concentration of host DNA decreased while the parasite genetic material increased.

Strategies involving host DNA depletion using restriction enzymes (Feehery et al., 2013; Leveille et al., 2014) may not be effective for certain parasite species that possess methylated sites (Ponts et al., 2013). In such cases, sequencing platforms such as Nanopore have implemented adaptive sampling, which allows the system to selectively select or reject molecules for sequencing based on reference sequences (Loose et al., 2016; Martin et al., 2022). This approach has been used for genomic surveillance of haemosporidia in human malaria patients with low parasitemia (approximately 0.1%) (Meulenaere et al., 2022).

In addition, parasite enrichment steps should be considered prior to flow cytometry analysis, especially for Haemoproteus sp. as strong gametocyte attachment to the host cell nucleus has been demonstrated (Graczyk et al., 1994). The process of exflagellation and subsequent PDG helps to reduce the amount of ghost erythrocytes attached to the parasite but does not eliminate them. Similar challenges have been observed in parasite isolation using alternative methods such as laser microdissection (Lutz et al., 2016; Palinauskas et al., 2010), where remnants of the host cell nucleus may persist even after the laser procedure. In avian malaria studies, most haemosporidian isolation techniques do not yield sufficient material for direct genome sequencing, requiring further amplification of genomic DNA. However, this process can recover both host and parasite DNA, potentially increasing the depth of sequencing.

DNA amplification and analysis of haemosporidian parasites is challenging due to their low abundance compared to host DNA. Our study successfully demonstrated the ability to enrich for parasite DNA, transforming a previously false negative qPCR result (whole blood infected) to a positive result with a concentration of 7.42 ng/µl (layer 2 of Percoll density gradient washed) and 1.76 ng/µl (post-sorting subpopulation 1). Due to its ability to work with low-volume samples, this method may be applicable to the enrichment of parasite DNA from other wildlife with nucleated red blood cells. Obtaining purer DNA may improve sequencing depth.

Credit authorship contribution statement

Brayan Andrés Gamboa-Suárez: Care of laboratory animals, Sampling, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing. Ingrid Astrid Lotta-Arévalo: Data curation, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing. Felipe Sarmiento Salazar: Conceptualization, Formal analysis, Methodology, Resources, Validation, Writing – original draft, Writing – review & editing. Nubia E. Matta: Conceptualization, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Writing – original draft, Writing – review & editing.

Statements and Declarations

We confirm that the authors don’t have to disclose financial or non-financial interests that are directly or indirectly related to the work submitted for publication.

ORCID:
Brayan Andrés Gamboa-Suárez
https://orcid.org/0009-0007-6961-582X

Ingrid Astrid Lotta-Arévalo
https://orcid.org/0000-0002-8900-829X

Felipe Sarmiento Salazar
https://orcid.org/0000-0002-4836-4546

Nubia E. Matta
https://orcid.org/0000-0003-1775-0804

Ethical Approval

Funding

This research was supported by the Research Division of the Universidad Nacional de Colombia [research project 57326 number].

Availability of data and materials: Not applicable.

Consent to participate: Not applicable.

Consent for publication Not applicable.

Competing interests: The authors declare no competing interests.

Aragão H, de B (1908) Sobre o cyclo evolutivo e a transmissão do Haemoproteus columbae. Revista Médica de São Paulo, 11(20):409–416.
Atkinson, CT (2008) Haemoproteus. In: Parasitic Diseases of Wild Birds. John Wiley & Sons, Ltd, pp. 11–34. https://doi.org/10.1002/9780813804620.ch2
Bensch S, Canbäck B, DeBarry JD, Johansson T, Hellgren O, Kissinger JC, Palinauskas V, Videvall E, Valkiūnas G (2016) The Genome of Haemoproteus tartakovskyi and Its Relationship to Human Malaria Parasites. Genome Biol Evo 8(5):1361–1373. https://doi.org/10.1093/gbe/evw081
Boissière A, Arnathau C, Duperray C, Berry L, Lachaud L, Renaud F, Durand P, Prugnolle F (2012) Isolation of Plasmodium falciparum by flow-cytometry: Implications for single-trophozoite genotyping and parasite DNA purification for whole-genome high-throughput sequencing of archival samples. Malar J 11(1):163. https://doi.org/10.1186/1475-2875-11-163
Borner J, Pick C, Thiede J, Kolawole OM, Kingsley MT, Schulze J, Cottontail VM, Wellinghausen N, Schmidt-Chanasit J, Bruchhaus I, Burmester T (2016) Phylogeny of haemosporidian blood parasites revealed by a multi-gene approach Mol Phylogenet Evol 94:221–231. https://doi.org/10.1016/j.ympev.2015.09.003
Cai C, Carey K A, Nedosekin DA, Menyaev YA, Sarimollaoglu M, Galanzha EI, Stumhofer JS, Zharov VP (2016) In vivo photoacoustic flow cytometry for early malaria diagnosis. Cytometry A. 89(6):531–542. https://doi.org/10.1002/cyto.a.22854
Cepeda AS, Pacheco M, Escalante AA, Alzate JF, Matta NE (2021) The apicoplast of Haemoproteus columbae: A comparative study of this organelle genome in Haemosporida. Mol Phylogenet Evol 161:107185. https://doi.org/10.1016/j.ympev.2021.107185
Cepeda AS, Lotta-Arévalo IA, Pinto-Osorio DF, Macías-Zacipa J, Valkiūnas G, Barato P, Matta NE (2019) Experimental characterization of the complete life cycle of Haemoproteus columbae, with a description of a natural host-parasite system used to study this infection. Int J Parasitol 49(12):975–984. https://doi.org/10.1016/j.ijpara.2019.07.003
Chakarov N, Greiner J, Hauser S, Schuetzmann D, Krüger O, Boerner M, Widera D (2012) Label-free enrichment of avian Leucocytozoon using flow cytometric sorting. Parasitology. 139(12):1547–1552. https://doi.org/10.1017/S0031182012000972
Coral AA, Valkiūnas G, González AD, Matta NE (2015) In vitro development of Haemoproteus columbae (Haemosporida: Haemoproteidae), with perspectives for genomic studies of avian haemosporidian parasites. Exp Parasitol 157:163–169. https://doi.org/10.1016/j.exppara.2015.08.003
Daubenberger CA, Spirig R, Patarroyo ME, Pluschke G (2007) Flow cytometric analysis on cross-reactivity of human-specific CD monoclonal antibodies with splenocytes of Aotus nancymaae, a non-human primate model for biomedical research. Vet Immunol Immunopathol. 119(1):14–20. https://doi.org/10.1016/j.vetimm.2007.06.010
Feehery GR, Yigit E, Oyola SO, Langhorst BW, Schmidt VT, Stewart FJ, Dimalanta ET, Amaral-Zettler LA, Davis T, Quail MA, Pradhan S (2013) A method for selectively enriching microbial DNA from contaminating vertebrate host DNA. PloS One, 8(10):e76096. https://doi.org/10.1371/journal.pone.0076096
Gallo V, Skorokhod OA, Schwarzer E, Arese P (2012) Simultaneous determination of phagocytosis of Plasmodium falciparum-parasitized and non-parasitized red blood cells by flow cytometry. Malar J 11(1):428. https://doi.org/10.1186/1475-2875-11-428
Garnham PCC (1966) Malaria Parasites and Other Haemosporidia. Blackwell. Oxford.
Graczyk TK, Cranfield MR, Shiff CJ (1994) Extraction of Haemoproteus columbae (Haemosporina: Haemoproteidae) Antigen from Rock Dove Pigeons (Columba livia) and Its Use in an Antibody ELISA. The J Parasitol 80(5):713–718. https://doi.org/10.2307/3283250
Henry CW, Dick JW (1978) Separation of Gametocytes of Leucocytozoon smithi from Whole Peripheral Turkey Blood. Avian Dis 22(3):542–546. https://doi.org/10.2307/1589312
Hopp CS, Taylor JJ, Crompton PD (2022) Assessment of Plasmodium falciparum Antigen-Specific B Cells. Methods Mol Biol (Clifton, N.J.), 2470:689–713. https://doi.org/10.1007/978-1-0716-2189-9_52
Klei TR (1971) Studies on Haemoproteus columbae of the Pigeon, Columba Livia, and the Intermediate Host Pseudolynchia canariensis [Ph.D.]. Wayne State University.
Lelliott PM, Lampkin S, McMorran BJ, Foote SJ, Burgio G (2014) A flow cytometric assay to quantify invasion of red blood cells by rodent Plasmodium parasites in vivo. Malar J 13(1):100. https://doi.org/10.1186/1475-2875-13-100
Leveille AN, Ogedengbe ME, Hafeez MA, Tu HH (Abby), Barta JR (2014) The Complete Mitochondrial Genome Sequence of Hepatozoon Catesbianae (apicomplexa: Coccidia: Adeleorina), a Blood Parasite of the Green Frog, Lithobates (formerly Rana Clamitans). J Parasitol 100(5):651–656.
Loose M, Malla S, Stout M (2016) Real-time selective sequencing using nanopore technology Nat Methods 13(9). https://doi.org/10.1038/nmeth.3930
Lutz HL, Marra NJ, Grewe F; Carlson JS, Palinauskas V, Valkiūnas G, Stanhope MJ (2016) Laser capture microdissection microscopy and genome sequencing of the avian malaria parasite, Plasmodium relictum. Parasitol Res 115(12):4503–4510. https://doi.org/10.1007/s00436-016-5237-5
Martin S, Heavens D, Lan Y, Horsfield S, Clark MD, Leggett RM (2022) Nanopore adaptive sampling: A tool for enrichment of low abundance species in metagenomic samples. Genome Biol 23(1):11. https://doi.org/10.1186/s13059-021-02582-x
Martinsen ES, Perkins SL, Schall JJ (2008) A three-genome phylogeny of malaria parasites (Plasmodium and closely related genera): Evolution of life-history traits and host switches. Mol Phylogenet Evol 47(1):261–273. https://doi.org/10.1016/j.ympev.2007.11.012
Matsuzaki M, Kikuchi T, Kita K, Kojima S, Kuroiwa T (2001) Large amounts of apicoplast nucleoid DNA and its segregation in Toxoplasma gondii. Protoplasma 218(3–4):180–191. https://doi.org/10.1007/BF01306607
Meulenaere KD, Cuypers WL, Rosanas-Urgell A, Laukens K, Cuypers B (2022) Selective whole-genome sequencing of Plasmodium parasites directly from blood samples by Nanopore adaptive sampling. bioRxiv. https://doi.org/10.1101/2022.11.29.518068
Miao J, Cui L (2011) Rapid isolation of single malaria parasite–infected red blood cells by cell sorting. Nat Protoc 6(2):140–146. https://doi.org/10.1038/nprot.2010.185
Omori S, Sato Y, Toda H, Sasaki K, Isobe, T, Nakanishi T, Murata K, Yukawa M (2010) Use of flow cytometry to separate (Leucocytozoon caulleryi) gametocytes from avian blood. Parasitology 137(13):1899–1903. https://doi.org/10.1017/S0031182010000880
Palinauskas V, Dolnik OV, Valkiūnas G, Bensch S (2010) Laser microdissection microscopy and single cell PCR of avian hemosporidians. J Parasitol 96(2):420–424. https://doi.org/10.1645/GE-2247.1
Palinauskas V, Križanauskienė A, Iezhova TA, Bolshakov CV, Jönsson J, Bensch S, Valkiūnas G (2013) A new method for isolation of purified genomic DNA from haemosporidian parasites inhabiting nucleated red blood cells. Exp Parasitol 133(3):275–280. https://doi.org/10.1016/j.exppara.2012.12.003
Pertoft H (2000) Fractionation of cells and subcellular particles with Percoll. J Biochem Biophys Methods 44(1):1–30. https://doi.org/10.1016/S0165-022X(00)00066-X
Ponts N, Fu L, Harris EY, Zhang J, Chung DWD, Cervantes MC, Prudhomme J, Atanasova-Penichon V, Zehraoui E, Bunnik E, Rodrigues EM, Lonardi S, Hicks GR, Wang Y, Le Roch KG (2013) Genome-wide mapping of DNA methylation in the human malaria parasite Plasmodium falciparum. Cell Host Microbe 14(6):696–706. https://doi.org/10.1016/j.chom.2013.11.007
Toscani-Field J, Weinberg J, Bensch S, Matta NE, Valkiūnas G, Sehgal RNM (2018) Delineation of the genera Haemoproteus and Plasmodium using RNA-Seq and multi-gene Phylogenetics. J Mol Evol 86(9):646–654. https://doi.org/10.1007/s00239-018-9875-3
Trager W (1950) Studies on the extracellular cultivation of an intracellular parasite (avian malaria). I. Development of the organisms in erythrocyte extracts, and the favoring effect of adenosinetriphosphate. J Exp Med 92(4):349–366. https://doi.org/10.1084/jem.92.4.349
Valkiūnas G (2005) Avian Malaria Parasites and Other Haemosporina. CRC press. https://doi.org/10.1201/9780203643792
Valkiūnas G, Palinauskas V, Križanauskienė A, Bernotienė R, Kazlauskienė R, Iezhova TA (2012) Further Observations on In Vitro Hybridization of Hemosporidian Parasites: Patterns of Ookinete Development in Haemoproteus spp. J Parasitol 99(1):124–136. https://doi.org/10.1645/GE-3226.1

No competing interests reported.

Download PDF

Journal Publication

published 29 Feb, 2024

Read the published version in Veterinary Parasitology →

Version 1

posted

You are reading this latest preprint version

Finding a needle in a haystack: DNA Haemoproteus columbae enrichment using percoll density gradient and flow cytometry

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.1 Ethics and Permissions

2.2 Blood samples

2.3 In vitro exflagellation

2.4 Parasite stages separation by a discontinuous gradient of Percoll

2.5 Flow cytometry and cell sorting.

2.6 Host and parasite DNA quantification by qPCR

2.6.1 Primer design for caseinolytic protease C (ClpC) fragment cloning and standard curve

2.6.2. Host DNA quantify

3. Results

3.1 Parasite exflagellation

3.2 Separation of parasite stages by Percoll density gradient

3.3 Parasite isolation by cell sorting

3.4 Quantification of host and parasite DNA by qPCR

4. Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1