A Novel HOIP Frameshift Variant Alleviates NF-kappaB Signaling and Sensitizes Cells to TNF-induced Death

doi:10.21203/rs.3.rs-3404349/v1

Download PDF

Article

A Novel HOIP Frameshift Variant Alleviates NF-kappaB Signaling and Sensitizes Cells to TNF-induced Death

https://doi.org/10.21203/rs.3.rs-3404349/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The linear ubiquitin chain assembly complex (LUBAC) is the sole known complex that can assemble linear ubiquitin chains. It is composed of three distinct subunits: HOIP, SHARPIN, and HOIL-1L, and has a wide range of tissue expression patterns. HOIP, the key component of LUBAC, possesses the capability to form linear ubiquitin linkages. In this study, we report a novel homozygous deletion variant of HOIP that leads to the loss of the catalytic domain of HOIP. The truncated protein could still interact with the other two proteins but was unable to create linear chains. Cells transfected with the truncated protein demonstrated impaired NF-κB activation and MAPK signaling when compared to wild-type cells, as well as sensitivity to TNF-induced death, including apoptosis, necroptosis, and pyroptotic forms of death. This finding provides insight into the genetic range of linear ubiquitination deficiencies in humans and suggests the involvement of cell death in disease pathogenesis.

Biological sciences/Cell biology/Cell death

Biological sciences/Cell biology/Cell signalling

linear ubiquitination

RNF31

linear ubiquitin chain assembly complex (LUBAC)

catalytic domain

deletion variant

HOIP p.G628Afs*52

The linear ubiquitin chain assembly complex (LUBAC) is the only E3 ubiquitin ligase complex that can form linear ubiquitin chains, consisting of HOIP (HOIL-1-interacting protein), HOIL-1L (Heme-oxidized IRP2 ubiquitin ligase 1 L), and SHARPIN (SHANK-associated RH domain interacting protein in postsynaptic density). [1] LUBAC is ubiquitously expressed in various cell lines and tissues, exerting a range of physiological functions. [2] The functions of LUBAC have been studied in multiple signaling pathways, such as TNFR1, NOD, IL-1R, and Toll-like receptors, among which the earliest and clearest pathway is the TNFR1-NFκB signaling pathway. In the canonical NF-κB pathway, the linear ubiquitination of NEMO (IKKγ) by LUBAC activates downstream signals, promotes the production of cellular pro-inflammatory and survival signals, and plays an important role in both innate and adaptive immunity.[3]

Dysfunctional linear ubiquitination underlies several primary immunodeficiency diseases. HOIL-1L functions as a component of LUBAC. Autosomal dominant variants in HOIL-1L cause chronic autoinflammation, invasive bacterial infections, and muscular amylopectinosis. SHARPIN is another HOIP-binding component of LUBAC. Spontaneous variants in SHARPIN cause multiorgan inflammation, immune system dysregulation, and a chronic proliferative dermatitis phenotype in mice. [4, 5] Although studies on SHARPIN in humans have focused on cancer and Alzheimer's disease, no clear evidence has been seen for a strong association with either disease. [6] Notably, RNF31 (HGNC:16031) encodes HOIP, the most critical component of the linear ubiquitin chain complex LUBAC, responsible for forming linear ubiquitin chains and attaching them to linear ubiquitin substrates. [2] Currently, only two cases of RNF31 gene variants have been reported in humans. Both were classified as combined immunodeficiency diseases with combined features. [7, 8] In mice, deletion of HOIP causes TNFR-mediated aberrant endothelial cell death, resulting in defective vascularization and embryonic lethality at midgestation. [9]

HOIP comprises several domains, including PUB (PNGase/ UBA or UBX-containing proteins), UBA (Ub-associated domain), RBR (RING1-IBR-RING2), and LDD (linear ubiquitin chain determining domain). Among these, the UBA region is responsible for the interaction of HOIP with SHARPIN and HOIL-1L, while the RBR and LDD domains constitute the catalytic structural domain of HOIP. It has been reported that the RING2-C-terminal portion, the smallest unit that forms linear ubiquitin chains, is essential for the formation of linear ubiquitin chains. [10, 11] Nonetheless, there are no documented clinical case reports of only the deletion of the catalytic domain of HOIP (leading to the disappearance of linear ubiquitination activity). Here, we reported a case of autoinflammatory disease caused by a deletion in the catalytic domain of HOIP, and investigate the effect of this variant on inflammation.

2.1 Ethics approval and consent to participate

The parents provided written informed consent for genetic studies. The study was approved by the ethics committee of the First Affiliated Hospital of Zhengzhou University (KS-2018-KY-36), and performed according to the principles of the Declaration of Helsinki. We collected peripheral blood samples from the patient and his family members. Genomic DNA was obtained using the TIANamp Genomic DNA Kit (TIANGEN, Beijing, China) according to standard extraction methods.

2.2 Genetic testing

MyGenostics provides a commercially-customized immune sequencing gene panel that can be used to perform sequencing analysis on 270 genes related to immune diseases (table S1). The sequencing data were aligned to the GRCh37/hg19 genome using the Burrows-Wheeler Aligner and variants were annotated using Annovar. Common variants were filtered using maf >0.05 in 1 000 Genomes 41, ExAC (v2.1), and dbSNP build 144. The variant was validated using Sanger sequencing.

2.3 Generation of RNF31 knockout cell lines

293T cells and HeLa cells were purchased from the American Type Culture Collection, and cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum. The wild-type HOIP plasmid was synthesized by GENEWIZ (Suzhou, China), and the full-length c.1882delG mutant HOIP (HOIP-mut) plasmid was obtained by site-directed mutagenesis. Cells were transfected using Neofect DNA transfection reagent (Neofect, Beijing, China) or jetOPTIMUS DNA transfection reagent (Polyplus, Illkirch, France) according to the manufacturer's instructions.

Oligonucleotide sgRNAs (F: caccgttgacaccacgccagtaccg, R: aaaccggtactggcgtggtgtcaac) targeting RNF31 were cloned into the lentiCRISPR-puro-v2 vector. PsPAX2, pMD2.G, lenti-crispr-puro-v2-gRNA, or lenti-puro-v2 plasmids were co-transfected into 293T cells to produce lentiviruses. HeLa cells were infected with lentivirus. The infected cells were then screened with puromycin (Abmole, Housten, TX, USA) at 3 μg /mL. Single-cell clones were tested for RNF31 knockout by Western blot (HOIP antibody, #875227, R&D Systems, Minneapolis, MN, USA), and sanger sequencing was performed to confirm the genomic variant sequence.

2.4 Immunoblotting

Cells were lysed using cell lysis buffer for Western and IP (P0013, Beyotime, Shanghai, China), supplemented with protease inhibitors and phosphatase inhibitors. SDS-PAGE electrophoresis, the proteins were separated by SDS-PAGE electrophoresis and transferred to PVDF membranes in buffer (194 mM glycine, 25 mM Tris, 20% (V/V) methanol). The membranes were incubated with the primary and secondary antibodies. The signal was detected by chemiluminescence (34580, ThermoFisher Scientific, Waltham, MA, USA). Either GAPDH or TUBULIN was used as the internal reference. The intensity of the blots was quantified using ImageJ software.

2.5 Immunoprecipitation

Cells were lysed in Western and IP lysis buffers containing protease inhibitors. The cell lysates were incubated overnight at 4 °C with FLAG antibody (mouse) (M185-3L, MBL, Nagoya, Japan). Then protein G agarose beads were added to the cell lysates and incubated at 4 °C for 2 hours. After washing the agarose beads, the appropriate amount of RIPA lysate and protein loading buffer were added. The immunoprecipitated protein samples were analyzed by immunoblotting using antibodies: FLAG-tag (mouse), MYC-tag (rabbit) (16286-1-AP, Proteintech, Wuhan, China), and HA-tag (rabbit) (M180-3, MBL).

2.6 Ubiquitination experiment

Intracellular total linear ubiquitination level assay by transfecting 293T cells simultaneously with p3×FLAG-CMV-HOIL-1L, p3×FLAG-CMV-SHARPIN, and p3×FLAG-CMV-HOIP, or p3×FLAG-CMV-HOIP-mut, or p3×FLAG-CMV plasmids. Following a 24-hour incubation period, the cells were lysed using protein lysis buffer containing protease and phosphatase inhibitors. The lysates were then subjected to Western blot analysis using LUB9 (MABS451, Millipore) and FLAG antibodies. The signals were detected using an ECL chemiluminescence assay.

2.7 NF-κB–luciferase reporter assays

Hela cells were simultaneously co-transfected with PGL4.32-NFκB-Report, pRL-TK, p3×FLAG-CMV-SHARPIN, p3×FLAG-CMV-HOIL-1L, and p3×FLAG-CMV-HOIP, or p3×FLAG-CMV-HOIP-mut, or p3×FLAG-CMV. After 48 hours, cells were lysed in luciferase cell lysis buffer (Promega, Madison, WI, USA), and the supernatant was collected by centrifugation at 13 000 rpm for 6 minutes. The luciferase activity was measured with the Luciferase Assay System, and the firefly luciferase activity of each lysate was normalized to Renilla luciferase activity.

2.8 Quantitative real-time PCR

Total RNA was extracted from cultured cells using RNAiso (9109, TaKaRa, Dalian, China). Reverse transcription reactions were then conducted using the HiScript II Q RT SuperMix for qPCR kit (R223-01, Vazyme, Nanjing, China). Quantitative PCR assays were performed using the AceQ qPCR SYBR Green Master Mix (Q141-02, Vazyme) kit. Reactions were run on the StepOnePlus™ Real-Time PCR System (4376600, Applied Biosystems, Foster City, CA, USA). ACTB was used as an internal reference for normalization and analyzed using the ΔΔCt method. The primer sequences used were as follows:

ACTB: 5’ ACCGCGAGAAGATGACCCAGAT 3' (F), 5’ GGGATAGCACAGCCTGGATAGCA 3' (R); IL6: 5’ CCCACACAGACAGCCACTCACCT 3' (F), 5’ TGCCTCTTTGCTGCTTTCACACA 3' (R)

2.9 Immunofluorescence assay

Cells were fixed with 4% paraformaldehyde for 30 minutes. Next, the cells were permeabilized by incubating on ice with 5% Triton X-100. The cells were then blocked with 5% (w/v) BSA in PBS for 1 hour and incubated overnight at 4 °C using the primary antibody p65 (10745-1-AP, Proteintech). Then the cells were incubated with Cy3-labeled goat anti-rabbit IgG antibody (GB21303, Servicebio) for 1 hour at room temperature. The nuclei were stained with 4,6-diamino-2-phenyl indole (DAPI) staining solution. Images were acquired using a confocal microscope (Olympus, Tokyo, Japan), and the FV31S-DT was used for image analysis.

2.10 Flow cytometry

Cells were collected and washed with pre-cooled PBS. Then the cells were stained with PI staining solution in binding buffer (E607306, Sangon Biotech, Shanghai, China). The signal was detected on a flow cytometer, Cytoflex (Beckman Coutler, Fullerton, CA, USA), using 488 nm excitation light. Data were analyzed with CytExpert and gated to live and dead cells based on the PI-red fluorescence signal.

2.11 Statistical analysis

All data are presented as mean SD. The data were analyzed using one-way analysis of variance (ANOVA) and two-way ANOVA, followed up by Tukey’s test as required. P values less than 0.05 were considered significant. The P-value settings are: NS, P>0.05; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. All statistical analyses were performed using Excel.

3.1 Identification of RNF31 c.1882delG variant in an immunodeficient case

We investigated a 12-year-old Chinese male whose parents denied consanguinity. He had no family history of immune diseases and no abnormalities in the neonatal period. The main clinical manifestations of this child were infectious mononucleosis, necrotizing lymphadenitis, sepsis, primary peritonitis, lobar pneumonia, and recurrent viral and bacterial infections (Fig. 1A). Supplementary materials offer additional clinical details for reference. Notably, both of his parents and siblings were in good health (Fig. 1B). Given the recurring inflammatory symptoms exhibited by the patient, we postulated the existence of an underlying immune genetic defect as the contributing factor.

Based on the recessive inheritance pattern, we identified a homologous variant in RNF31 (Fig. 1B and 1C). This variant is a single-base deletion in exon 10, c.1882delG (NM_017999.5), leading to a frame transfer and a premature stop codon, p.G628Afs*52 (NP_060469.4) (Fig. 1D). Sanger sequencing confirmed that the variant was homozygous in the case, while his healthy parents and other siblings were all heterozygous deletion mutants at this locus (Fig. 1C). Furthermore, this variant was absent from the 1000 Genomes Project and the Genome Aggregation Database (gnomAD).

The RNF31 gene encodes 1072 amino acids, and the variant corresponds to the 628th amino acid, which is situted between the UBA and RBR domains (Fig. 1D). The resulting truncated protein lacks the RBR and LDD structural domains, which are the catalytic domains of HOIP (Fig. 1D). There are no clinical reports on the deletion of the catalytic domain of HOIP in cases. According to the American College of Medical Genetics and Genomics guidelines, this variant is preliminarily determined to be a likely pathogenic variant (PM4+PM2-pp+PM3-pp+PP1+PP3). [12, 13]

3.2 Impaired linear ubiquitination ability of LUBAC

SHARPIN and HOIL-1L interact with the UBA1 domain (p.Arg480-p.Gln542) and the UBA2 domain (p.Leu565-p.Arg623) of HOIP, respectively, to form the LUBAC. (Fig. 1D). [14, 15] To ascertain the binding capacity of the HOIP-truncated protein with these two proteins, we conducted immunoprecipitation experiments. Remarkably, the immunoprecipitation results resembled those of the wild-type HOIP, with the mutant variant displaying continued affinity towards SHARPIN and HOIL-1L (Fig. 2A, Fig. S1A-B). This compelling observation suggests that despite the variant, the HOIP protein variant retains its capability to form a functional LUBAC.

The mutant protein is lacking the catalytically active RBR domain and the LDD domain responsible for determining the ubiquitin linkage modes; therefore, we performed a total cellular protein assay for linear ubiquitination. The results revealed a considerable reduction in linear ubiquitination activity in cells transfected with the mutant HOIP compared to the wild-type HOIP (Fig. 2B). This finding strongly suggests that the variant hampers the intracellular formation of linear ubiquitin chains. These results provide evidence of the impaired ability of LUBAC, comprised of truncated proteins, to engage in linear ubiquitination.

3.3 Impaired NF-κB signaling pathway and MAPK signaling

The intracellular co-expression of HOIP, HOIL-1L, and SHARPIN leads to the activation of the classical NF-κB signaling pathway. [16] Given HOIP plays an important role in the pathway, we performed NF-κB dual-luciferase assay experiments in Hela cells. Results showed that the transcription of NF-κB was significantly activated in cells co-transfected with SHARPIN, HOIL-1L, and wild-type HOIP, whereas this transcriptional activation effect was not evident in co-transfected mutants or cells with an empty vector plasmid, indicating impaired activation of the NF-κB pathway (Fig. 3A). Moreover, immunofluorescence confocal experiments revealed that P65 translocated to the nucleus in wild-type co-transformed cells, whereas it did not spontaneously translocate in mutant and empty vector cells, suggesting that HOIP variants affect the function of HOIP in the NF-κB pathway (Fig. 3B).

Besides, tumor necrosis factor α (TNF-α) can activate intracellular NF-κB signaling and Mitogen-activated protein kinase (MAPK) signaling by binding to the membrane surface receptor TNFR1. Thus, we investigated the impact of this variant on TNF-α induced NF-κB signaling and the MAPK pathway. In HOIP-knockout HeLa cell lines, compared with cells transfected with wild-type HOIP, cells overexpressing mutant HOIP showed a decreased phosphorylation level of IKBα, and a slower degradation rate (Fig. 3C). Phosphorylated P65 was decreased in cells transfected with mutant plasmids compared to cells transfected with wild-type plasmids (Fig. 3D). Moreover,IL-6 expression was considerable reduction in the mutant cells, suggesting that HOIP variants impair the activation of the NF-κB signaling pathway (Fig. 3E). Additionally, in the MAPK signaling pathway, the activation of P38 was significantly impaired by TNF stimulation, while the activation of extracellular regulated protein kinases (ERK) was not significantly affected (Fig. 3F-G).

3.4 HOIP deficiency induces apoptosis and necroptosis, leading to increased cell mortality

Linear ubiquitination plays an important role in TNF-induced cell death signaling and regulates inflammation development. TNFR1 deletion in HOIP-knockout mice prevented mouse deaths, confirming the role of TNF in inducing cell death in HOIP-knockout mice. [9] Therefore, we induced cell death with TNF-α to determine if the mutant protein affected cell death. The cells transfected with mutant plasmids were more sensitive to TNF-induced cell death than cells transfected with wild-type and empty vector plasmids (Fig. 4A). In mutant cells, compared with cells expressing the HOIP wild-type plasmid, the cleavage of apoptosis marker proteins Caspase-3 and Caspase-7 increased (Fig. 4B and 4D). Apoptosis was more pronounced in mutant cells than in cells transfected with an empty vector plasmid. Consequently, we further investigated apoptosis in the mitochondrial pathway. The results suggest that the HOIP-truncated protein increases death via the mitochondrial pathway (Fig. 4B and 4D). Additionally, the phosphorylation level of MLKL, a marker protein of necroptosis, increased, indicating that the level of necrotic apoptosis was elevated in cells expressing the mutant HOIP (Fig. 4C-D). After treating cells with TNF, we observed the unique death morphology of pyroptosis under the microscope, leading to the detection of pyroptosis. The results showed that the pyroptosis marker proteins Gasdermin D (GSDMD), but not Gasdermin E (GSDME), were cleaved and increased in mutant cells (Fig. 4E-F). Loss-of-function variants in HOIP impair linear ubiquitination, leading to enhanced cell-death inflammation.

We identified a homozygous deficiency variant in HOIP in an immunodeficient patient. This variant leads to a frameshift in protein translation, resulting in a truncated protein lacking the catalytic domain. Functional studies of this variant revealed that cells lacking the HOIP catalytic domain have impaired NF-κB and MAPK signaling and are sensitive to TNF-induced death. The variant could be reclassified as a pathogenic variant according to ACMG guidelines, which is, to the best of our knowledge, the first report of HOIP deletion pathogenic variants.

Recent years have seen an increasing number of studies on the functions of HOIP and LUBAC, as linear ubiquitination plays an important role in the immune system. However, to date, only two clinical reports have been published on cases with HOIP variants, and none of them involved linear ubiquitination catalytic domain deletion. The two reported cases carried variants in the non-catalytic region that resulted in reduced protein stability. In the in vitro knockout cell lines, we exogenously expressed different variants of RNF31, none of which had significantly different expression levels (data not shown). Also, no significant differences were observed in the expression levels of SHARPIN and HOIL-1L, which is consistent with previous in-vitro studies. [8, 17] In terms of variant sites, one case was a homozygous point variant (c.215T>C; p.L72P), and the other was a compound heterozygous variant (c.1197G>C; p.Q399H; c.1737+3A>G). [7, 8] Consistent with our findings of recessive pathogenic patterns, heterozygous carriers of HOIP, HOIL-1, or OTULIN variants, as reported by other investigators, did not show an immunodeficiency phenotype, regardless of the variant site. The mutant HOIP retains the UBA domain, allowing it to still bind to the other two components of LUBAC to form linear ubiquitination complexes. However, the deletion of the RBR and LDD domains impairs the linear ubiquitination of substrates by HOIP mutant proteins. All three cases had similar clinical phenotypes of immune dysregulation, with severe bacterial and viral infections. However, the clinical manifestations varied. Our case mainly presented with recurrent fever, lymphadenopathy, infectious mononucleosis, necrotizing lymphadenitis, and lobar pneumonia, among other clinical symptoms. In the two previously reported cases, the first case had autoinflammation, immunodeficiency, amylopectinosis, and lymphangiectasia, while the second case presented with covariate immunodeficiency without lymphangiectasia or evidence of starch adhesion (table S2). This may be related to the varying pathogenicity of different pathogens.

Our findings indicate that the HOIP variant identified in this case resulted in the loss of linear ubiquitination function and impaired the intracellular NF-κB pathway, thereby affecting the expression of downstream target genes, which may have contributed to the recurrent bacterial and viral infections. The literature abounds with evidence underscoring the role of LUBAC in conferring cellular protection against bacterial infections. HOIP and HOIL-1L are key regulators of bacterial immunity against Burkholderia cenocepacia and Salmonella typhimurium. Cells activate the NF-κB signaling pathway through the synthetic linear ubiquitin chain and, simultaneously, induce autophagy, thereby inhibiting bacterial proliferation and removing bacteria. [18, 19, 20, 21, 22] However, bacteria have evolved a series of effector proteins that disrupt the linear ubiquitination mechanism, enabling them to stay alive in the host longer. For instance, specific E3 ubiquitin ligases are secreted to bind to HOIP and HOIL-1L and inhibit linear ubiquitination and NF-κB activation while mediating HOIP degradation through the proteasome pathway to disrupt LUBAC formation. Additionally, bacteria have evolved linear ubiquitin chain-specific deubiquitinases to prevent linear ubiquitin chain accumulation, which inhibits host NF-κB immune signaling and limits immune responses. [23, 24, 25] These findings underscore the crucial role of linear ubiquitination in response to bacterial infection, including inflammatory activation and autophagy regulation. Conversely, linear ubiquitination has a negative feedback effect on antiviral immunity and can limit innate immunity by inhibiting interferon. [26, 27, 28] On the other hand, viruses can enhance viral survival and persistence by disrupting the linear ubiquitination of specific substrates, inhibiting interferon synthesis and NF-κB activation, and modulating the host inflammatory response. [29, 30]

Furthermore, our results showed that HOIP mutant cells are sensitive to TNF-induced death and exhibit a prominently activated mitochondrial apoptotic pathway. In this patient, these cellular changes may contribute to the development of inflammatory conditions, including necrotizing lymphadenitis, pneumonia, and other similar diseases. Specifically, the LMP1 protein expressed by the Epstein-Barr virus perpetually triggers growth and survival pathways by mimicking CD40 signaling, and its expression is essential for the transformation of human B lymphocytes into immortalized lymphoid cell lines. [31, 32, 33] Prior research indicates that linear ubiquitination modification promotes LMP1 activation of NF-κB while suppressing interferon signaling and facilitating cell growth and survival. In contrast, the removal of HOIP and HOIL-1L impairs LMP1-induced activation of the classical NF-κB pathway and P38 and JNK. [34, 35] Consistent with these observations, in the B-cell line LCL cells, the depletion of HOIP inhibited LCL growth and induced apoptosis by activating the intrinsic apoptotic pathway. [34] Our results coincide with these studies, highlighting the critical role of HOIP in suppressing cell death. Particularly, the HOIP variant led to significant cell necrosis and pyroptosis induced by TNF, in addition to mitochondrial-mediated apoptosis.

However, forms of cell death such as necrosis, pyroptosis, and secondary necrosis driven by apoptosis can stimulate the release of cytokines known as damage-associated molecular patterns, activate immune receptors, and elicit inflammatory responses, all of which can serve as major drivers of inflammatory diseases. [36] It was found that in Sharpin gene-spontaneously null mutant mice, cell death sensitivity could be corrected and chronic proliferative dermatitis in mice could be ameliorated by knocking out the tnf gene. [3] Meanwhile, knockout of Ripk3 or Mlk1, key proteins in the cell death pathway, partially protected the inflammatory phenotype of the spleen and significantly reduced liver inflammation. [37] In addition, it has been shown that in Hoil-1 and Hoip epidermis-specific knockout mice, cell death in the epidermis triggered severe skin inflammation and necrosis of keratin-forming cells. Knockdown of Tnf only partially alleviated the phenotype, suggesting an important role for other signalling pathways in the development of disease. Remarkable, knockout of Caspase-8 and Mlkl/Ripk3 restored symptoms in epidermal Hoil-1 and Hoip-deficient mice. [38] These findings highlight the importance of cell death in the development of inflammation and suggest that cell death-related pathways represent a potential therapeutic target for the treatment of inflammatory patients with HOIP deficiency.

There are some limitations to our study. Due to the limited availability of clinical samples from patients, we were unable to examine the in vivo expression of RNA and protein of HOIP, as well as the function of the patient's immune cells, in more detail.

In conclusion, we identified the first RNF31 deletion variant and investigated its function, highlighting its key role in linear ubiquitination modifications. We investigated the NF-κB and MAPK signaling pathways while focusing on the role of HOIP in cell death, providing theoretical evidence for the inflammatory phenotype in HOIP-deficient individuals.

Conflict of Interest

The authors declare no competing interests.

Acknowledgments

This work was supported financially by National Natural Science Foundation of China (No. 82270444 and 81501851)

Author Contributions

Conceptualization, Xin Tu and Xiangdong Kong; Conceived and supervised the project, Xin Tu and Xiangdong Kong; Investigation, Mengru Wang, Ying Bai, Dan Jiang, Yue Wang, Yingchao Zhou, Mengchen Zhou, Yilin Chen, Chenguang Yu, Xiangyi Wang, Qiang Guo, Lingfeng Zha, Qianqian Li, Zhubing Cao, Jianfei Wu, Shumei Shi, Qing Wang, and Chengqi Xu; Writing-original draft, Mengru Wang, and Ying Bai; Writing-review & editing, Xin Tu, Xiangdong Kong, and Ying Bai; Visualization, Xin Tu, and Ying Bai.

Haas TL, Emmerich CH, Gerlach B, Schmukle AC, Cordier SM, Rieser E, et al. Recruitment of the linear ubiquitin chain assembly complex stabilizes the TNF-R1 signaling complex and is required for TNF-mediated gene induction. Mol Cell 2009, 36(5): 831–844.
Kirisako T, Kamei K, Murata S, Kato M, Fukumoto H, Kanie M, et al. A ubiquitin ligase complex assembles linear polyubiquitin chains. EMBO J 2006, 25(20): 4877–4887.
Gerlach B, Cordier SM, Schmukle AC, Emmerich CH, Rieser E, Haas TL, et al. Linear ubiquitination prevents inflammation and regulates immune signalling. Nature 2011, 471(7340): 591–596.
Boisson B, Laplantine E, Prando C, Giliani S, Israelsson E, Xu Z, et al. Immunodeficiency, autoinflammation and amylopectinosis in humans with inherited HOIL-1 and LUBAC deficiency. Nat Immunol 2012, 13(12): 1178–1186.
Seymour RE, Hasham MG, Cox GA, Shultz LD, Hogenesch H, Roopenian DC, et al. Spontaneous mutations in the mouse Sharpin gene result in multiorgan inflammation, immune system dysregulation and dermatitis. Genes Immun 2007, 8(5): 416–421.
Jung J, Kim JM, Park B, Cheon Y, Lee B, Choo SH, et al. Newly identified tumor-associated role of human Sharpin. Mol Cell Biochem 2010, 340(1–2): 161–167.
Boisson B, Laplantine E, Dobbs K, Cobat A, Tarantino N, Hazen M, et al. Human HOIP and LUBAC deficiency underlies autoinflammation, immunodeficiency, amylopectinosis, and lymphangiectasia. J Exp Med 2015, 212(6): 939–951.
Oda H, Beck DB, Kuehn HS, Sampaio Moura N, Hoffmann P, Ibarra M, et al. Second Case of HOIP Deficiency Expands Clinical Features and Defines Inflammatory Transcriptome Regulated by LUBAC. Front Immunol 2019, 10: 479.
Peltzer N, Rieser E, Taraborrelli L, Draber P, Darding M, Pernaute B, et al. HOIP deficiency causes embryonic lethality by aberrant TNFR1-mediated endothelial cell death. Cell Rep 2014, 9(1): 153–165.
Smit JJ, Monteferrario D, Noordermeer SM, van Dijk WJ, van der Reijden BA, Sixma TK. The E3 ligase HOIP specifies linear ubiquitin chain assembly through its RING-IBR-RING domain and the unique LDD extension. Embo J 2012, 31(19): 3833–3844.
Stieglitz B, Rana RR, Koliopoulos MG, Morris-Davies AC, Schaeffer V, Christodoulou E, et al. Structural basis for ligase-specific conjugation of linear ubiquitin chains by HOIP. Nature 2013, 503(7476): 422–426.
Rehder C, Bean LJH, Bick D, Chao E, Chung W, Das S, et al. Next-generation sequencing for constitutional variants in the clinical laboratory, 2021 revision: a technical standard of the American College of Medical Genetics and Genomics (ACMG). Genet Med 2021, 23(8): 1399–1415.
Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med 2015, 17(5): 405–424.
Liu J, Wang Y, Gong Y, Fu T, Hu S, Zhou Z, et al. Structural Insights into SHARPIN-Mediated Activation of HOIP for the Linear Ubiquitin Chain Assembly. Cell Rep 2017, 21(1): 27–36.
Fujita H, Tokunaga A, Shimizu S, Whiting AL, Aguilar-Alonso F, Takagi K, et al. Cooperative Domain Formation by Homologous Motifs in HOIL-1L and SHARPIN Plays A Crucial Role in LUBAC Stabilization. Cell Rep 2018, 23(4): 1192–1204.
Tokunaga F, Sakata S, Saeki Y, Satomi Y, Kirisako T, Kamei K, et al. Involvement of linear polyubiquitylation of NEMO in NF-kappaB activation. Nat Cell Biol 2009, 11(2): 123–132.
Lafont E, Kantari-Mimoun C, Draber P, De Miguel D, Hartwig T, Reichert M, et al. The linear ubiquitin chain assembly complex regulates TRAIL-induced gene activation and cell death. Embo J 2017, 36(9): 1147–1166.
Dorrington MG, Bradfield CJ, Lack JB, Lin B, Liang JJ, Starr T, et al. Type I IFNs facilitate innate immune control of the opportunistic bacteria Burkholderia cenocepacia in the macrophage cytosol. Plos Pathog 2021, 17(3): e1009395.
Fiskin E, Bionda T, Dikic I, Behrends C. Global Analysis of Host and Bacterial Ubiquitinome in Response to Salmonella Typhimurium Infection. Mol Cell 2016, 62(6): 967–981.
van Wijk SJL, Fricke F, Herhaus L, Gupta J, Hotte K, Pampaloni F, et al. Linear ubiquitination of cytosolic Salmonella Typhimurium activates NF-kappaB and restricts bacterial proliferation. Nat Microbiol 2017, 2: 17066.
Noad J, von der Malsburg A, Pathe C, Michel MA, Komander D, Randow F. LUBAC-synthesized linear ubiquitin chains restrict cytosol-invading bacteria by activating autophagy and NF-kappaB. Nat Microbiol 2017, 2: 17063.
Chu Y, Kang Y, Yan C, Yang C, Zhang T, Huo H, et al. LUBAC and OTULIN regulate autophagy initiation and maturation by mediating the linear ubiquitination and the stabilization of ATG13. Autophagy 2021, 17(7): 1684–1699.
de Jong MF, Liu Z, Chen D, Alto NM. Shigella flexneri suppresses NF-kappaB activation by inhibiting linear ubiquitin chain ligation. Nat Microbiol 2016, 1(7): 16084.
Liu J, Wang Y, Wang D, Wang Y, Xu X, Zhang Y, et al. Mechanistic insights into the subversion of the linear ubiquitin chain assembly complex by the E3 ligase IpaH1.4 of Shigella flexneri. Proc Natl Acad Sci U S A 2022, 119(12): e2116776119.
Wan M, Wang X, Huang C, Xu D, Wang Z, Zhou Y, et al. A bacterial effector deubiquitinase specifically hydrolyses linear ubiquitin chains to inhibit host inflammatory signalling. Nat Microbiol 2019, 4(8): 1282–1293.
Belgnaoui SM, Paz S, Samuel S, Goulet ML, Sun Q, Kikkert M, et al. Linear ubiquitination of NEMO negatively regulates the interferon antiviral response through disruption of the MAVS-TRAF3 complex. Cell Host Microbe 2012, 12(2): 211–222.
Inn KS, Gack MU, Tokunaga F, Shi M, Wong LY, Iwai K, et al. Linear ubiquitin assembly complex negatively regulates RIG-I- and TRIM25-mediated type I interferon induction. Mol Cell 2011, 41(3): 354–365.
Zuo Y, Feng Q, Jin L, Huang F, Miao Y, Liu J, et al. Regulation of the linear ubiquitination of STAT1 controls antiviral interferon signaling. Nat Commun 2020, 11(1): 1146.
Khan M, Syed GH, Kim SJ, Siddiqui A. Hepatitis B Virus-Induced Parkin-Dependent Recruitment of Linear Ubiquitin Assembly Complex (LUBAC) to Mitochondria and Attenuation of Innate Immunity. Plos Pathog 2016, 12(6): e1005693.
Chen Y, He L, Peng Y, Shi X, Chen J, Zhong J, et al. The hepatitis C virus protein NS3 suppresses TNF-alpha-stimulated activation of NF-kappaB by targeting LUBAC. Sci Signal 2015, 8(403): ra118.
Uchida J, Yasui T, Takaoka-Shichijo Y, Muraoka M, Kulwichit W, Raab-Traub N, et al. Mimicry of CD40 signals by Epstein-Barr virus LMP1 in B lymphocyte responses. Science 1999, 286(5438): 300–303.
Rastelli J, Homig-Holzel C, Seagal J, Muller W, Hermann AC, Rajewsky K, et al. LMP1 signaling can replace CD40 signaling in B cells in vivo and has unique features of inducing class-switch recombination to IgG1. Blood 2008, 111(3): 1448–1455.
Graham JP, Arcipowski KM, Bishop GA. Differential B-lymphocyte regulation by CD40 and its viral mimic, latent membrane protein 1. Immunol Rev 2010, 237(1): 226–248.
Greenfeld H, Takasaki K, Walsh MJ, Ersing I, Bernhardt K, Ma Y, et al. TRAF1 Coordinates Polyubiquitin Signaling to Enhance Epstein-Barr Virus LMP1-Mediated Growth and Survival Pathway Activation. Plos Pathog 2015, 11(5): e1004890.
Wang L, Wang Y, Zhao J, Ren J, Hall KH, Moorman JP, et al. The Linear Ubiquitin Assembly Complex Modulates Latent Membrane Protein 1 Activation of NF-kappaB and Interferon Regulatory Factor 7. J Virol 2017, 91(4).
van Loo G, Bertrand MJM. Death by TNF: a road to inflammation. Nat Rev Immunol 2022: 1–15.
Rickard JA, Anderton H, Etemadi N, Nachbur U, Darding M, Peltzer N, et al. TNFR1-dependent cell death drives inflammation in Sharpin-deficient mice. Elife 2014, 3.
Taraborrelli L, Peltzer N, Montinaro A, Kupka S, Rieser E, Hartwig T, et al. LUBAC prevents lethal dermatitis by inhibiting cell death induced by TNF, TRAIL and CD95L. Nat Commun 2018, 9(1): 3910.

(Not answered)

Supplementalmaterials.docx
Supplemental materials

Download PDF

Version 1

posted

You are reading this latest preprint version

A Novel HOIP Frameshift Variant Alleviates NF-kappaB Signaling and Sensitizes Cells to TNF-induced Death

Status:

Version 1

Abstract

Figures

1 Introduction

2 Materials and methods

3 Results

4 Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1