mmu-miR-374b-5p modulated inflammatory factors via downregulation of C/EBP β/NF-κB signaling in Kupffer cells during Echinococcus multilocularis infection

doi:10.21203/rs.3.rs-3420264/v1

Download PDF

Research Article

mmu-miR-374b-5p modulated inflammatory factors via downregulation of C/EBP β/NF-κB signaling in Kupffer cells during Echinococcus multilocularis infection

https://doi.org/10.21203/rs.3.rs-3420264/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 29 Mar, 2024

Read the published version in Parasites & Vectors →

You are reading this latest preprint version

Background

Alveolar echinococcosis (AE) is an important infectious disease caused by the metacestode larva of Echinococcus multilocularis (E. multilocularis), seriously threatening global public health security. Kupffer cells (KCs) play important roles in inflammasome. However, its role in hepatic alveolar echinococcosis not yet fully elucidated.

Methods

In this study, qRT-PCR was used to detect the expression level of miR-374b-5p in KCs. C/EBP β, one of the targets of miR-374b-5p, was identified through luciferase reporter assays and loss-of-function and gains. Critical genes involved in NFκB signaling pathway were analyzed by qRT-PCR and western blot.

Results

This study reported that miR-374b-5p was significantly up-regulated in KCs during E. multilocularis infection, and further showed that miR-374b-5p was able to bind to the 3'-UTR of the C/EBP β gene and regulated its expression. The expression levels of NF-κBp65 and p-NF-κBp65 and pro-inflammatory factor including iNOS, TNFα, and IL6 was attenuated after overexpression of miR-374b-5p while enhanced after suppression of miR-374b-5p. However, the Arg1 expression level was promoted after overexpression of miR-374b-5p while suppressed after suppression of miR-374b-5p. Additionally, the increased protein levels of NF-κBp65 and p-NF-κBp65 were found in the C/EBP β-overexpressed KCs.

Conclusions

These results demonstrated that miR-374b-5p probably regulated the expression of inflammatory factors via C/EBP β/NF-κB signaling. This finding is helpful to explore the mechanism of inflammation regulation during E. multilocularis infection.

Echinococcus multilocularis

miR-374b-5p

inflammatory factors

C/EBP β

NF-κB

In recent studies, increasing attention has been given to the zoonotic Alveolar echinococcosis (AE), which caused by the larva of Echinococcus multilocularis (E. multilocularis) [1]. It is prevalence in areas with developed animal husbandry [2, 3]. The life cycle of E. multilocularis mainly involves rodents, foxes and human. Human was occasionally infected by ingesting food or drinking water contaminated with eggs discharged from the definitive host foxes and dogs [4]. Once ingested, the oncospheres hatch from the eggs and then migrate from blood to body, especially liver. Remarkably, E. multilocularis mainly destroys the host’s liver by mechanical extrusion and production of active molecules [5]. Kupffer cells (KCs) play important roles in maintaining immune homeostasis of the liver against pathogen infection [6, 7]. KCs mediate liver injury, plerosis, and partake in formation of liver fibrosis through secreting cytokines, phagocytosis and antigen-presenting [8, 9]. KCs can produce inflammatory cytokines or chemokines via NF-κB, which result in liver fibrosis during Schistosoma japonicum infection [10]. However, in E. multilocularis infected liver, the regulation of host immunity by KCs has not been clarified.

MicroRNAs (miRNAs), with 18–25 nucleotides, are a class of conserved endogenous non-coding RNAs with gene regulatory functions. miRNAs can silence target gene expression by base pairing to complementary sequence in the 3'-untranslated region [11]. miRNAs have been reported to participate in interactions between the pathogen and the host. Recent studies have confirmed that miRNAs can play a key role in the regulation of inflammatory responses against pathogen [12]. In T helper cells, the schistosomal miR-10 targets MAP3K7 and consequently downmodulates NF-κB activity [13]. Leishmania braziliensis exploits host miR-548d-3p to modulate the production of pro-inflammatory cytokines, affecting inflammatory processes [14]. Therefore, study of miRNAs will be providing further insight into parasite-host interactions [15, 16].

Previous studies have found that miR-374b-5p was involved in different physiological and pathological processes [17, 18, 19]. In this study, we found that mmu-miR-374b-5p (miR-374b-5p) was significantly up-regulated in the KCs of mice infected with E. multilocularis. Therefore, we hypothesized that miR-374b-5p might mediate the inflammatory response in mice liver during E. multilocularis infection. This finding will demonstrate a function of miR-374b-5p in regulation of KC immune responses, possibly involved in the host-parasite relationship during E. multilocularis infection.

Parasite infection

Fresh protoscoleces (PSCs) were aseptically dissected from E. multilocularis-infected gerbil. The activity and quantity of protoscoleces were determined by microscopic observation. Six-week old Balb/c female mice (n = 80) were purchased from Laboratory Animal Center of Lanzhou Veterinary Research Institute and were randomly allocated into two groups of 40 each. One group was intra-peritoneal inoculated with approximately 1,000 protoscoleces, while the control group (C) was treated with same volume PBS at the same time[20].

Collection of excretory/secretory products (ESPs)

E. multilocularis were cultured in DMEM medium with 1% penicillin-streptomycin (without FBS) in an incubator containing 5% CO₂ at 37℃. After 8 h, the culture medium was removed, and fresh culture medium (without FBS) was added. ESPs of protoscoleces were obtained at 24 h. Then the endotoxin and protein concentration was determined with ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, USA) and BCA kit (Vazyme, China), respectively, and stored at -80℃.

Isolation, cultivation, and transfection of KCs

Primary KCs were isolated from uninfected (n = 3) and E. multilocularis-infected (n = 3) mouse liver by collagenase perfusion method and density gradient centrifugation [21], then cultured in RPMI-1640 medium supplemented with 10% FBS and 1% penicillin-streptomycin. Four hours later, the medium was removed, and adherent cells were cultured continually with fresh RPMI-1640 medium. All the while, the cells were maintained in an incubator containing 5% CO₂ at 37℃.

KCs were plated into 12-well plates and transfected with 100 nmol/L miR-374b-5p mimics, 100 nmol/L miR-374b-5p inhibitor, or 100 nmol/L their NC (negative control, Sangon China) using Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen, USA), respectively. Following transfection for 10 h, the medium was replaced with fresh DMEM medium supplemented with 10% FBS.

The C/EBP β overexpression vector (pmCherry-N1-C/EBP β) was constructed using the pmCherry-N1 plasmid. KCs were planted in 12-well culture plate and transfected with 2 µg/mL pmCherry-N1 (empty vector)or 2 µg/mL pmCherry-N1-C/EBP β (C/EBP β) by using lipofectamine 2000 (Invitrogen, USA). Six hours post transfection, the culture medium was changed to DMEM from Opti-MEM (Invitrogen, USA). Each transfection was independently repeated three times.

RNA isolation and quantitative real-time PCR

Total RNAs were isolated from KCs using TRIzol reagents (Invitrogen, USA). Complementary DNA synthesis was performed using 1 µg of total RNA via HiScriptⅡ 1st Strand cDNA Synthesis Kit or miRNA 1st Strand cDNA Synthesis Kit (Vazyme, China). qRT-PCR was carried out using SYBR Green Premix Pro Taq HS qPCR Kit on ABI 7500 Thermal Cycler (Thermo, USA) with the following steps: 95°C for 5 min and 40 cycles of 95°C for 10 s, 60°C for 30 s. The relative expression level was normalized to U6 small nuclear RNA (snRNA) or GAPDH by using the 2^−ΔΔCt formula. The details of primers used for qRT-PCR were summarized in Table 1. Statistical analysis data were taken from three independent experiments.

Table 1

Primers for qRT-PCR
Primer	Sequence(5’-3’)
miR-374b-5p	GCGCGATATAATACAACCTGC
Universal reverse primer	GCTGTCAACGATACGCTACG
C/EBP β forward primer	GCTGAGCGACGAGTACAAGATGC
C/EBP-β reverse primer	CTTGTGCTGCGTCTCCAGGTTG
IL6 forward primer	CTTCTTGGGACTGATGCTGGTGAC
IL6 reverse primer	TCTGTTGGGAGTGGTATCCTCTGTG
iNOS forward primer	CCTAGTCAACTGCAAGAGAA
iNOS reverse primer	TTTCAGGTCACTTTGGTAGG
TNFα forward primer	CGCTCTTCTGTCTACTGAACTTCGG
TNFα reverse primer	GTGGTTTGTGAGTGTGAGGGTCTG
Arg1 forward primer	AGACAGCAGAGGAGGTGAAGAGTAC
Arg1 reverse primer	AAGGTAGTCAGTCCCTGGCTTATGG
GAPDH forward primer	CCACTCACGGCAAATTCAAC
GAPDH reverse primer	CTCCACGACATACTCAGCAC

Target genes analysis of miR-374b-5p

miRDB (https://mirdb.org/) and TargetScan (https://www.targetscan.org/mmu_80/) were used to predict the targets of miR-374b-5p. According to the results, the potential target genes were selected to further validate.

Plasmid construction and Luciferase assay

The 3'-UTR of C/EBP β were cloned into pmirGLO plasmid to construct the luciferase reporter plasmids also as pmirGLO-C/EBP β-WT. Meanwhile, the 3'-UTR of wild type sequences of C/EBP β binding to seed region of miR-374b-5p were mutated and cloned into pmirGLO plasmid, named the pmirGLO-C/EBP β-Mut.

HEK293T cells (1×10⁵ cells per well) were plated into 24-well plates and co-transfected by pmirGLO-C/EBP β-WT (C/EBP β-WT) or pmirGLO-C/EBP β-Mut (C/EBP β-Mut) with miR-374b-5p mimics or miR-NC using Lipofectamine 2000 according to the manufacturer's instructions, respectively. After 24 h, luciferase activity was detected on a Dual Glo Luciferase Assay System (Promega, USA) using a Dual Luciferase Reporter Assay System (Vazyme, China). For this assay, relative activity was defined by the ratio of firefly to Renilla luciferase activity. Each transfection was independently repeated three times.

Western blot

Firstly, cells were cleaned three times with pre-cooling PBS, and lysed with RIPA buffer (Thermo, USA) containing protease-phosphatase inhibitor (NCM Biotech, China). The total protein concentration was measured with BCA kit (Vazyme, China). Total protein (25 µg) from each group was separated with 12% SDS-PAGE and then transferred to PVDF membranes. Subsequently, the PVDF membranes were blocked with 5% non-fat dried milk for 90 min at room temperature and washed once in TBS with 0.05%Tween (TBST). Then the PVDF membranes were incubated with the following primary antibody overnight at 4℃: C/EBP β rabbit monoclonal antibody (1:1000, Beyotime, China), NF-κBp65 mouse monoclonal antibody (1:500, Beyotime, China), p-NF-κBp65 rabbit polyclonal antibody (1:500, Beyotime, China), rabbit anti-IL6 polyclonal antibody (1:1000, Bioss, China), rabbit anti-TNFα polyclonal antibody (1:500, Bioss, China), rabbit anti-iNOS polyclonal antibody (1:1000, Bioss, China), rabbit anti-Arg1 polyclonal antibody (1:1000, Bioss, China), rabbit anti-β-actin polyclonal antibody (1:5000, Bioss, China). And then, rabbit anti-mouse IgG-HRP antibody (1:4000, Biodragon, China) or goat anti-rabbit IgG-HRP antibody (1:4000, Biodragon, China) was used to incubate with membranes for 1h. At last, the membranes were tested on high resolution image acquisition system (BioRad, USA) with BeyoECL Moon reagent (Beyotime, China).

Statistical analysis

All data are shown as means ± SD. The level of differential expression was evaluated between experimental group and control group by t-test. All the statistical analyses in this study were performed by Graphpad prism 8. p < 0.05 was considered statistically significant.

Increased expression of miR-374b-5p in KCs after E. multilocularis infection

Protoscolices were collected from the E. multilocularis-infected Mongolian gerbil (Fig. 1A). Previous research has shown that miR-374b-5p was involved in pathogen-mediated inflammation [18, 19]. To examine the expression of miR-374b-5p in mouse KCs during E. multilocularis infection, the primary KCs were obtained from the liver of E. multilocularis-infected mice (Fig. 1B, C). The qRT-PCR result showed that the level of miR-374b-5p was significantly increased at 2 months post-infection (Fig. 1D).

miR-374b-5p was directly bound to the 3'-UTR of C/EBP β and suppressed its expression

To determine the potential role of miR-374b-5p in KCs during E. multilocularis infection, its potential targets were predicted by TargetScan and miRDB databases. A total of 8 potential targets, mainly associated with immune response, were screened out and visualized by qRT-PCR. Amongst only C/EBP β gene was significantly down-regulated in miR-374b-5p-overexpressed KCs (Fig. S1). Further analysis showed that there is a single binding site of miR-374b-5p in 3′-UTR of C/EBP β (Fig. 2A). Luciferase reporter assay revealed that the miR-374b-5p significantly decreased the luciferase activity in the HEK293T cells transfected with pmirGLO-C/EBP β-WT compared with that in the NC control (Fig. 2B). However, the decrease was not observed in the HEK293T cells transfected with pmirGLO-C/EBP β-Mut (Fig. 2B), suggesting that miR-374b-5p is able to bind to the 3′-UTR of C/EBP β. Furthermore, the expressions of C/EBP β were significantly inhibited at mRNA and protein levels in the miR-374b-5p-overexpressed KCs. Consistently, C/EBP β was significantly elevated at both mRNA and protein levels after downregulation of miR-374b-5p in the KCs by transfecting with miR-374b-5p inhibitor (Fig. 2C, D, E). Moreover, the expression of C/EBP β was negatively correlated with the miR-374b-5p expression in the KCs from E. multilocularis-infected mice (Fig. 2F). Above results suggest that miR-374b-5p was able to directly target to the 3′-UTR of C/EBP β and thereby suppressed C/EBP β expression.

Overexpression of miR-374b-5p inhibited the expression of NF-κBp65

In order to study the effect of miR-374b-5p-mediated C/EBP β on the NF-κB signaling pathway, the primary mice KCs were isolated. We found the protein levels of NF-κBp65 and p-NF-κBp65 were significantly down-regulated in the KCs transfected with miR-374b-5p mimics, while their protein levels were significantly up-regulated after transfection with miR-374b-5p inhibitor (Fig. 3A, B). Consistently, the protein levels of NF-κBp65 and p-NF-κBp65 were significantly up-regulated in the KCs overexpressed C/EBP β (Fig. 3C). This indicated that miR-374b-5p-mediated C/EBP β may be involved in the regulation of NF-κB signaling pathways.

Overexpression of miR-374b-5p changed the level of inflammatory factors

In order to determine whether the miR-374b-5p influence on the expression of inflammatory factors, the expression levels of M1-type pro-inflammatory (iNOS, TNFα, and IL6) and M2-type anti-inflammatory factors (Arg1) were detect by qRT-PCR and western blot. The expression of iNOS, TNFα, and IL6 at both mRNA and protein levels were statistically down-regulated in the KCs transfected with miR-374b-5p mimics compared with miR-NC, while Arg1 expression was statistically up-regulated (Fig. 4A,C). After transfection with miR-374b-5p inhibitor, the expressions of those inflammatory factors were opposite to those in the miR-374b-5p-overexpressed KCs (Fig. 4B, D). Above all, miR-374b-5p probably induced M2-type anti-inflammatory factors while suppressed M1-type pro-inflammatory factors via C/EBP β/NF-κB signaling pathway.

The production of proinflammatory factors was inhibited in KCs from E. multilocularis-infected mice and treated with ESPs

The results showed that the expression of iNOS and TNFα were decreased in KCs at 2 months post-infection, while Arg1 was obviously increased (Fig. 5A). Interestingly, the expression of miR-374b-5p was up-regulated in KCs treated with 25µg ESPs (Fig. 5B), and its target gene C/EBP β were down-regulated (Fig. 5C). Furthermore, the protein expression of NF-κBp65 and p-NF-κBp65 were down-regulated in ESPs-treated KCs (Fig. 5D). The expression of iNOS, TNFα, and IL6 at mRNA and protein levels were statistically down-regulated in KCs treated with ESPs. The mRNA level of Arg1 had no changed after treatment with ESPs, but Arg1 protein was statistically up-regulated (Fig. 5E, F). All these findings demonstrated that the NF-κB signaling was inhibited after treating KCs with ESPs in vitro.

Alveolar echinococcosis (AE) is an important infectious disease, threatening the health of human beings and animals in the world. How to effectively prevent and treat AE is still a challenge. E. multilocularis has a continuous and infiltrative tumor-like invasive growth in liver, which leading to serious liver injury. Recent research shows that KCs are major source of inflammatory mediators [22] and closely relates to the immune response in liver. KCs that located in hepatic sinusoid can play a defensive role by releasing inflammatory mediators. Previous study shows that miRNA profiles of KCs have significantly changed during the E. multilocularis infection [20]. In this study, we found that miR-374b-5p was up-regulated at the middle stage of infection. Evidence showed that miR-374b-5p was involved in the regulation of inflammation response. It was reported that overexpressed miR-374b-5p can lead to the reduction of neuroinflammation in Alzheimer's disease models [23]. Previous study showed the immune regulatory effect of miR-374b-5p on CD4⁺ T cells in mice spleen [19].

Luciferase reporter assay revealed that the miR-374b-5p could directly bind to C/EBP β. Moreover, down-regulation of C/EBP β in the KCs transfected with miR-374b-5p mimics was observed. C/EBP β, one of the transcription factors, can combine with the promoter and thus control the expression of target genes [24]. Studies found that C/EBP β was closely related to the NF-κB signaling pathway, C/EBP β promotes NF-κBp65 translocation into nucleus and the DNA binding activity [25, 26]. The result showed that overexpression of miR-374b-5p inhibited the protein levels of NF-κBp65 and p-NF-κBp65. Consistently, overexpression of C/EBP β promoted the protein levels of p-NF-κBp65. NF-κBp65 was discovered as the critical protein responsible for NF-κB signaling pathway. When NF-κBp65 subunit is phosphorylated and it transferred into the nucleus from the cytoplasm [27, 28], the phosphorylation of NF-κBp65 result in NF-κB activation and the production of proinflammatory cytokines [29, 30]. Result from the experiment also showed overexpression of miR-374b-5p inhibited the production of pro-inflammatory factors, while promoting the expression of anti-inflammatory factors in primary mouse KCs. Moreover, the production of proinflammatory factors was inhibited in KCs from E. multilocularis-infected mice. This result indicated that miR-374b-5p is probably involved in inflammatory reaction process during the E. multilocularis infection. It has been confirmed that the parasitic helminths stimulates the host to trigger the Th1-type immune response in early stage infection [31]. Subsequently, Th1-type immune response gradually changes to the Th2-type immune response, which is contributed to survive for the worms in host. And some researchers [32, 33] found that in the early stage of worm infection, anti-inflammatory factors showed an upward trend. Our research results also support this statement. Helminths can manipulate the host immune response towards Th2-type immune response that is mainly produced in response to both the mechanical extrusion caused by the helminths and also their release of excretory/secretory products [34, 35]. To confirm these changes is due to E. multilocularis infections, ESPs were collected and co-cultured with KCs. As expected, miR-374b-5p was obviously up-regulated in KCs treated with ESPs, which is consistent with KCs from infested E. multilocularis. And the protein expression of NF-κBp65 and p-NF-κBp65 were down-regulated in ESPs-treated KCs. Then the inflammatory cytokines in KCs treated with ESPs were tested. The result reflects that the expression of iNOS, TNFα, and IL6 at mRNA and protein levels were statistically down-regulated in KCs treated with ESPs. These results were similar as seen in miR-374b-5p-overexpressed KCs. The mRNA level of IL6 was up-regulated at 2 months post-infection in KCs, possibly because of the very complex regulatory mechanism of animals. Several recent studies have shown that IL6 does not only promotes M2 polarization, but also suppress the production of proinflammatory cytokines [36, 37, 38].

In conclusion, our results indicate that the level of miR-374b-5p was obviously up-regulated at 2 months post-infection in KCs. Moreover, miR-374b-5p was able to bind to the 3'-UTR of the C/EBP β gene and suppressed its expression, thus down-regulated NF-κB signaling. This research is helpful to explore the mechanism of inflammation regulation and host defense during E. multilocularis infection.

E. multilocularisaris	Echinococcus multilocularis
AE	Alveolar echinococcosis
miRNA	MicroRNA
KCs	Kupffer cells
FBS 3 'UTR WT Mut PBS SDS-PAGE	fatal bovine serum 3 'untranslated region wild type Mutant phosphate belanced solution Sodium dodecyl sulphate–polyacrylamide gel electrophoresis
TBST	Tris bufered saline with Tween-20
PVDF 2mpi	Polyvinylidene fluoride 2 months post infection
iNOS TNFα IL6	induced nitrogen monoxide synthase Tumor Necrosis Factor α Interleukin 6
Arg1	Arginase1

Acknowledgements

Not applicable.

Funding

The study was financially supported by grants from the National Key Research and Development Program of China (2022YFD1800200), the National Natural Science Foundation of China (No.32072889), and the Innovation Program of Chinese Academy of Agricultural Sciences.

Availability of data and materials

The datasets supporting the findings of this article are included within the article.

Authors’ contributions

XL, GP and YL designed the experiments and analyzed the data. GP, YL and TA drafted the initial version of the manuscript. GP, HL, LW, GC, and TL participated in some experiments and data analysis. XL, GP and XG drafted the final version of the manuscript. All authors contributed to the article and approved the submitted version.

Ethics approval and consent to participate

All the animal experiment procedures were approved by Animal Administration and Ethics Committee of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences and conducted according to the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of the People’s Republic of China.

Consent for publication

Not applicable.

Competing interests

The authors declare no conflict of interest.

Eckert J, Deplazes P. Biological, epidemiological, and clinical aspects of echinococcosis, a zoonosis of increasing concern. Clin Microbiol Rev. 2004;17(1):107-135. doi:10.1128/CMR.17.1.107-135.2004
Guo B, Zhang Z, Guo Y, Guo G, Wang H, Ma J, et al. High endemicity of alveolar echinococcosis in Yili Prefecture, Xinjiang Autonomous Region, the People's Republic of China: Infection status in different ethnic communities and in small mammals. PLoS Negl Trop Dis. 2021;15(1):e0008891. Published 2021 Jan 19. doi:10.1371/journal.pntd.0008891
Woolsey ID, Miller AL. Echinococcus granulosus sensu lato and Echinococcus multilocularis: A review. Res Vet Sci. 2021;135:517-522. doi:10.1016/j.rvsc.2020.11.010
Kotwa JD, Isaksson M, Jardine CM, Campbell GD, Berke O, Pearl DL, et al. Echinococcus multilocularis Infection, Southern Ontario, Canada. Emerg Infect Dis. 2019;25(2):265-272. doi:10.3201/eid2502.180299
Gürler AT, Bölükbaş CS, Açıcı M, Umur Ş. Overview of Echinococcus multilocularis in Turkey and in the World. Turkiye Parazitol Derg. 2019;43(Suppl 1):18-35. doi:10.4274/tpd.galenos.2019.6300
Dai S, Liu F, Qin Z, Zhang J, Chen J, Ding WX, et al. Kupffer cells promote T-cell hepatitis by producing CXCL10 and limiting liver sinusoidal endothelial cell permeability. Theranostics. 2020;10(16):7163-7177. Published 2020 Jun 1. doi:10.7150/thno.44960
Ju C, Tacke F. Hepatic macrophages in homeostasis and liver diseases: from pathogenesis to novel therapeutic strategies. Cell Mol Immunol. 2016;13(3):316-327. doi:10.1038/cmi.2015.104
Heymann F, Peusquens J, Ludwig-Portugall I, Kohlhepp M, Ergen C, Niemietz P, et al. Liver inflammation abrogates immunological tolerance induced by Kupffer cells. Hepatology. 2015;62(1):279-291. doi:10.1002/hep.27793
Seki E, De Minicis S, Osterreicher CH, Kluwe J, Osawa Y, Brenner DA, et al. TLR4 enhances TGF-beta signaling and hepatic fibrosis. Nat Med. 2007;13(11):1324-1332. doi:10.1038/nm1663
Zhang WJ, Fang ZM, Liu WQ. NLRP3 inflammasome activation from Kupffer cells is involved in liver fibrosis of Schistosoma japonicum-infected mice via NF-κB. Parasit Vectors. 2019;12(1):29. doi:10.1186/s13071-018-3223-8
Fabian MR, Sonenberg N. The mechanics of miRNA-mediated gene silencing: a look under the hood of miRISC. Nat Struct Mol Biol. 2012;19(6):586-593. Published 2012 Jun 5. doi:10.1038/nsmb.2296
Saliminejad K, Khorram Khorshid HR, Soleymani Fard S, Ghaffari SH. An overview of microRNAs: Biology, functions, therapeutics, and analysis methods. J Cell Physiol. 2019;234(5):5451-5465. doi:10.1002/jcp.27486
Meningher T, Barsheshet Y, Ofir-Birin Y, Gold D, Brant B, Dekel E, et al. Schistosomal extracellular vesicle-enclosed miRNAs modulate host T helper cell differentiation. EMBO Rep. 2020;21(1):e47882. doi:10.15252/embr.201947882
Souza MA, Ramos-Sanchez EM, Muxel SM, Lagos D, Reis LC, Pereira VRA, et al. miR-548d-3p Alters Parasite Growth and Inflammation in Leishmania (Viannia) braziliensis Infection. Front Cell Infect Microbiol. 2021;11:687647. doi:10.3389/fcimb.2021.687647
Kataria P, Surela N, Chaudhary A, Das J. MiRNA: Biological Regulator in Host-Parasite Interaction during Malaria Infection. Int J Environ Res Public Health. 2022;19(4):2395. doi:10.3390/ijerph19042395
Zheng Y, Cai X, Bradley JE. microRNAs in parasites and parasite infection. RNA Biol. 2013;10(3):371-379. doi:10.4161/rna.23716
Huang F, Wang B, Zeng J, Sang S, Lei J, Lu Y. MicroRNA-374b inhibits liver cancer progression via down regulating programmed cell death-1 expression on cytokine-induced killer cells. Oncol Lett. 2018;15(4):4797-4804. doi:10.3892/ol.2018.7951
Bian H, Zhou Y, Zhou D, Zhang Y, Shang D, Qi J. The latest progress on miR-374 and its functional implications in physiological and pathological processes. J Cell Mol Med. 2019;23(5):3063-3076. doi:10.1111/jcmm.14219
Li D, Du X, Zhu M, Yang S, Zhao W. MiR-374b-5p Regulates T Cell Differentiation and Is Associated with rEg.P29 Immunity. Biomed Res Int. 2020;2020:8024763. doi:10.1155/2020/8024763
Guo X, Zheng Y. Expression profiling of circulating miRNAs in mouse serum in response to Echinococcus multilocularis infection. Parasitology. 2017;144(8):1079-1087. doi:10.1017/S0031182017000300
Liu T, Li H, Li Y, Wang L, Chen G, Pu G, et al. Integrative Analysis of RNA Expression and Regulatory Networks in Mice Liver Infected by Echinococcus multilocularis. Front Cell Dev Biol. 2022;10:798551. doi:10.3389/fcell.2022.798551
Kolios G, Valatas V, Kouroumalis E. Role of Kupffer cells in the pathogenesis of liver disease. World J Gastroenterol. 2006;12(46):7413-7420. doi:10.3748/wjg.v12.i46.7413
Zhang J, Wang R. Deregulated lncRNA MAGI2-AS3 in Alzheimer's disease attenuates amyloid-β induced neurotoxicity and neuroinflammation by sponging miR-374b-5p. Exp Gerontol. 2021;144:111180. doi:10.1016/j.exger.2020.111180
Wang F, Gao Y, Tang L, Ning K, Geng N, Zhang H, et al. A novel PAK4-CEBPB-CLDN4 axis involving in breast cancer cell migration and invasion. Biochem Biophys Res Commun. 2019;511(2):404-408. doi:10.1016/j.bbrc.2019.02.070
Yang X, Zou J, Cai H, Huang X, Yang X, Guo D, et al. Ginsenoside Rg3 inhibits colorectal tumor growth via down-regulation of C/EBPβ/NF-kB signaling. Biomed Pharmacother. 2017;96:1240-1245. doi:10.1016/j.biopha.2017.11.092
Zou J, Li H, Chen X, Zeng S, Ye J, Zhou C, et al. C/EBPβ knockdown protects cardiomyocytes from hypertrophy via inhibition of p65-NFkB. Mol Cell Endocrinol. 2014;390(1-2):18-25. doi:10.1016/j.mce.2014.03.007
Giridharan S, Srinivasan M. Mechanisms of NF-kB p65 and strategies for therapeutic manipulation. J Inflamm Res. 2018;11:407-419. Published 2018 Oct 30. doi:10.2147/JIR.S140188
Liu B, Wu Y, Wang Y, Cheng Y, Yao L, Liu Y, et al. NF-κB p65 Knock-down inhibits TF, PAI-1 and promotes activated protein C production in lipopolysaccharide-stimulated alveolar epithelial cells type II. Exp Lung Res. 2018;44(4-5):241-251. doi:10.1080/01902148.2018.1505975
Zhang H, Zhuo S, Song D, Wang L, Gu J, Ma J, et al. Icariin Inhibits Intestinal Inflammation of DSS-Induced Colitis Mice Through Modulating Intestinal Flora Abundance and Modulating p-p65/p65 Molecule. Turk J Gastroenterol. 2021;32(4):382-392. doi:10.5152/tjg.2021.20282
Cui L, Feng L, Zhang ZH, Jia XB. The anti-inflammation effect of baicalin on experimental colitis through inhibiting TLR4/NF-kB pathway activation. Int Immunopharmacol. 2014;23(1):294-303. doi:10.1016/j.intimp.2014.09.005
Muñoz-Carrillo JL, Contreras-Cordero JF, Muñoz-López JL, Maldonado-Tapia CH, Muñoz-Escobedo JJ, Moreno-García MA. Resiniferatoxin modulates the Th1 immune response and protects the host during intestinal nematode infection. Parasite Immunol. 2017;39(9):10.1111/pim.12448. doi:10.1111/pim.12448
Peng J, Federman HG, Hernandez CM, Siracusa MC. Communication is key: Innate immune cells regulate host protection to helminths. Front Immunol. 2022;13:995432. Published 2022 Sep 26. doi:10.3389/fimmu.2022.995432
Allen JE, Maizels RM. Diversity and dialogue in immunity to helminths. Nat Rev Immunol. 2011;11(6):375-388. doi:10.1038/nri2992
Drurey C, Lindholm HT, Coakley G, Poveda MC, Löser S, Doolan R, et al. Intestinal epithelial tuft cell induction is negated by a murine helminth and its secreted products. J Exp Med. 2022;219(1):e20211140. doi:10.1084/jem.20211140
Crowe J, Lumb FE, Harnett MM, Harnett W. Parasite excretory-secretory products and their effects on metabolic syndrome. Parasite Immunol. 2017;39(5):10.1111/pim.12410. doi:10.1111/pim.12410
Mauer J, Chaurasia B, Goldau J, Vogt MC, Ruud J, Nguyen KD, et al. Signaling by IL-6 promotes alternative activation of macrophages to limit endotoxemia and obesity-associated resistance to insulin. Nat Immunol. 2014;15(5):423-430. doi:10.1038/ni.2865
Braune J, Weyer U, Hobusch C, Mauer J, Brüning JC, Bechmann I, et al. IL-6 Regulates M2 Polarization and Local Proliferation of Adipose Tissue Macrophages in Obesity. J Immunol. 2017;198(7):2927-2934. doi:10.4049/jimmunol.1600476
Han IH, Song HO, Ryu JS. IL-6 produced by prostate epithelial cells stimulated with Trichomonas vaginalis promotes proliferation of prostate cancer cells by inducing M2 polarization of THP-1-derived macrophages. PLoS Negl Trop Dis. 2020;14(3):e0008126. doi:10.1371/journal.pntd.0008126

No competing interests reported.

SupplementaryFigureandTable.docx
Supplementary Information Figure S1: The mRNA expression levels of potential targets in KCs transfected with miR-374b-5p mimics were detected by qRT-PCR; Table S1: Putative target genes of mmu-miR-374b-5p.

Download PDF

Journal Publication

published 29 Mar, 2024

Read the published version in Parasites & Vectors →

Editorial decision: Revision requested
21 Feb, 2024
Reviews received at journal
21 Feb, 2024
Reviewers agreed at journal
05 Feb, 2024
Reviewers agreed at journal
13 Nov, 2023
Reviewers invited by journal
10 Nov, 2023
Editor assigned by journal
09 Oct, 2023
Submission checks completed at journal
09 Oct, 2023
First submitted to journal
07 Oct, 2023

You are reading this latest preprint version

mmu-miR-374b-5p modulated inflammatory factors via downregulation of C/EBP β/NF-κB signaling in Kupffer cells during Echinococcus multilocularis infection

Status:

Journal Publication

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Methods

Parasite infection

Collection of excretory/secretory products (ESPs)

Isolation, cultivation, and transfection of KCs

RNA isolation and quantitative real-time PCR

Target genes analysis of miR-374b-5p

Plasmid construction and Luciferase assay

Western blot

Statistical analysis

Results

Overexpression of miR-374b-5p inhibited the expression of NF-κBp65

Overexpression of miR-374b-5p changed the level of inflammatory factors

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1