Revealing new bacterial functions in the plant rhizoplane

doi:10.21203/rs.3.rs-3438462/v1

Download PDF

Research Article

Revealing new bacterial functions in the plant rhizoplane

https://doi.org/10.21203/rs.3.rs-3438462/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Microorganisms play important ecological roles during interactions with plants. Although some microorganisms promote plant performance and are applied as biofertilizers, the molecular cross-talk of bacteria and plants is not fully understood. We aim to reveal which bacterial genes are tightly associated with the adaptation to the plant host by merging the outcomes of RNA-Seq data of a bacterium colonizing roots and comparative genomics analyses.

Results

Here, we show the expression of genes in a plant growth-promoting Pseudomonas strain interacting with plant roots. Our findings highlight that many of the upregulated genes have not been previously associated with this interaction. The occurrence of 184 of the upregulated bacterial genes in the interaction was higher in Pseudomonas isolates from plants compared to bacteria from other habitats, such as soils, animals or water. We argue that these genes may play relevant biological roles in this host, but only a few have been previously shown to be associated with plant-bacteria interactions. One of these genes is the yafL gene, encoding a cysteine peptidase with an NlpC/P60 hydrolytic domain, for which we demonstrate its involvement in bacterial plant growth promotion through the comparison of a wild-type bacterium with a yafL knockout strain.

Conclusions

Microbial plant growth promotion is a complex process with potential involvement of numerous bacterial genes, many of which still await characterization. By integrating the outcomes from in vivo RNA-Seq experiments and comparative genomic analyses, we have revealed several plant-associated genes and functions. Moreover, we have experimentally demonstrated the role of one of these genes in plant growth promotion.

The plant microbiome strongly impacts host health and disease status. Indeed, the plant rhizosphere hosts a large variety of microorganisms that can promote nutrient acquisition and/or protect plants against attack by phytopathogens [1]. Thus, microorganisms can be applied as biofertilizers or as biological control agents (BCAs). This use constitutes an eco-friendly approach to increase crop yields [1, 2]. However, apart from well-known plant‒microbe mutualistic symbioses, such as the interaction between rhizobia and legumes, the molecular dialogue between plants and many other plant growth-promoting (PGP) bacteria is not well understood [3–7].

Research on plant‒microbe interactions has typically focused on the plant response rather than on gene expression in its prokaryotic counterpart due to the low proportion of microbial RNA [3, 8]. As a consequence, research on the microbial contribution to plant promotion has usually focused on in vitro analysis of potential mechanisms, such as solubilization of phosphorous and production of siderophores, or only on the identification of plant growth promotion-related genes in genomes [9, 10]. As a consequence, the mechanisms by which PGP bacteria colonizing the plant root surface promote the growth of their host are not known. Considering that the colonization of the root surface is a key step in plant-bacteria interactions and the important processes that are assumed to occur therein (i.e.: provision of nutrients, production of phytohormones, defence against pathogens) [11], it is of utmost importance to gain a broader understanding of the mechanisms underlying the microbial processes occurring in this plant tissue. Indeed, this knowledge can be beneficial not only for understanding this kind of cross-kingdom interaction but also for developing more efficient biofertilizers [3].

Pseudomonas is a large genus comprising more than 300 species, many of which are commonly isolated from plant tissues and comprise both PGP and pathogenic species [12–14]. However, knowledge of the interactions of this genus with plants has mainly been derived from pathogenic Pseudomonas species (e.g., P. syringae) [15, 16], with a few beneficial mechanisms studied in a limited number of other species (e.g., P. fluorescens or P. protegens) [17–19]. In contrast, the ecology and interaction mechanisms of other species such as P. brassicacearum, which is a common plant growth-promoting symbiont [20, 21], remain poorly understood. To overcome this lack of knowledge, researchers are becoming to sequence the transcriptome of the symbiont within the plant tissue. For instance, an RNA-Seq analyses of the Pseudomonas ogarae F113 unveils the differential response of an AmrZ mutant to the plant environment in contrast to that of the wild type strain, finding that the target gene regulates the production of extracellular matrix [22].

To better understand the mechanisms implicated in the interaction of Pseudomonas with the plant root surface, we used transcriptomic (RNA-Seq) analysis of the rapeseed PGP bacterial strain Pseudomonas sp. CDVBN10 [20] in the rhizoplane of Brassica napus, searching for putative novel mechanisms in plant-bacteria interactions. Here, we provide a catalogue of bacterial genes and functions (I) overexpressed during the association with plant roots and (II) enriched in plant-isolated strains that should be considered relevant for plant-bacteria interactions. To validate our hypothesis, we selected one of the most highly overexpressed bacterial genes in the rhizoplane, the yafL gene, encoding a noncharacterized hydrolase of the NlpC/P60 family, and we analysed its function using reverse genetics.

Plant material and bacterial strain

In this study, we used a bacterial strain (‘Pseudomonas brassicacearum’ CDVBN10) isolated in a previous work from Brassica napus (rapeseed) roots [20]. To ensure its taxonomic assignment, we used dDDH calculations between the CDVBN10 genome and the genomes of the closest species detected by the TYGS server [23]. The dDDH was obtained directly from the TYGS results (formula 2). We used commercial B. napus cv. rescator seeds as a plant host.

Obtaining samples for RNA-Seq

We sterilized the surface of rapeseed seeds by washing with EtOH (70%) (2 min) followed by soaking in a 5% NaClO solution (10 min). Then, we washed the seeds 10 times with sterile water and placed them on agar‒water (2g L^− 1 of agar) Petri plates, which were stored at 28°C in darkness upon germination (48 h). Then, we placed 5 germinated plants per plate containing Hoagland agar medium (5 mL L^− 1 of 1 M Ca(NO₃)₂, 5 mL L^− 1 of 1 M KNO₃, 2 mL L^− 1 of 1 M MgSO₄, 1 mL L^− 1 FeEDTA solution (7.45 mg L^− 1 Na₂EDTA, 5.57 g L^− 1 FeSO₄) and 1 mL L^− 1 of a solution containing 2.86 g L^− 1 H₃BO₃, 1.81 g L^− 1 MnCl₂, 0.2 g L^− 1 ZnSO₄·7H₂O, 0.05 g L^− 1 CuSO₄·5H₂O and 25 mg L^− 1 Na₂MoO₄·2H₂O) [24]. We inoculated the plants with 0.2 mL of a suspension of the CDVBN10 strain in sterile water (absorbance: OD = 1; 600 nm) previously grown on TSA plates for 24 h (28°C). We kept the plants in a light chamber with mixed incandescent and fluorescent lighting (400 microeinsteins m^− 2 s^− 1; 400–700 nm) with a photoperiod of 16 h/8 h at 24/16°C (day/night) for 11 days. Then, we cut the roots and collected 20 roots per microtube (pooled sample), freezing them with liquid N₂. Then, we added 1 mL of Ringer solution (NaCl 2.25 g L^− 1, KCl 0.105, CaCl₂ 0.045 g L^− 1 and NaHCO₃ 0.05 g L^− 1) to each tube. To detach bacterial cells from the rhizoplane, we sonicated the samples (2 s ON, 1 s OFF, 10% amplitude) for 2 min. We centrifuged the samples for 10 min (14,000 rcf). We discarded the supernatant and stored the pellet at -80°C for further processing.

We prepared 3 different control treatments. These samples consisted of CDVBN10 cells (0.2 mL of the same inoculum than in the interaction samples) grown on Hoagland medium (+ 0,1% of a carbon source) on Petri plates in a light chamber dedicated for plant culture. We used glucose (3 days, and 6 days) and glycerol (3 days) as carbon source. Each of these 3 control conditions were treated separately. We pooled the biomass from 3 plates to prepare each of the three replicate samples from each control condition. We processed these samples with the protocol described above to avoid biases.

We extracted RNA from three replicate samples per condition. For this, we used the Quick-RNA Fungal/Bacterial Miniprep Kit (Zymo Research) according to the manufacturer's instructions. The amount of extracted RNA was measured by the Qubit High Sensitivity Assay Kit on a Qubit 2.0 Fluorometer (Thermo Fisher Scientific). We evaluated the quality and integrity of the RNA using a BioAnalyzer (Agilent). To enrich the mRNA, we carried out prokaryotic ribodepletion in all samples and eukaryotic ribodepletion in the interaction samples, in both cases with the Ribo-Zero Kit (Bacteria and Plant, respectively; Illumina). We converted the enriched mRNA to cDNA using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific), which was used to build a library with the TruSeq Stranded Total RNA Kit (Illumina). We sequenced this library on an NovaSeq 6 000 150PE (Illumina).

Sequencing and RNA-Seq analyses

We removed the adapter sequences with Trimmomatic (v0.39) [25], sequences shorter than 50 bp using Cutadapt [26], and those with a Phred score < 30 using FastX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/index.html). We mapped these sequences mapped with Bowtie2 (v2.3.5) [27] against the genome of the CDVBN10 strain (NCBI accession: GCA_013608025.1). We converted the resulting SAM files to BAM format and indexed with the Samtools program (v1.9) [28]. With these files, we performed a count of the reads per coding sequence (CDS) with FADU (v1.7) [29]. Then, we used the R package DESeq2 [30] to identify differentially expressed genes (DEGs). We used the adjusted p value (Bonferroni correction) throughout the manuscript. In the following sections we consider as significantly upregulated or downregulated genes to those genes found to have p < 0.05 in the DESeq2 comparison of interaction samples against each of the 3 control conditions. In the text we are providing the Log2FC and p values of the comparison with 3 days – glucose controls as an example, while all the values can be accessed in the supplementary data of this manuscript. To assign putative functions to the DEGs, we reannotated the genome/proteome of strain CDVBN10 with eggNOG-Mapper (v2) [31] RAST (v2.0) [32], antiSMASH (v5.1.2) [33], kofamKOALA [34], SignalP (v5.0) [35] and CELLO [36]. Methodological details, bioinformatic code and source data can be found in the GitHub repository created for this article (https://github.com/zakisaati/Unraveling-new-bacterial-functions-in-the-plant-rhizoplane).

We obtained 2 lists of COGs potentially involved in the plant-associated lifestyle from previous published comparative genomic analyses on the genus Pseudomonas [6, 20] and used them to screen our RNA-Seq results. We suggest that those plant-associated functions that were upregulated (in plants) in our transcriptomic data might play relevant roles in plant-bacteria interactions.

Generation of the Δ yafL mutant

We deleted the yafL gene to test whether it is involved in plant growth promotion. The CDS was named “fig|6666666.448518.peg.3527” in our custom annotations. The nucleotide and amino acid sequences can be found in Table S2. We performed the plasmid construction and transformation methods following the protocol described previously [37] with several modifications. The CRISPR/Cas9 system consisted of three plasmids: (I) pCAS-R2KT, which encodes the Cas9 protein; (II) pSEVA-dgRNAT, which is used to add the N20 target sequence; and (III) pSEVA-gRNAT-yafL, with the repairing homologous arms.

pSEVA-dgRNAT was derived from pSEVA-gRNAT by replacing and introducing the original N20 yafL sequence “GCCTTATCAGCTTCCAGTGC” into SacI/EcoRI-digested pSEVA-gRNAT. We used the primers Pseva1R and Pseva3F (Table S1) for amplification [5 µL of KOD Fx Buffer Toyobo® (Ltd., Osaka, Japan), 2 µL of dNTPs (2mM each), 0.3 µL of each primer (10 µM), 6 µL of miliQ sterile water. PCR cycling conditions: preheating at 95°C for 9 min, 11 cycles of denaturing: 95°C for 20 s; annealing at 51,5°C for 35 s and extension 68°C for 15 s, 24 cycles of denaturing: 95°C for 20 s; annealing at 54,5°C for 35 s and extension 68°C for 15 s with a final extension at 68°C for 10 mins and 16°C for 10 mins]. Next, we amplified the 1,000 bp fragments upstream and downstream of the yafL target gene using the primers PF-3/PF-4 and PR-3/PR-4 (Table S1) and these were connected via overlap-extension PCR [5 µL of KOD Fx Buffer Toyobo® (Ltd., Osaka, Japan), 2 µL of dNTPs (2mm each), 0.3 µL of each primer (10 µM), 6 µL of miliQ sterile water. PCR cycling conditions: preheating at 95°C for 9 min, 11 cycles of denaturing: 95°C for 20 s; annealing at 51°C for 35 s and extension 68°C for 1 minute, 24 cycles of denaturing: 95°C for 20 s; annealing at 55,5°C for 35 s and extension 68°C for 1 minute with a final extension at 68°C for 10 min and 16°C for 10 min]. Then, we inserted the homologous arm synthesized into SacI/BcuI-digested pSEVA-dgRNAT to generate pSEVA-gRNAT-yafL.

We transformed he plasmids pCAS-R2KT, pSEVA-dgRNAT and pSEVA-gRNAT-yafL into Pseudomonas sp. CDVBN10 by electroporation. We prepared the CDVBN10 electrocompetent cells as described elsewhere [38]. We cultivated the CDVBN10 strain overnight and then transferred it to a 100 mL flask containing 10 mL of Luria-Bertani (LB) medium until the cell density (OD₆₀₀) reached 0.6–0.8. After concentration, we prepared the electrocompetent cells by three washes with 3 mM HEPES buffer (Sigma) and we concentrated it to 500 µL. For electroporation, we transferred 100 µL of bacterial suspension and 150 ng of DNA to a 2 mm gap ice-cold electroporation cup. The settings for the Bio-Rad GenePulser II were as follows: 2.5 kV and 200 Ω. After electroporation, we added 1 mL of LB liquid medium and we mixed the sample. Then, we transferred the entire mixture into a 2.0 mL Eppendorf tube and cultivated it at 28°C for 2 h before spreading it on LB Petri plates. We checked the absence of the functional yafL gene in the CDVBN10∆yafL knockout mutant via PCR using the primers yafLKO-F/yafLKO-R [12,5 µL of REDEXtract-N-Amp PCR ReadyMix (Sigma, St Louis, MO, USA), 2.5 µL yafLKO-F (2 µM), 2.5 µL yafLKO-R (2 µM), 6 µL of miliQ sterile water and 2 µL of bacterial DNA (100 µg m L^–1) as the template. PCR cycling conditions: preheating at 95°C for 9 min, 35 cycles of denaturing at 94°C for 1 min; annealing at 52,5°C for 1 min and 10 s and extension 72°C for 2 min and 30 s with a final extension at 72°C for 7 min] and subsequent sequencing (Supplementary Table 1).

Greenhouse assay

We performed a greenhouse assay to test the differences in plant growth promotion performance between the wild-type (WT) CDVBN10 strain and the ∆yafL strain. We surface sterilized the rapeseed seeds were as detailed above. We placed two seeds in plots containing tyndallized vegetal soil and we irrigated the soil. We distributed 30 plots into two trays per treatment (WT, ∆yafL and uninoculated control), with 90 plants in total. Five days later, we checked the plots to preserve only one germinated plant per plot. Then, we inoculated 5 mL of the bacterial strain (WT or ∆yafL) into the plant surrounding area using a bacterial suspension as detailed in the previous section. We inoculated the control plants with 5 mL of sterile water. We removed the plants 40 days after germination and dried them at 60°C for 3 days. We measured the dry mass. We analysed the statistical differences among treatments in R using the ANOVA and TukeyHSD functions implemented in the stats package (v3.6.2) [39]. We analysed the soil as described previously [40].

Scanning electron microscopy (SEM) of the plant roots

To observe the CDVBN10 colonization process on the B. napus roots, we inoculated the plants as detailed above, and samples for SEM visualization were prepared 11 days post-inoculation (dpi). We cut pieces of roots (1 cm) and fixed them with 3% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.2) containing 5% saccharose and 2 mmol of CaCl₂ at 4°C over two days. We washed the fixed samples three times for 15 min on a rotator with the same cacodylate buffer. The samples were gently spun down for 5 min at 5 000 rpm (2 348 g) between each wash. After the final wash, we postfixed the samples with 1% OsO₄ in 0.1 M cacodylate buffer containing 5% saccharose and 2 mM CaCl₂ at 4°C overnight. We washed once the osmium-postfixed samples with the same cacodylate buffer and then three times with ddH₂O, washing for 15 min in each step. Then, we dehydrated the postfixed samples with an ethanol gradient (25%, 50%, 75%, 90%, 96%, 100% and 100%) and dried them using a “Porous specimen pot” (CPD800A, Quorum Technologies Ltd., Ringmer, UK) in a critical-point dryer (K850, Quorum Technologies Ltd., Ringmer, UK). We mounted each dried individual plant roots onto aluminium stubs with ultrasmooth carbon discs (SPI Supplies, Structure Probe, Inc., West Chester, PA, USA) and we sputter-coated them with 3 nm platinum in a high-resolution Turbo-Pumped Sputter Coater Q150T (Quorum Technologies Ltd, Ringmer, UK). We examined the final samples under an FEI Nova NanoSEM scanning electron microscope (FEI, Brno, Czech Republic) at 3 or 5 kV using an Everhart–Thornley detector (ETD), circular backscatter detector (CBS), and through-the-lens detector (TLD).

GFP-tagged strains and confocal microscopy

We performed the GFP labelling of the CDVBN10-WT and CDVBN10∆yafL strains as previously described [41] with modifications. Briefly, we used the E. coli S17.1 containing the plasmid pHC60 [42] as a donor strain. For this mating, we mixed fresh cultures of donor and recipient strains on tryptic soy agar (TSA) Petri plates supplemented with tetracycline (10 µg/mL) and then we incubated the mix overnight at 28°C. We selected transconjugants selected on minimal medium (MM) plates [43] with tetracycline (10 µg/mL). We routinely grown the recombinant strains at 28°C in TSA-tetracycline medium.

To compare the colonization processes of both GFP-tagged strains, we inoculated them as detailed above. We cut 3–4 cm of inoculated rapeseed roots at 11 dpi. We placed these pieces aseptically on slides with drops of sterile water. We added propidium iodide (10 µL, 10 µM) to the roots as a red stain for plant cells. We visualized the samples on a confocal microscope (LEICA TCS SP5) with dual-wavelength emission from an argon laser (488 nm for GFP and 617 nm for propidium iodide). We composed three-dimensional images from pictures taken at each micrometre along the Z axis of the sample.

Transcriptome of Pseudomonas sp. CDVBN10 during the colonization of rapeseed roots

As the model for this research, we used the CDVBN10 rapeseed endophyte. This strain showed PGP potential in vitro, in greenhouse and in field conditions. This strain is able to produce indole acetic acid, siderophores and cellulose and to solubilize phosphate [20]. The strain was previously identified as P. brassicacearum based on its 16S rRNA gene sequence. Here, the genome-based identification of the CDVBN10 strain shows that, despite its 16S closeness with P. brassicacearum [20], it does not belong to any described species (< 70% dDDH). We sequenced the transcriptome of Pseudomonas sp. CDVBN10 during rapeseed colonization to elucidate the ecological response of the bacterium to the plant host. First, we ensured an optimal colonization time by viewing cells attached to the roots. The scanning electron microscopy images confirmed that CDVBN10 displayed a robust colonization process and first steps of biofilm formation at 11 days post inoculation (dpi) (Fig. 1a, Figure S1). We managed to obtain high-quality RNA-Seq data for bacterial cells from the rhizoplane. The few existing studies with similar objectives showed limited recovery of bacterial sequences since plant and bacterial tissues were processed alongside each other [44–47]. In our study, due to the detachment of bacterial cells from plant roots, it was possible to map 93.5% of the reads of CDVBN10 cells interacting with rapeseed roots and 99% of the reads of control cells (Table 1). Hence, the proportion of transcripts belonging to root-associated Pseudomonas sp. cells obtained by detachment was considerably higher than those obtained previously [44–47]. These values show that our method can efficiently and selectively capture the specific transcriptome of host-associated cells (Fig. 1b).

Table 1

Summary of the results of RNA-Seq carried out on the transcriptome of the strain *Pseudomonas* sp. CDVBN10 colonizing rapeseed roots ("Interaction") and in pure culture ("Control").
Sample	Raw reads	Quality Filtered reads	Reads aligned exactly 1 time	Reads aligned > 1 time	Total Mapping (%)
3 days Glucose - Control 1	57,598,646	45,811,490	45,261,157	23,943	98.8
3 days Glucose - Control 2	55,920,670	43,579,824	43,247,449	23,193	99.3
3 days Glucose - Control 3	64,788,627	56,527,995	56,156,950	21,850	99.4
6 days Glucose - Control 1	64,627,698	56,189,966	55,802,754	56,203	99.4
6 days Glucose - Control 2	61,597,674	54,246,823	53,828,836	43,756	99.3
6 days Glucose - Control 3	86,001,366	72,795,554	72,233,499	43,398	99.3
3 days Glycerol - Control 1	85,504,966	78,414,576	77,849,951	99,543	99.4
3 days Glycerol - Control 2	85,671,174	78,942,981	78,401,388	137,417	99.5
3 days Glycerol - Control 3	81,326,964	65,423,920	64,746,695	219,284	99.3
Interaction 1	74,750,548	64,437,934	59,368,189	361,520	92.5
Interaction 2	73,711,066	62,336,661	58,083,451	560,947	94.1
Interaction 3	72,373,008	62,772,410	58,339,228	400,811	93.6

Differential expression analysis between control samples (free-living cells) and interaction samples (cells within the rhizoplane) yielded many DEGs (Table 2, Fig. 1b). Of the 5,768 CDSs in the Pseudomonas sp. CDVBN10 genome, 226 were differentially expressed with an adjusted p value less than 0.05 and an absolute Log2FC value higher than 2 (Table 2).

Table 2

Differentially expressed genes (DEGs) in *Pseudomonas* sp. CDVBN10 interacting with *B. napus* roots. The last two columns indicate the number of DEGs shared among the three comparisons.
	3 days - glucose		6 days - glucose		3 days - glycerol		Shared DEGs
Log2FC	p < 0.05	p < 0.01	p < 0.05	p < 0.01	p < 0.05	p < 0.01	p < 0.05	p < 0.01
> 2 (upregulated)	464	392	658	588	310	305	146	137
> 1 (upregulated)	1,092	824	1,285	1,049	1,041	995	490	383
<(-2) (downregulated)	309	302	431	417	423	419	80	78
<(-1) (downregulated)	976	853	1,001	888	1,081	1,050	348	295

Switch off chemotaxis and motility mechanisms at the rhizoplane

The processes of bacterial root colonization and biofilm formation are coordinated by the perception of chemical signals from the plant and neighboring bacterial cells [48, 49]. However, at the time the transcriptomics experiment was performed, the CDVBN10 strain should have already carried out these processes, since it is already established on the surface of the roots of B. napus. That means, that once the plant has been colonized, flagella and chemotaxis molecules are no longer required [50]. In this sense, there are two genes that encode proteins related to chemotaxis, MCP (Methyl-accepting chemotaxis protein), that are significantly downregulated (-4.1 and − 4.5 Log2FC; p = 9.6x10^− 29 and p = 3.4x10^− 100) (Table S2, Fig. 2).

In regards with motility, there are several genes involved in flagellar synthesis, fliC, fliD, fliF, fliG, fliM, fliN, which are downregulated in the CDVBN10 transcriptome in the interaction with the plant, as well as the sigma factor 28 (σ28, fliA) responsible for the activation of flagellar synthesis in Pseudomonas [51]. This is consistent with microscopy images in which P. brassicacearum CDVBN10 is seen forming microcolonies (early-medium step of biofilm development) on the roots. (Fig. 1, Supplementary Data). A previous transcriptional comparison of Pseudomonas ogarae mutants impaired in root colonization with its WT strain colonizing alfalfa also showed differential expression in motility (including flagellar assembly), MCP, and biofilm formation [22].

Energy metabolism and cellular respiration during the early biofilm stage at the root surface

Our results have provided a complex picture of the interaction of Pseudomonas sp. CDVBN10 during the early formation of biofilms on rapeseed roots. Biofilms are usually characterized by hypoxic conditions in which the bacterial extracellular matrix decreases oxygen flow [44, 52]. However, we observed overexpression of oxygen-dependent respiratory pathways, which indicates that bacterial cells are still forming an immature biofilm matrix (microcolonies) with sufficient oxygen concentrations. Hence, increased oxygenic respiration would lead to enhanced energy generation. Some of the genes encoding enzymes in the electron transport chain were overexpressed during the interaction with the plant, such as the cyoABCD operon (encoding cytochrome bo oxidase) (1.3–6.8 Log2FC; p = 5.8×10^− 3-2.3×10^− 27). Previous research suggest that this operon is only expressed under high oxygen concentrations [53]. In contrast, other works shows that this cytochrome is essential for the adaptation and growth of Rhizobium etli CFN42 under low oxygen concentrations during its symbiosis with Phaseolus vulgaris [54], and that this operon is overexpressed in microaerophilic conditions as well as at low pH [55]. Consistent with our observation, previous reports indicate how a strain of Burkholderia also overexpresses cytochromes in the rhizosphere of sugarcane [54]. In addition to the cyoABCD operon, the sdhC gene (encoding succinate dehydrogenase) was also upregulated (2.6 Log2FC; p = 2.3×10^− 11). This enzyme is a part of the tricarboxylic acid (TCA) cycle or Krebs cycle, which continues with the cellular respiration of glucose and has an impact on many cellular metabolic processes (oxidative metabolism of carbohydrates, lipids, proteins). Once glucose is metabolized to pyruvate via glycolysis, it is oxidized to CO₂ through the TCA cycle. A key step in this process is the condensation of oxaloacetate and acetyl coenzyme A to produce citrate through citrate synthase (EC:2.3.3.1) [56], the gene encoding which (gltA) is highly expressed in Pseudomonas sp. CDVBN10 during the interaction with the plant (significatively overexpressed in the comparison with 3 days – glycerol and 6 days – glucose controls). Overall, the overexpressed genes in these pathways and others also related to energy metabolism indicate that rapeseed roots represent a favourable environment for this strain, enabling efficient energy generation. Our data suggest that the strain CDVBN10 exhibited high energetic metabolism during the association with B. napus roots (Table S2 Fig. 2).

Influence of mutualistic interaction on the nutrient cycles

Exudates from plant roots are an important source of nutrients that bacteria can use [57]. In return, plants can also benefit from the metabolism of beneficial bacteria attached to the root, which can, for instance, provide the plant with nutrients [58, 59]. Here, we show that Pseudomonas sp. CDVBN10 overexpresses different genes related to phosphate metabolism in rapeseed roots, including those encoding the synthesis of an enzyme with inorganic triphosphatase activity (EC 3.6.1.25; 0.8 Log2FC; p = 4.6×10^− 2), an inorganic pyrophosphatase (ppa; EC 3.6.1.1; 2.0 Log2FC; p = 3.6×10^− 6), and a pyrroloquinoline quinone (PQQ)-dependent glucose dehydrogenase (gdc; 1.7 Log2FC; p = 1.4×10^− 3; not significative against the glycerol control). The activities of all these enzymes could enhance phosphate availability for the plant [60, 61]. For potassium transport, the genes kefA (1.5 Log2FC; p = 2.5×10^− 5) and kefF (2.1 Log2FC; p = 1.8×10^− 2), involved in the synthesis of a potassium pump and its regulator [62], respectively, are just significantly overexpressed in the comparison against 3 days – glucose control samples. In contrast, there was no differential expression of the pstSABC and phnCDE genes, which synthesize phosphate transporters and phosphonates, respectively, of the kup and kdp genes, which are involved in the synthesis of potassium transporters. Furthermore, siderophore production was upregulated (see the ‘Secondary metabolism and defence systems’ section); these molecules can facilitate iron uptake by the plant [63] (Table S2, Fig. 2).

Bacteria can activate different adaptive mechanisms in response to conditions with low nutrient availability. For example, the CstA protein is produced in these circumstances [64]. Here, we found that cstA was downregulated in the cells of Pseudomonas sp. CDVBN10 living on the roots (-1.1 Log2FC; p = 3.8×10^− 7). Similarly, the synthesis of polyhydroxyalkanoates (PHAs), which are polyesters produced as carbon and energy reserve substances [65, 66], was also significantly downregulated (Table S2, Fig. 2) [67–69]. These results indicate that the rhizoplane constitutes an environment rich in nutrients for the bacteria.

Our RNA-Seq data indicate that Pseudomonas sp. CDVBN10 uses various sources of carbon and other nutrients from roots or root exudates. A relevant proportion of the nutrients released by plant roots are complex carbohydrates, usually broken down by carbohydrate-active enzymes (CAZys) [70]. Here, CDVBN10 on plant roots overexpressed a lytic polysaccharide monooxygenase (AA10) (2.6 Log2FC; p = 4.1×10^− 5) with a role in the degradation of either cellulose or chitin [71]. (Table S2, Fig. 2). The hydrolysis of these biomolecules can be useful for the bacterium, not only for nutrition but also to enhance bacterial entry into the roots in a later interaction stage [72].

Secondary metabolism and defence systems

The root environment is usually a confluence point for many microorganisms that are attracted to root exudates. Therefore, microorganisms have to compete with others for plant resources to thrive in this niche [73]. An effective strategy in this competition is the production of secondary metabolites with antimicrobial action, but there are few reports on whether bacteria express these metabolites when associated with a plant host [74, 75]. In this context, strain CDVBN10 overexpresses different types of biosynthetic gene clusters (BGCs) that could be related to the production of antimicrobial molecules, such as a type II lanthipeptide, a ribosomally synthesized and posttranslationally modified peptide (RiPP) and several genes included in nonribosomal peptide synthetases (NRPSs) BGCs, including a BGC that seems to be involved in the synthesis of pyoverdine. In fact, the pvdS gene is also overexpressed compared with both 3 days control treatments (2.7 Log2FC; p = 1.2×10^− 2); this gene is a global regulator of the synthesis of pyoverdine, a siderophore with functions in microbial competition [76]. The hcnABC operon, responsible for the production of hydrogen cyanide (HCN), a volatile metabolite that also has antimicrobial actions [77], is negligibly expressed in the CBDVBN10 strain during its interaction with rapeseed roots (Table S2, Fig. 2). Large amounts of HCN can be toxic to plants [78]. Thus, the maintenance of safe low levels of HCN could be a regulatory mechanism for plant metabolism [78, 79].

Another mechanism of competition between different microbial cells is mediated by the injection of harmful molecules into competitor cells through type VI secretion systems (T6SSs) [80]. There exist negative regulators of the synthesis of such systems, such as RsmA [81]. Since the gene encoding this posttranscriptional regulator was downregulated in our interaction-related transcriptomes (-3.3 Log2FC; p = 3.3×10^− 11), the synthesis of the T6SSs was less strongly repressed on the root surface, leading to enhanced production of T6SSs (Table S2, Fig. 2). Furthermore, microorganisms need to resist toxic molecules produced by their competitors [82, 83]. The CDVBN10 strain in association with roots could be prepared for external threats, since, compared to 3 days control treatments, it overexpressed two genes similar to those that synthesize an immunity protein that acts against colicin (creD, 4.2 Log2FC; p = 4.8×10^− 3) and another one acting against the bactericidal peptide MccB17 (McbE, 4.2 Log2FC; p = 4.2×10^− 3) (Table S2, Fig. 2).. Although our interaction system lacked external competitors, the activation of these two mechanisms may indicate that our PGP strain was prepared for competition with other rhizospheric inhabitants and resistance against the bacteriocins produced by them.

Pseudomonas sp. CDVBN10 upregulates the synthesis of molecules responsible for the induced systemic resistance (ISR) in plants

Bacterial microbe-associated molecular patterns (MAMPs) trigger responses in the immune system of plants. Some examples of MAMPs are lipopolysaccharides (LPSs) and the elongation factor Tu (ef-Tu) [84]. The lpxABCDHL genes, involved in the synthesis of LPS, were highly expressed in the interaction, although only lpxC (UDP-3-O-(R-3-hydroxymyristoyl)-N-acetylglucosamine deacetylase), which is essential for the synthesis of lipid A from LPS [85], was significantly overexpressed. The elongation factor Tu and elongation factor thermo-stable (EF-Ts) were also upregulated (1.7 Log2FC; p = 4.8×10^− 6; 0.98 Log2FC; p = 6.5×10^− 3) (Table S2, Fig. 2). Beyond MAMPs, CDVBN10 also upregulated the synthesis of plant hormones related to ISR, such as salicylate (see next section). In summary, our data suggest that the plant may receive signals to activate its immune system, which may help with future pathogen invasions.

Pseudomonas sp. CDVBN10 activates the synthesis of plant hormones in the rhizoplane

Bacteria can produce hormones that control many physiological processes in plants. The strain Pseudomonas sp. CDVBN10 has the acdS gene, which encodes 1-aminocyclopropane-1-carboxylate (ACC)-deaminase, whose action decreases ethylene and increases ammonia levels. Ethylene is a phytohormone that regulates plant development, senescence and stress responses [86, 87]. However, despite this gene being activated during the interaction, the expression levels were low, and the gene was not differentially expressed from the control (Table S2, Fig. 2).

Polyamines are polycationic molecules that also act as plant hormones. One of the main polyamines in nature is putrescine [88]. It has been demonstrated that putrescine promotes bacterial biofilm formation [89] and regulates multiple physiological functions in plants [88]. Here, the speB gene (agmatinase, which produces putrescine from agmatine) of Pseudomonas sp. CDVBN10, is upregulated in the plant (2.6 Log2FC; p = 1.0×10^− 10). Similarly, an arginine decarboxylase, an ornithine carbamoyltransferase and an argininosuccinate synthase, enzymes related to arginine metabolism that create intermediate metabolites in the putrescine synthetic pathway, were also upregulated (Table S2, Fig. 2).

Adaptation to adverse factors and stresses in the plant-bacterium interaction environment

Plant-associated bacteria must be able to resist the defence molecules produced by the plant. Specifically, plants can produce reactive oxygen species (ROS) in response to microorganisms [90]. Pseudomonas sp. CDVBN10 on plant roots showed the upregulation of several genes that can mediate ROS resistance, such as genes encoding organic hydroperoxide reductases (ohr; 4.9 Log2FC; p = 2.0×10^− 11) and alkyl hydroperoxide reductase (ahpC; 4.6 Log2FC; p = 5.9×10^− 5; ahpF; 2.7 Log2FC; p = 2.5×10^− 2) [91]. Similarly, it overexpressed the periplasmic stress response protein CpxP (cpxP; 8.7 Log2FC; p = 5.3×10^− 52), which also helps to ameliorate stress [92]. A plant-inducible nitrilase is also overexpressed in the interaction with the plant (4.4 Log2FC; p = 1.2×10^− 25). The bacterium may increase its synthesis of this enzyme to break down β-cyano-L-alanine, a molecule that is toxic to microorganisms at high levels and the hydrolysis of which serves as an additional source of nitrogen for the bacterium [93] (Table S2, Fig. 2).

Some plant defence molecules are antimicrobial compounds, and mechanisms of resistance to these biocide molecules produced by plants include the use of channels or extrusion pumps [94], which are often able to act on various substrates. The strain CDVBN10 on plant roots upregulated an mdtABC transporter and the MexA and MexB components of MexAB-OprM in rapeseed roots (Table S2, Fig. 2). Both are multidrug efflux systems of the resistance-nodulation-cell division (RND) family with wide substrate specificity that may help in the secretion of antimicrobial molecules by plants [95]. This system is activated in the presence of flavonoids and has been demonstrated to play a role in epiphytic colonization by a pathogenic Pseudomonas strain [95, 96].

Decoding new bacterial functions in the plant environment.

Upregulation of a gene in the plant environment indicates a likelihood of the gene being related to plant-bacteria interactions. Here, we found 421 upregulated genes (Log2FC > 1; p < 0.05 in the three comparisons), but for many of them, the role in this interaction has never been reported. However, the overexpression of a certain gene can also occur due to less specific factors (e.g.: the presence of molecules that are ubiquitous in nature) and could not be related to any specific interaction with the host. Hence, to determine the biological relevance of these findings, we compared the CDVBN10 functions—based on COGs—with those found to be strongly associated with plant interactions based on the comparative genomic studies published previously [4, 20] (Table S2). Of these functions found to be associated with plants in both studies, 78 belonged to genes that were also upregulated (Log2FC > 1; p < 0.05) in our RNA-Seq analyses of the plant rhizoplane, and 73 to genes downregulated (Log2FC < (-1); p < 0.05) (Table S2; Fig. 3). When setting the differential expression to ± 2, just 20 and 19 genes of those associated with plants were found to be up- and down-regulated, respectively. The majority of these upregulated functions belonged to the COG category “Function unknown”, followed by categories related to the metabolism of amino acids and ions (Table S2). Interestingly, those genes found to be downregulated comprise many related with cell motility. This means that, although these genes (COGs) may be required for plant-bacteria interactions, as they were annotated as plant-associated COGs (Table S2), they are no longer used in the current colonization step. We also searched for COG pathways rather than categories within our set of genes, and we did not find any with complete pathway being both upregulated and covered by plant-associated COGs (Table S2). Considering the biological significance of the upregulation on the plant root surface plus the observed association with plant interactions in genomic studies, we hypothesize that these genes may have relevant roles in plant-bacteria interactions.

An upregulated cysteine-peptidase of the NlpC/P60 family is essential in the interaction of Pseudomonas sp. with B. napus.

To validate our hypothesis, we selected one of those 184 upregulated genes that, based on comparative genomic studies, was found to be significantly associated with strains inhabiting plants for further research on its role as a plant growth promotion trait. Specifically, we selected a gene with high similarity to the yafL gene (interaction vs 3 days glucose control: 2.1 Log2FC, p = 9.9×10^− 7; interaction vs 6 days glucose control: 3.9 Log2FC, p = 1.6×10^− 5; interaction vs 3 days glycerol control: 3.7 Log2FC, p = 4.7×10^− 44) (Table S2, Fig. 4). The annotation of this gene allowed us to determine that the encoded enzyme is a cysteine peptidase with a hydrolytic domain of the NlpC/P60 family and that, based on its physicochemical characteristics and the presence of a signal peptide, it may be located in the outer cell membrane or secreted from the cell. NlpC/P60 hydrolases show a wide range of activities, acting as peptidases, amidases, transglutaminases and acetyltransferases over a varied range of substrates, such as murein [97]. However, these enzymes are not very well characterized, and the annotations and comparative searches of these proteins in public databases do not allow us to identify the substrates of these enzymes with certainty. Because of its localization, it is possible that its substrate is a murein component. It has been demonstrated that the inoculation of peptidoglycans or muropeptides, which are small fragments of peptidoglycan, activates defence responses in plants [98]. It has also been reported that the presence of this enzyme in Enterococcus faecalis and Salmonella sp. is responsible for triggering immune pathways in humans [99] and Caenorhabditis elegans [100], respectively. It has been recently published an RNA-Seq analyses of Pseudomonas ogarae (a species phylogenetically close to CDVBN10 strain) from the alfalfa rhizosphere [22]; we inspected their raw analyses and found that a homologue of yafL is also overexpressed within the plant environment (personal communication). Considering the mentioned roles for this protein in other host-microbe interactions, its upregulation in our data and previous reports, and its high degree of association with plant-associated Pseudomonas, we aimed to explore the role of this hydrolytic enzyme in the interaction of Pseudomonas sp. CDVBN10 with B. napus.

We carried out a greenhouse assay with both the mutant and the WT strains on B. napus. The soil properties are presented in the Supplementary Data. At forty-three dpi, we found significant differences in the dry mass of plants (p = 9.7×10^− 3) inoculated with CDVBN10 or its ΔyafL strain and control plants with no inoculation (Fig. 4). Plants inoculated with the ΔyafL strain exhibited slower growth than those inoculated with the WT strain and did not show significant differences from uninoculated plants.

To determine whether the decrease in rapeseed growth promotion by the ΔyafL strain was due to decreased root colonization, we labelled the WT and mutant strains with GFP and performed a colonization assay to visualize the roots by confocal microscopy. The results of this assay indicated that the mutant ΔyafL was still capable of colonizing rapeseed roots at both 11 dpi and 29 dpi, with no apparent qualitative changes relative the colonization behaviour of the WT strain (Fig. 5). Considering the abovementioned results, we report for the first time that the yafL gene and its encoded cysteine peptidase (NlpC/P60 hydrolase family) contribute to the PGP capability of Pseudomonas sp. CDVBN10 and are thus involved in plant-bacteria interactions.

Our results provide a deeper understanding of the metabolic and molecular mechanisms underlying the beneficial interaction between Pseudomonas sp. CDVBN10 and B. napus. We found several DEGs with potential roles in plant growth promotion or bacterial adaptation to the lifestyle of the plant environment. The data demonstrate that the bacterium modify drastically its behaviour within the plant tissue. For instance, it activates the intake of carbohydrates and shows an optimal fitness, as concluded by the high expression on genes related with energy obtention. Also, the transcriptome shows a defenced state of the bacterial strain at the roots, by activating pumps to extrude xenobiotics and inactivating ROS molecules. Conversely, we suggest that the bacterial MAMPs may be eliciting the ISR responses, with potential priming effects against pathogens. Additionally, many of the detected DEGs encoded hypothetical proteins or proteins that have never been associated with this type of microbe-host interaction. Our screening of these upregulated genes towards plant-associated functions allows to find tens of genes with potential strong effects on plant-bacteria interactions. For one of the DEGs, the yafL gene, involvement in plant growth promotion was confirmed.

Ethics approval and Consent to participate: Not applicable.

Consent for publication: Not applicable.

Availability of data and materials: All raw sequences obtained in this RNA-Seq analysis are deposited at the NCBI Sequence Read Archive (SRA) database under the Bioproject PRJNA887938.

Bioinformatic codes and source data can be found in the GitHub repository created for this article https://github.com/zakisaati/Unraveling-new-bacterial-functions-in-the-plant-rhizoplane.

Funding: This research was funded by EUROPEAN UNION’S HORIZON 2020 research and innovation programme, grant number 750795. We also acknowledge the funds received by the Regional Government of Castilla y León, Escalera de Excelencia CLU-2018-04, co-funded by the P.O. FEDER of Castilla y León 2014–2020. ZSS received a grant cofinanced by the European NextGenerationEU, Spanish “Plan de Recuperación, Transformación y Resiliencia,” Spanish Ministry of Universities and the University of Salamanca (“Ayudas para la recualificación del sistema universitario español 2021-2022””). AJG received a FPU predoctoral fellowship from the Central Spanish Government.

Acknowledgements: The authors gratefully acknowledge the access to the electron microscopy facility of IMIC, maintained with institutional support RVO 6138897.

Competing Interests: The authors declare that they have no competing interests.

Authors' contributions: Conceptualization: Z.S-S., and P.G-F. Data curation: Z.S-S. and P.G-F Formal analysis: Z.S-S. Funding acquisition: P.G-F. Investigation: Z.S-S, L.I.G-D, A.J-D, V.T.,L.Q. Methodology: Z.S-S, D.M., Y.S, P.G-F Project administration: P.G-F. Resources: P.G-F. Software: Z.S-S. Supervision: P.G-F. Visualization: Z.S-S and L.I.G-D. Writing - original draft: Z.S-S. Writing - review and editing: V.T., R.R., P.B., P.G-F.

French E, Kaplan I, Iyer-Pascuzzi A, Nakatsu CH, Enders L. Emerging strategies for precision microbiome management in diverse agroecosystems. Nat. Plants, 2021;7(3):256-267.
Chen QL, Hu HW, He ZY, Cui L, Zhu YG, He JZ. Potential of indigenous crop microbiomes for sustainable agriculture. Nat. Food, 2021; 2(4), 233-240.
Levy A, Conway JM, Dangl JL; Woyke T. Elucidating bacterial gene functions in the plant microbiome. Cell Host Microbe, 2018; 24(4), 475-485.
Levy A, Salas Gonzalez I, Mittelviefhaus M, Clingenpeel S, Herrera Paredes S, Miao J, et al. Genomic features of bacterial adaptation to plants. Nat. Genet, 2018; 50(1), 138-150.
Han Q, Ma Q, Chen Y, Tian B, Xu L, Bai Y, et al. Variation in rhizosphere microbial communities and its association with the symbiotic efficiency of rhizobia in soybean. ISME J, 2020; 14(8), 1915-1928.
Jarzyniak K, Banasiak J, Jamruszka T, Pawela A, Di Donato M, Novák O, et al. Early stages of legume–rhizobia symbiosis are controlled by ABCG-mediated transport of active cytokinins. Nat. Plants, 2021; 7(4), 428-436.
Anthony MA, Crowther TW, van der Linde S, Suz LM, Bidartondo MI, Cox F, et al. Forest tree growth is linked to mycorrhizal fungal composition and function across Europe. ISME J, 2022; 16(5), 1327-1336.
Thomas J, Kim HR, Rahmatallah Y, Wiggins G, Yang Q, Singh R, et al. RNA-seq reveals differentially expressed genes in rice (Oryza sativa) roots during interactions with plant-growth promoting bacteria, Azospirillum brasilense. PLoS One, 2019; 14(5), e0217309.
Higdon SM., Pozzo T, Tibbett EJ, Chiu C, Jeannotte R, Weimer BC, et al. Diazotrophic bacteria from maize exhibit multifaceted plant growth promotion traits in multiple hosts. PloS One, 2020; 15(9), e0239081.
Dubey A, Kumar A, Malla MA, Chowdhary K, Singh G, Ravikanth G, et al. Approaches for the amelioration of adverse effects of drought stress on crop plants. Front. Biosci., 2021; 26(10), 928-947.
Knights HE, Jorrin B, Haskett TL, Poole PS. Deciphering bacterial mechanisms of root colonization. Environ. Microbiol. Rep. 2021; 13(4), 428-444.
Shalev O, Ashkenazy H, Neumann M, Weigel D. Commensal Pseudomonas protect Arabidopsis thaliana from a coexisting pathogen via multiple lineage-dependent mechanisms. ISME J, 2022; 16(5), 1235-1244.
Saati-Santamaría Z, Baroncelli R, Rivas R, García-Fraile P. Comparative Genomics of the Genus Pseudomonas Reveals Host-and Environment-Specific Evolution. Microbiol. Spectr., 2022; e02370-22.
Saati-Santamaría Z, Peral-Aranega E, Velázquez E, Rivas R, García-Fraile P. Phylogenomic analyses of the genus Pseudomonas lead to the rearrangement of several species and the definition of new genera. Biol., 2021; 10(8), 782.
Xin XF, Kvitko B, He SY. Pseudomonas syringae: what it takes to be a pathogen. Nat. Rev. Microbiol., 2018; 16(5), 316-328.
Fan L, Wang T, Hua C, Sun W, Li X, Grunwald L, et al. A compendium of DNA-binding specificities of transcription factors in Pseudomonas syringae. Nat. Commun., 2020; 11(1), 4947.
Tan J, Kerstetter JE, Turcotte MM. Eco-evolutionary interaction between microbiome presence and rapid biofilm evolution determines plant host fitness. Nat. Ecol. Evol, 2021; 5(5), 670-676.
Großkinsky DK, Tafner R, Moreno MV, Stenglein SA, García de Salamone IE, Nelson LM, et al. Cytokinin production by Pseudomonas fluorescens G20-18 determines biocontrol activity against Pseudomonas syringae in Arabidopsis. Sci. Rep., 2016; 6(1), 23310.
Vacheron J, Péchy-Tarr M, Brochet S, Heiman CM, Stojiljkovic M, Maurhofer M, et al. T6SS contributes to gut microbiome invasion and killing of an herbivorous pest insect by plant-beneficial Pseudomonas protegens. ISME J, 2019; 13(5), 1318-1329
Jiménez-Gómez A, Saati-Santamaría Z, Kostovcik M, Rivas R, Velázquez E, Mateos PF, et al. Selection of the root endophyte Pseudomonas brassicacearum CDVBN10 as plant growth promoter for Brassica napus L. crops. Agronomy, 2020; 10(11), 1788.

Zhou T, Chen D, Li C, Sun Q, Li L, Liu F, et al. Isolation and characterization of Pseudomonas brassicacearum J12 as an antagonist against Ralstonia solanacearum and identification of its antimicrobial components. Res., 2012; 167(7), 388-394.
Blanco-Romero E, Durán D, Garrido-Sanz D, Rivilla R, Martín M, Redondo-Nieto M. Transcriptomic analysis of Pseudomonas ogarae F113 reveals the antagonistic roles of AmrZ and FleQ during rhizosphere adaption. Genom., 2022; 8(1), 000750.
Meier-Kolthoff JP, Göker M. . TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat. commun. 2019; 10(1), 2182.

Hoagland DR, Arnon DI. The water-culture method for growing plants without soil. Circ. - Calif. Agric. Exp. Stn, 1950; 347(2nd edit).
Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics, 2014; 30(15), 2114-2120

Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J., 2011; 17(1), 10-12.

Langmead B, Salzberg SL. (2012). Fast gapped-read alignment with Bowtie 2. Nat. Methods, 2012; 9(4), 357-359.
Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The sequence alignment/map format and SAMtools. Bioinformatics, 2009; 25(16), 2078-2079.

Chung M, Adkins RS, Mattick JS, Bradwell KR, Shetty AC, Sadzewicz L, et al. FADU: a quantification tool for prokaryotic transcriptomic analyses. mSystems, 2021; 6(1), e00917-20.
Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome boil., 2014; 15(12), 550.
Cantalapiedra CP, Hernández-Plaza A, Letunic I, Bork P, Huerta-Cepas J. eggNOG-mapper v2: functional annotation, orthology assignments, and domain prediction at the metagenomic scale. Biol. Evol., 2021; 38(12), 5825-5829.
Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, et al. The RAST Server: rapid annotations using subsystems technology. BMC genom., 2008; 9(1), 75.
Blin K, Shaw S, Steinke K, Villebro R, Ziemert N, Lee SY, et al. antiSMASH 5.0: updates to the secondary metabolite genome mining pipeline. Nucleic Acids Res, 2019; 47(W1), W81-W87.
Aramaki T, Blanc-Mathieu R, Endo H, Ohkubo K, Kanehisa M, Goto S, et al. KofamKOALA: KEGG ortholog assignment based on profile HMM and adaptive score threshold. Bioinformatics, 2020; 36(7), 2251-2252.
Armenteros JA, Tsirigos KD, Sønderby CK, Petersen TN, Winther O, Brunak S, et al. SignalP 5.0 improves signal peptide predictions using deep neural networks. Biotechnol., 2019; 37(4), 420-423.

Yu CS, Lin CJ, Hwan, JK. Predicting subcellular localization of proteins for Gram‐negative bacteria by support vector machines based on n‐peptide compositions. Protein Sci., 2004; 13(5), 1402-1406.

Sun J, Wang Q, Jiang Y, Wen Z, Yang L, Wu J, et al. Genome editing and transcriptional repression in Pseudomonas putida KT2440 via the type II CRISPR system. Cell Factories, 2018; 17, 41.
Luo X, Yang Y, Ling W, Zhuang H, Li Q, Shang G. Pseudomonas putida KT2440 markerless gene deletion using a combination of λ Red recombineering and Cre/loxP site-specific recombination. FEMS Microbiol. Lett., 2016; 363(4).
R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-07-0, 2012; URL http://www.R-project.org/
Camarero JJ, Colangelo M, Gazol A, Pizarro M, Valeriano C, Igual JM. Effects of Windthrows on Forest Cover, Tree Growth and Soil Characteristics in Drought-Prone Pine Plantations. Forests, 2021; 12(7), 817.
García-Fraile P, Carro L, Robledo M, Ramírez-Bahena MH, Flores-Félix JD, Fernández MT, et al. Rhizobium promotes non-legumes growth and quality in several production steps: Towards a biofertilization of edible raw vegetables healthy for humans. PLoS ONE, 2012; 7(5), e38122.
Cheng HP, Walker GC. Succinoglycan is required for initiation and elongation of infection threads during nodulation of alfalfa by Rhizobium meliloti. J. Bacteriol.,1998; 180(19), 5183-5191.
Beringer JE. R factor transfer in Rhizobium leguminosarum. Gen. Microbiol., 1974; 84(1), 188–198.

Paungfoo-Lonhienne C, Lonhienne TG, Yeoh YK, Donose BC, Webb RI, Parson J, et al. Crosstalk between sugarcane and a plant-growth promoting Burkholderia species. Sci. Rep., 2016; 6(1), 37389.
Pankievicz VCS, Camilios-Neto D, Bonato P, Balsanelli E, Tadra-Sfeir MZ, Faoro H, et al. RNA-seq transcriptional profiling of Herbaspirillum seropedicae colonizing wheat (Triticum aestivum) roots. Plant Mol. Biol., 2016; 90(6), 589-603.

Balsanelli E, Tadra-Sfeir MZ, Faoro H, Pankievicz VC, de Baura VA, Pedrosa FO, et al. Molecular adaptations of Herbaspirillum seropedicae during colonization of the maize rhizosphere. Microbiol., 2015; 18(8), 2343-2356.

Nobori T, Velásquez AC, Wu J, Kvitko BH, Kremer JM, Wang Y, et al. Transcriptome landscape of a bacterial pathogen under plant immunity. Proc. Natl. Acad. Sci., 2018; 115(13), E3055-E3064.
Wiesmann CL, Wang NR, Zhang Y, Liu Z, Haney CH. Origins of symbiosis: shared mechanisms underlying microbial pathogenesis, commensalism and mutualism of plants and animals. FEMS Microbiol. Rev.. 2022, fuac048.
Feng H, Zhang N, Fu R, Liu Y, Krell T, Du W, et al. Recognition of dominant attractants by key chemoreceptors mediates recruitment of plant growth‐promoting rhizobacteria. Environ. Microbiol. 2019; 21(1), 402-415.
Yost CK, Del Bel KL, Quandt J, Hynes MF. Rhizobium leguminosarum methyl-accepting chemotaxis protein genes are down-regulated in the pea nodule. Arch. Microbiol. 2004; 182, 505-513
Lo YL, Chen CL, Shen L, Chen YC, Wang YH, Lee CC, et al. Characterization of the role of global regulator FliA in the pathophysiology of Pseudomonas aeruginosa infection. Res. Microbiol. 2018; 169(3), 135-144.

Schiessl KT, Hu F, Jo J, Nazia SZ, Wang B, Price-Whelan A, et al. Phenazine production promotes antibiotic tolerance and metabolic heterogeneity in Pseudomonas aeruginosa Nat. Commun., 2019; 10(1), 762.
Cotter PA, Chepuri V, Gennis RB, Gunsalus RP. Cytochrome o (cyoABCDE) and d (cydAB) oxidase gene expression in Escherichia coli is regulated by oxygen, pH, and the fnr gene product. Bacteriol., 1991; 172(11), 6333-6338.
Lunak ZR, Noel KD. A quinol oxidase, encoded by cyoABCD, is utilized to adapt to lower O2 concentrations in Rhizobium etli Microbiology, 2015; 161(Pt 1), 203.
Lunak, ZR, Noel, KD. Quinol oxidase encoded by cyoABCD in Rhizobium etli CFN42 is regulated by ActSR and is crucial for growth at low pH or low iron conditions. Microbiology, 2015; 161(Pt 9), 1806.

Su YB, Peng B, Li H, Cheng ZX, Zhang TT, Zhu JX, et al. Pyruvate cycle increases aminoglycoside efficacy and provides respiratory energy in bacteria. Proc. Natl. Acad. Sci., 2018; 115(7), E1578-E1587.
Zhao M, Zhao J, Yuan J, Hale L, Wen T, Huang Q, et al. Root exudates drive soil‐microbe‐nutrient feedbacks in response to plant growth. Plant Cell Environ., 2021; 44(2), 613-628

Haskett TL, Tkacz A, Poole PS. Engineering rhizobacteria for sustainable agriculture. ISME J, 2011; 15(4), 949-964.
Menendez E, Garcia-Fraile P. Plant probiotic bacteria: solutions to feed the world. AIMS Microbiol., 2017; 3(3), 502.

An R, Moe LA. Regulation of pyrroloquinoline quinone-dependent glucose dehydrogenase activity in the model rhizosphere-dwelling bacterium Pseudomonas putida KT2440. Appl. Environ. Microbiol., 2016; 82(16), 4955-4964.
Khourchi S, Elhaissoufi W, Loum M, Ibnyasser A, Haddine M, Ghani R, et al. Phosphate solubilizing bacteria can significantly contribute to enhance P availability from polyphosphates and their use efficiency in wheat. Microbiol. Res., 2022; 262, 127094.
Newman MM, Lorenz N, Hoilett N, Lee NR, Dick RP, Liles MR, et al. Changes in rhizosphere bacterial gene expression following glyphosate treatment. Sci. Total Environ., 2016; 553, 32-41.
Hermenau R, Ishida K, Gama S, Hoffmann B, Pfeifer-Leeg M, Plass W, et al. Gramibactin is a bacterial siderophore with a diazeniumdiolate ligand system. Nat. Chem. Biol, 2018; 14(9), 841-843.
Matin A. The molecular basis of carbon‐starvation‐induced general resistance in Escherichia coli. Mol. Microbiol., 1991; 5(1), 3-10.
Villanueva L, Del Campo J, Guerrero R. Diversity and physiology of polyhydroxyalkanoate-producing and-degrading strains in microbial mats. FEMS Microbiol. Ecol., 2010; 74(1), 42-54.
Wong HL, White RA, Visscher PT, Charlesworth JC, Vázquez-Campos X, Burns, BP. Disentangling the drivers of functional complexity at the metagenomic level in Shark Bay microbial mat microbiomes. ISME J, 2018; 12(11), 2619-2639.

Schultz JE, Matin A. Molecular and functional characterization of a carbon starvation gene of Escherichia coli. Mol. Biol., 1991; 218(1), 129-140.
Dubey AK, Baker CS, Suzuki K, Jones AD, Pandit P, Romeo T, et al. CsrA regulates translation of the Escherichia coli carbon starvation gene, cstA, by blocking ribosome access to the cstA transcript. J. Bacteriol., 2003; 185(15), 4450-4460.
Pavez P, Castillo JL, González C, Martínez M. Poly-β-hydroxyalkanoate exert a protective effect against carbon starvation and frozen conditions in Sphingopyxis chilensis. Curr. Microbiol., 2009; 59(6), 636-640.

Cantarel BL, Coutinho PM, Rancurel C, Bernard T, Lombard V, Henrissat B. The Carbohydrate-Active EnZymes database (CAZy): an expert resource for glycogenomics. Nucleic Acids Res, 2009; 37(suppl_1), D233-D238.
López-Mondéjar R, Zühlke D, Becher D, Riedel K, Baldrian P. Cellulose and hemicellulose decomposition by forest soil bacteria proceeds by the action of structurally variable enzymatic systems. Sci. Rep., 2016; 6(1), 25279.

Robledo M, Jiménez-Zurdo JI, Velázquez E, Trujillo ME, Zurdo-Piñeiro JL, Ramírez-Bahena M. H, et al. Rhizobium cellulase CelC2 is essential for primary symbiotic infection of legume host roots. Natl. Acad. Sci., 2008; 105(19), 7064-7069.

Gu S, Wei Z, Shao Z, Friman VP, Cao K, Yang T, et al. Competition for iron drives phytopathogen control by natural rhizosphere microbiomes. Nat. Microbiol., 2020; 5(8), 1002-1010.
Vick SH, Fabian BK, Dawson CJ, Foster C, Asher A, Hassan KA, et al. Delving into defence: identifying the Pseudomonas protegens Pf-5 gene suite involved in defence against secreted products of fungal, oomycete and bacterial rhizosphere competitors. Microb. Genom., 2021; 7(11), 000671.
Tostado-Islas O, Mendoza-Ortiz A, Ramírez-García G, Cabrera-Takane ID, Loarca D, Pérez-González C, et al. Iron limitation by transferrin promotes simultaneous cheating of pyoverdine and exoprotease in Pseudomonas aeruginosa. ISME J, 2021; 15(8), 2379-2389.
Andrić S, Rigolet A, Argüelles Arias A, Steels S, Hoff G, Balleux G, et al. Plant-associated Bacillus mobilizes its secondary metabolites upon perception of the siderophore pyochelin produced by a Pseudomonas competitor. ISME J, 2022; 17, 263-275.
Haas D, Défago G. Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat. Rev. Microbiol., 2005; 3(4), 307-319.
Siegień I, Bogatek R. Cyanide action in plants—from toxic to regulatory. Acta Physiol. Plant, 2006; 28(5), 483-497.
Deepika S, Mittal A, Kothamasi D. HCN‐producing Pseudomonas protegens CHA0 affects intraradical viability of Rhizophagus irregularis in Sorghum vulgare roots. J. Basic Microbiol., 2019; 59(12), 1229-1237.
Durán D, Bernal P, Vazquez-Arias D, Blanco-Romero E, Garrido-Sanz D, Redondo-Nieto M, et al. Pseudomonas fluorescens F113 type VI secretion systems mediate bacterial killing and adaption to the rhizosphere microbiome. Sci. Rep., 2021; 11(1), 5772.
Allsopp LP, Wood TE, Howard SA, Maggiorelli F, Nolan LM, Wettstadt S, et al. RsmA and AmrZ orchestrate the assembly of all three type VI secretion systems in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci., 2017; 114(29), 7707-7712.
Poveda J, Rodríguez VM, Díaz-Urbano M, Sklenář F, Saati-Santamaría Z, Menéndez E, et al. Endophytic fungi from kale (Brassica oleracea var. acephala) modify roots-glucosinolate profile and promote plant growth in cultivated Brassica species. First description of Pyrenophora gallaeciana. Front Microbiol, 2022; 3940.
Chen J, Ullah C, Reichelt M, Beran F, Yang ZL, Gershenzon J, et al. The phytopathogenic fungus Sclerotinia sclerotiorum detoxifies plant glucosinolate hydrolysis products via an isothiocyanate hydrolase. Nat. Commun., 2020; 11(1), 3090.
Li X, Jousset A, de Boer W, Carrión VJ, Zhang T, Wang X, et al. Legacy of land use history determines reprogramming of plant physiology by soil microbiome. ISME J, 2019; 13(3), 738-751.
Raetz CR, Reynolds CM, Trent MS, Bishop RE. Lipid A modification systems in gram-negative bacteria. Annu. Rev. Biochem., 2007; 76, 295.

Binder BM. Ethylene signaling in plants. J. Biol. Chem., 2020; 295(22), 7710-7725.
Gontia-Mishra I, Sapre S, Kachare S, Tiwari S. Molecular diversity of 1-aminocyclopropane-1-carboxylate (ACC) deaminase producing PGPR from wheat (Triticum aestivum) rhizosphere. Plant Soil. 2017; 414, 213-227.
Chen D, Shao Q, Yin L, Younis ., Zheng B. Polyamine function in plants: metabolism, regulation on development, and roles in abiotic stress responses. Plant Sci., 2019; 9, 1945.
Liu Z, Hossain SS., Morales Moreira Z, Haney CH. Putrescine and its metabolic precursor arginine promote biofilm and c-di-GMP synthesis in Pseudomonas aeruginosa. Bacteriol., 2022; 204(1), e00297-21.
Camejo D, Guzmán-Cedeño A, Vera-Macias L, Jiménez A. Oxidative post-translational modifications controlling plant-pathogen interaction. Plant Physiol. Biochem., 2019; 144, 110-117.
Imlay JA. The molecular mechanisms and physiological consequences of oxidative stress: lessons from a model bacterium. Rev. Microbiol., 2013; 11(7), 443-454.
Thede GL, Arthur DC, Edwards RA, Buelow DR, Wong JL, Raivio TL, et al. Structure of the periplasmic stress response protein CpxP. J. Bacteriol., 2011; 193(9), 2149-2157.
Howden AJ, Jill Harrison C, Preston GM. A conserved mechanism for nitrile metabolism in bacteria and plants. Plant J., 2009; 57(2), 243-253.
Martinez JL, Sánchez MB, Martínez-Solano L, Hernandez A, Garmendia L, Fajardo A, et al. Functional role of bacterial multidrug efflux pumps in microbial natural ecosystems. FEMS Microbiol. Rev., 2009; 33(2), 430-449.
Stoitsova SO, Braun Y, Ullrich MS, Weingart H. Characterization of the RND-type multidrug efflux pump MexAB-OprM of the plant pathogen Pseudomonas syringae. Environ. Microbiol., 2008; 74(11), 3387-3393.
Helmann TC, King DM, Lindow SE. Differential virulence contributions of the efflux transporter MexAB-OprM in Pseudomonas syringae infecting a variety of host plants. Mol. Plant Microbe Interact., 2022; 35(8), 672-680.
Xu Q, Rawlings ND, Chiu HJ, Jaroszewski L, Klock HE, Knuth MW, et al. Structural analysis of papain-like NlpC/P60 superfamily enzymes with a circularly permuted topology reveals potential lipid binding sites. PLoS One, 2011; 6(7), e22013.
Pel MJ, Pieterse CM. Microbial recognition and evasion of host immunity. J. Exp. Bot, 2013; 64(5), 1237-1248.
Kim B, Wang YC, Hespen CW, Espinosa J, Salje J, Rangan KJ, et al. Enterococcus faecium secreted antigen A generates muropeptides to enhance host immunity and limit bacterial pathogenesis. eLife, 2019; 8, e45343.
Rangan KJ, Pedicord VA, Wang YC, Kim B, Lu Y, Shaham S, et al. A secreted bacterial peptidoglycan hydrolase enhances tolerance to enteric pathogens. Sci, 2016; 353(6306), 1434-1437.

No competing interests reported.

Download PDF

Editor assigned by journal
24 Oct, 2023
Submission checks completed at journal
13 Oct, 2023
First submitted to journal
12 Oct, 2023

You are reading this latest preprint version

Revealing new bacterial functions in the plant rhizoplane

Status:

Version 1

Abstract

Figures

Background

Methods

Plant material and bacterial strain

Obtaining samples for RNA-Seq

Sequencing and RNA-Seq analyses

Greenhouse assay

Scanning electron microscopy (SEM) of the plant roots

GFP-tagged strains and confocal microscopy

Results and discussion

Switch off chemotaxis and motility mechanisms at the rhizoplane

Energy metabolism and cellular respiration during the early biofilm stage at the root surface

Influence of mutualistic interaction on the nutrient cycles

Secondary metabolism and defence systems

Adaptation to adverse factors and stresses in the plant-bacterium interaction environment

Conclusions

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1